First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Specific-CT brain template construction and retrospective dosimetric comparison study in brain for nasopharyngeal carcinoma patients treated with IMRT or VMAT.

The current Radiotherapy (RT) technology still inevitably irradiated normal brain tissue, causing implicit radiation-induced injury. This study investigates the precise localization and the corresponding radiation dosage of brain regions susceptible to damage in nasopharyngeal carcinoma (NPC) patients following RT. Utilizing the Advanced Normalization Tools (ANTs) package, a computed tomography (CT) brain template was created in the standard Montreal Neurological Institute (MNI) space, based on 803 Chinese NPC patients (T0~T4) who underwent RT. With this template, all patients' CT and RTdose data were registered to the MNI space, and the RTdose distribution characteristics in normal brain tissues were compared for NPC patients treated with Intensity-modulated radiotherapy (IMRT) or Volumetric Modulated Arc Therapy (VMAT), with patients' age and gender as covariates. Analysis of the average dosages indicated that certain areas within the Limbic, Temporal, and Posterior Lobes, the Brainstem, and the Cerebellum Posterior Lobe were exposed to doses exceeding 50 Gy. Inter-group analysis revealed that IMRT delivered higher doses than VMAT to brain regions anterior to the nasopharyngeal tumor, whereas VMAT affected the posterior regions more. Interestingly, VMAT showed a drawback in preserving the normal brain tissues for T4-stage patients. This revealed that the two treatment modalities have unique characteristics in preserving normal brain tissue, each with advantages. With better localization precision, the created CT brain template in MNI space may be beneficial for NPC patients' toxicity and dosimetric analyses.

Charge Transfer Mechanism on a Cobalt-Polyoxometalate-TiO2 Photoanode for Water Oxidation in Acid.

We constructed a photoanode comprising the homogeneous water oxidation catalyst (WOC) Na8K8[Co9(H2O)6(OH)3(HPO4)2(PW9O34)3] (Co9POM) and nanoporous n-type TiO2 photoelectrodes (henceforth "TiO2-Co9POM") by first anchoring the cationic 3-aminopropyltrimethoxysilane (APS) ligand on a metal oxide light absorber, followed by treatment of the metal oxide-APS with a solution of the polyoxometalate WOC. The resulting TiO2-Co9POM photoelectrode exhibits a 3-fold oxygen evolution photocurrent enhancement compared to bare TiO2 in aqueous acidic conditions. Three-element (Co 2p, W 4f, and O 1s) X-ray photoelectron spectroscopy and Raman spectroscopy studies before and after use indicate that surface-bound Co9POM retains its structural integrity throughout all photoelectrochemical water oxidation studies reported here. Extensive charge-transfer mechanistic studies by photoelectrochemical techniques and transient absorption spectroscopy elucidate that Co9POM serves as an efficient WOC, extracting photogenerated holes from TiO2 on the picosecond time scale. This is the first comprehensive mechanistic investigation elucidating the roles of polyoxometalates in POM-photoelectrode hybrid oxygen evolution reaction systems.

Noninvasive in vivo microscopy of single neutrophils in the mouse brain via NIR-II fluorescent nanomaterials.

In vivo microscopy of single cells enables following pathological changes in tissues, revealing signaling networks and cell interactions critical to disease progression. However, conventional intravital microscopy at visible and near-infrared wavelengths <900 nm (NIR-I) suffers from attenuation and is typically performed following the surgical creation of an imaging window. Such surgical procedures cause the alteration of the local vasculature and induce inflammation in skin, muscle and skull, inevitably altering the microenvironment in the imaging area. Here, we detail the use of near-infrared fluorescence (NIR-II, 1,000-1,700 nm) for in vivo microscopy to circumvent attenuation in living tissues. This approach enables the noninvasive visualization of cell migration in deep tissues by labeling specific cells with NIR-II lanthanide downshifting nanoparticles exhibiting high physicochemical stability and photostability. We further developed a NIR-II fluorescence microscopy setup for in vivo imaging through the intact skull with high spatiotemporal resolution, which we use for the real-time dynamic visualization of single-neutrophil behavior in the deep brain of a mouse model of ischemic stroke. The labeled downshifting nanoparticle synthesis takes 5-6 d, the imaging system setup takes 1-2 h, the in vivo cell labeling takes 1-3 h, the in vivo NIR-II microscopic imaging takes 3-5 h and the data analysis takes 3-8 h. The procedures can be performed by users with standard laboratory training in nanomaterials research and appropriate animal handling.

Mixed-Transducer Micro-Origami for Efficient Motion and Decoupled Sensing.

This work introduces a mixed-transducer micro-origami to achieve efficient vibration, controllable motion, and decoupled sensing. Existing micro-origami systems tend to have only one type of transducer (actuator/sensor), which limits their versatility and functionality because any given transducer system has a narrow range of advantageous working conditions. However, it is possible to harness the benefit of different micro-transducer systems to enhance the performance of functional micro-origami. More specifically, this work introduces a micro-origami system that can integrate the advantages of three transducer systems: strained morph (SM) systems, polymer based electro-thermal (ET) systems, and thin-film lead zirconate titanate (PZT) systems. A versatile photolithography fabrication process is introduced to build this mixed-transducer micro-origami system, and their performance is investigated through experiments and simulation models. This work shows that mixed-transducer micro-origami can achieve power efficient vibration with high frequency, large vibration ranges, and little degradation; can produce decoupled folding motion with good controllability; and can accomplish simultaneous sensing and actuation to detect and interact with external environments and small-scale samples. The superior performance of mixed-transducer micro-origami systems makes them promising tools for micro-manipulation, micro-assembly, biomedical probes, self-sensing metamaterials, and more.

Novel dual action PARP and microtubule polymerization inhibitor AMXI-5001 powerfully inhibits growth of esophageal carcinoma both alone and in combination with radiotherapy.

Esophageal cancer is one of the leading causes of cancer deaths globally with an incidence that is concentrated in specific hot spots in Eastern Asia, the Middle East, Eastern Africa, and South America. 10-year overall survival for patients treated with standard of care chemoradiation followed by surgical resection is below 40% highlighting the need for novel therapeutics to treat this disease. We assessed the effect of AMXI-5001, a novel small molecule poly ADP-Ribose polymerase (PARP) inhibitor and microtubule polymerization inhibitor on tumor growth inhibition in both in-vitro and in-vivo murine models. We found that AMXI-5001 was the most potent growth inhibitor of 8 out of 9 different esophageal carcinoma cell lines compared to other clinically available PARP inhibitors, Olaparib, Niraparib, Rucaparib, and Talazoparib. We then confirmed the previously described mechanism of action of AMXI-5001 as a PARP-inhibitor and microtubule polymerization inhibitor using both a PARP trapping assay and immunofluorescence. To further assess AMXI-5001's potential as a therapeutic for esophageal carcinoma we evaluated the effect of AMXI-5001 in combination with standard chemotherapy agents, Cisplatin and 5 Fluorouracil. We showed that AMXI-5001 synergistically inhibits growth in KYSE-70, a squamous esophageal cell line in combination with these drugs. In addition, we found that AMXI-5001 was an effective radiosensitizer, and squamous esophageal carcinoma cell lines treated 24 hours prior to external beam radiation showed significantly more growth inhibition compared to controls. Finally, we assessed the effect of AMXI-5001 monotherapy and in combination with radiotherapy in a xenograft mouse model implanted with subcutaneous KYSE-70 cells. Compared to vehicle control, and those treated with either AMXI-5001 alone or radiation alone, mice treated with both AMXI-5001 and radiation had significant tumor response. In conclusion, AMXI-5001 is an orally bioavailable dual-action PARP and microtubule polymerization inhibitor that holds promise in the treatment of esophageal carcinoma.

The Sequence Characteristics and Binding Properties of the Odorant-Binding Protein SvelOBP1 from Sympiezomias velatus (Coleoptera: Curculionidae) to Jujube Volatiles.

Sympiezomias velatus (Chevrolat) (Coleoptera: Curculionidae) has caused serious damage on jujube trees (Ziziphus jujuba Mill) in northern China. Semiochemicals emerging from the host are essential in the process of insects identifying and localizing the host. The highly expressed odorant-binding protein 1 of S. velatus (SvelOBP1) was assumed to play a possible role in the recognition of host volatiles. In this study, SvelOBP1 was cloned based on the antennal transcriptome of S. velatus. The recombinant SvelOBP1 protein was expressed in Escherichia coli and purified by Ni-NTA resin. The predicted protein SvelOBP1 belonged to a classic OBP subfamily. The expression patterns revealed that SvelOBP1 was mainly expressed in the antennae of both males and females, whereas the expression of SvelOBP1 in other body parts could be neglected. The fluorescence binding assay indicated that SvelOBP1 displayed very strong binding affinities to dibutyl benzene-1,2-dicarboxylate and (Z)-hex-3-en-1-ol (Ki = 6.66 ± 0.03 and 7.98 ± 0.06 µM). The molecular docking results showed that residues Trp114, Phe115 and Asp110 may be involved in binding to both dibutyl benzene-1,2-dicarboxylate and (Z)-hex-3-en-1-ol and may have a great impact on odorant recognition of S. velatus. Our results provide evidence that SvelOBP1 might participate in the olfactory molecular perception of S. velatus and would promote the development of pest attractants for S. velatus control.

Single isocenter versus dual isocenter treatment using flattening filter-free and jaw-tracking volumetrically modulated arc therapy for boot-shaped lung cancer: Evaluation of dosimetric and feasibility.

BACKGROUND: To determine whether a dual-isocenter volumetrically modulated arc therapy (VMAT) technique results in lower normal pulmonary dosage compared to a traditional single isocenter technique for boot-shaped lung cancer. METHODS: A cohort of 15 patients with advanced peripheral or central lung cancer who had metastases in the mediastinum and supraclavicular lymph nodes was randomly selected for this retrospective study. VMAT plans were generated for each patient using two different beam alignment techniques with the 6-MV flattening filter-free (FFF) photon beam: single-isocenter jaw-tracking VMAT based on the Varian TrueBeam linear accelerator (S-TV), and dual-isocenter VMAT based on both TrueBeam (D-TV) and Halcyon linear accelerator (D-HV). For all 45 treatment plans, planning target volume (PTV) dose coverage, conformity/homogeneity index (CI/HI), mean heart dose (MHD), mean lung dose (MLD) and the total lung tissue receiving 5, 20, 30 Gy (V5, V20, V30) were evaluated. The monitor units (MUs), delivery time, and plan quality assurance (QA) results were recorded. RESULTS: The quality of the objectives of the three plans was comparable to each other. In comparison with S-TV, D-TV and D-HV improved the CI and HI of the PTV (p < 0.05). The MLD was 13.84 ± 1.44 Gy (mean ± SD) for D-TV, 14.22 ± 1.30 Gy and 14.16 ± 1.42 Gy for S-TV and D-HV, respectively. Lungs-V5Gy was 50.78 ± 6.24%, 52.00 ± 7.32% and 53.36 ± 8.48%, Lungs-V20Gy was 23.72 ± 2.27%, 26.18 ± 2.86% and 24.96 ± 3.09%, Lungs-V30Gy was 15.69 ± 1.76%, 17.20 ± 1.72% and 16.52 ± 2.07%. Compared to S-TV, D-TV provided statistically significant better protection for the total lung, with the exception of the lungs-V5. All plans passed QA according the gamma criteria of 3%/3 mm. CONCLUSIONS: Taking into account the dosimetric results and published clinical data on radiation-induced pulmonary injury, dual-isocenter jaw-tracking VMAT may be the optimal choice for treating boot-shaped lung cancer.

A variant of the venom allergen-like protein, DdVAP2, is required for the migratory endoparasitic plant nematode Ditylenchus destructor parasitism of plants.

The potato rot nematode, Ditylenchus destructor, poses a serious threat to numerous root and tuber crops, yet the functional characterization of effectors from this migratory endoparasitic plant nematode remains limited. Despite inhabiting distinct habitats, sedentary and migratory plant parasitic nematodes share the structurally conserved effectors, such as venom allergen-like proteins (VAPs). In this study, a variant of DdVAP2 was cloned from D. destructor. The transcription profile analysis revealed that DdVAP2 was higher expressed in D. destructor feeding on either potato or sweet potato compared to on fungus via qRT-PCR. And DdVAP2 was highly expressed at all life stages feeding on sweet potato, except for eggs. DdVAP2 was confirmed to be specifically expressed in the subventral esophageal glands of D. destructor through in situ hybridization assays. Combined with functional validation of the signal peptide of DdVAP2, it suggested that DdVAP2 could be secreted from nematode into host. Heterologous expression of DdVAP2 in Nicotiana benthamiana revealed that the protein localized in both cytosol and nuclei of plant cells. Knocking down DdVAP2 by RNAi in D. destructor resulted in infection and reproduction defects on plants. All the results suggest that DdVAP2 plays a crucial role in the interaction between D. destructor and plants by facilitating the nematode infection.

Synaptotagmin-11 regulates immune functions of microglia in vivo.

Membrane trafficking pathways mediate key microglial activities such as cell migration, cytokine secretion, and phagocytosis. However, the underlying molecular mechanism remains poorly understood. Previously, we found that synaptotagmin-11 (Syt11), a non-Ca2+ -binding Syt associated with Parkinson's disease (PD) and schizophrenia, inhibits cytokine release and phagocytosis in primary microglia. Here we reported the in vivo function of Syt11 in microglial immune responses using an inducible microglia-specific Syt11-conditional-knockout (cKO) mouse strain. Syt11-cKO resulted in activation of microglia and elevated mRNA levels of IL-6, TNF-α, IL-1ß, and iNOS in various brain regions under both resting state and LPS-induced acute inflammation state in adult mice. In a PD mouse model generated by microinjection of preformed α-synuclein fibrils into the striatum, a reduced number of microglia migrated toward the injection sites and an enhanced phagocytosis of α-synuclein fibrils by microglia were found in Syt11-cKO mice. To understand the molecular mechanism of Syt11 function, we identified its direct binding proteins vps10p-tail-interactor-1a (vti1a) and vti1b. The linker domain of Syt11 interacted with both proteins and a peptide derived from it competitively inhibited the interaction of Syt11 with vti1a/vti1b in vitro and in cells. Importantly, application of this peptide induced more cytokine secretion in wild-type microglia upon LPS treatment, phenocopying defects in Syt11 knockdown cells. Altogether, we propose that Syt11 inhibits microglial activation in vivo and regulates cytokine secretion through interactions with vti1a and vti1b.

Free radical-mediated extraction of polysaccharides from Gelidium amansii and their modulation on abnormal glycometabolism in Caenorhabditis elegans.

An improved Fenton-microwave synergistic method was employed to extract polysaccharides from Gelidium amansii (GAPs), which were subsequently purified through alcohol precipitation, deproteinization, and gel chromatography. The effects of GAPs on oxidative stress resistance and abnormal glycometabolism were investigated using Caenorhabditis elegans. The polysaccharide yield reached 54.17 % ± 0.27 % under the following conditions: solid-liquid ratio of 1:102 g/mL, temperature of 80 °C, H2O2 concentration of 1.0 %, microwave power of 700 W, and 33 min. The purified GAPs were heteropolysaccharides primarily composed of mannose, ribose, glucuronic acid, glucose, galactose, xylose, and arabinose, with a molar ratio of 0.287:0.524:0.634:2.646:89.649:5.416:0.463. The weight-average and numerical-average molecular weights of the GAPs were determined to be 142.800 kDa and 75.255 kDa, respectively. Treatment of C. elegans with GAPs at 2.0 mg/mL resulted in a significant extension of the mean lifespan by 53.85 % compared to the negative control (p < 0.05). Furthermore, GAPs exhibited notable enhancements in the antioxidant system, including SOD by 56.90 % and CAT by 96.83 % (p < 0.05). Additionally, GAPs led to reductions in glucose-related metabolites, including glucose levels by 34.54 % and pyruvic acid levels by 149.54 % (p < 0.05). These findings demonstrate the excellent performance of GAPs in enhancing the antioxidant system and regulating abnormal glycometabolism.

A research on the improved rotational robustness for thoracic organ delineation by using joint learning of segmenting spatially-correlated organs: A U-net based comparison.

PURPOSE: To study the improved rotational robustness by using joint learning of spatially-correlated organ segmentation (SCOS) for thoracic organ delineation. The network structure is not our point. METHODS: The SCOS was implemented in a U-net-like model (abbr. SCOS-net) and evaluated on unseen rotated test sets. Two hundred sixty-seven patients with thoracic tumors (232 without rotation and 35 with rotation) were enrolled. The training and validation images came from 61 randomly chosen unrotated patients. The test data included two sets. One consisted of 3000 slices from the rest 171 unrotated patients. They were rotated by us by -30°âˆ¼30°. One was the images from the 35 rotated patients. The lung, heart, and spinal cord were delineated by experienced radiation oncologists and regarded as ground truth. The SCOS-net was compared with its single-task learning counterparts, two published multiple learning task settings, and rotation augmentation. Dice, 3 distance metrics (maximum and 95th percentile of Hausdorff distances and average surface distance (ASD)) and the number of cases where ASD = infinity were adopted. We analyzed the results using visualization techniques. RESULTS: In terms of no augmentation, the SCOS-net achieves the best lung and spinal cord segmentations and comparable heart delineation. With augmentation, SCOS performs better in some cases. CONCLUSION: The proposed SCOS can improve rotational robustness, and is promising in clinical applications for its low network capacity and computational cost.

Cooperative regulation of Zhx1 and hnRNPA1 drives the cardiac progenitor-specific transcriptional activation during cardiomyocyte differentiation.

The zinc finger proteins (ZNFs) mediated transcriptional regulation is critical for cell fate transition. However, it is still unclear how the ZNFs realize their specific regulatory roles in the stage-specific determination of cardiomyocyte differentiation. Here, we reported that the zinc fingers and homeoboxes 1 (Zhx1) protein, transiently expressed during the cell fate transition from mesoderm to cardiac progenitors, was indispensable for the proper cardiomyocyte differentiation of mouse and human embryonic stem cells. Moreover, Zhx1 majorly promoted the specification of cardiac progenitors via interacting with hnRNPA1 and co-activated the transcription of a wide range of genes. In-depth mechanistic studies showed that Zhx1 was bound with hnRNPA1 by the amino acid residues (Thr111-His120) of the second Znf domain, thus participating in the formation of cardiac progenitors. Together, our study highlights the unrevealed interaction of Zhx1/hnRNPA1 for activating gene transcription during cardiac progenitor specification and also provides new evidence for the specificity of cell fate determination in cardiomyocyte differentiation.

Effects of different n-6/n-3 polyunsaturated fatty acids ratios on lipid metabolism in patients with hyperlipidemia: a randomized controlled clinical trial.

Background and aims: Intake of n-3 polyunsaturated fatty acids (PUFA) is helpful for cardiometabolic health. It improves lipid metabolism, and increasing n-3 PUFA is often considered beneficial. However, the role of n-6/n-3 in the regulation of lipid metabolism has been much debated. Therefore, this study was performed on the effect of different proportions of n-6/n-3 diet on lipid metabolism, and quality of life in patients with hyperlipidemia, aiming to explore appropriate proportions of n-6/n-3 to provide the theoretical basis for the development and application of nutritional blended oil in the future. Methods: These 75 participants were randomized and assigned into three groups, which received dietary oil with high n-6/n-3 PUFA ratios (HP group: n-6/n-3 = 7.5/1), dietary oil with middle n-6/n-3 PUFA ratios (MP group: n-6/n-3 = 2.5/1) or low n-6/n-3 PUFA ratios (LP group: n-6/n-3 = 1/2.5). All patients received dietary guidance and health education were monitored for hyperlipidemia. Anthropometric, lipid and blood glucose parameters and quality of life were assessed at baseline and 60 days after intervention. Result: After 60 days, high-density lipoprotein cholesterol (HDL-c) level was increased (p = 0.029) and Total cholesterol (TC) level was decreased (p = 0.003) in the MP group. In the LP group, TC level was decreased (p = 0.001), TG level was decreased (p = 0.001), but HDL-c level was not significantly increased. At the end of intervention, quality of life' score was improved in both MP and LP groups (p = 0.037). Conclusion: Decreasing the intake of edible oil n-6/n-3 ratio can improve blood lipids and quality of life. This is significant for the prevention of cardiovascular disease (CVD). It is also essential to note that an excessive reduction of the n-6/n-3 ratio does not further improve the blood lipid metabolism. In addition, the application of perilla oil in nutritional blended oil has particular significance. Clinical trial registration: https://www.chictr.org.cn/indexEN.html, identifier ChiCTR-2300068198.

Fluorescence-amplified nanocrystals in the second near-infrared window for in vivo real-time dynamic multiplexed imaging.

Optical imaging in the second near-infrared window (NIR-II, 1,000-1,700 nm) holds great promise for non-invasive in vivo detection. However, real-time dynamic multiplexed imaging remains challenging due to the lack of available fluorescence probes and multiplexing techniques in the ideal NIR-IIb (1,500-1,700 nm) 'deep-tissue-transparent' sub-window. Here we report on thulium-based cubic-phase downshifting nanoparticles (α-TmNPs) with 1,632 nm fluorescence amplification. This strategy was also validated for the fluorescence enhancement of nanoparticles doped with NIR-II Er3+ (α-ErNPs) or Ho3+ (α-HoNPs). In parallel, we developed a simultaneous dual-channel imaging system with high spatiotemporal synchronization and accuracy. The NIR-IIb α-TmNPs and α-ErNPs facilitated the non-invasive real-time dynamic multiplexed imaging of cerebrovascular vasomotion activity and the single-cell-level neutrophil behaviour in mouse subcutaneous tissue and ischaemic stroke model.

Identification and sex-specific expression of chemosensory genes in the antennal transcriptomes of Pachyrhinus yasumatsui (Coleoptera: Curculionidae).

Pachyrhinus yasumatsui Kono et Morimoto is a major pest of Chinese jujube, which is widespread in northern China and causes severe economic losses in the jujube industry. Chemosensory genes play crucial roles in insect behaviors. Currently, little is known about chemosensory genes in P. yasumatsui. In the present study, antennal transcriptomes of female and male adult P. yasumatsui were annotated. In total, 113 genes involved in chemosensory functions were identified, including 41 odorant receptors, 28 odorant-binding proteins, 16 ionotropic receptors, 15 chemosensory proteins, 9 gustatory receptors, and 4 sensory neuron membrane proteins. Subsequently, the phylogenetic analyses of these olfactory-related proteins in P. yasumatsui were conducted using multiple sequence alignment. Furthermore, sex-specific expression levels of 113 genes were analyzed based on fragments per kilobase of transcript per million mapped reads (FPKM). Then, the quantitative real-time PCR (RT-qPCR) was used to quantify gene expression profiles of 28 P. yasumatsui OBPs (PyasOBPs) and 15 CSPs (PyasCSPs). The results revealed that 20 PyasOBPs and 13 PyasCSPs exhibited significantly higher expression in the antennae than in the bodies, suggesting that they might have functions in olfaction. Moreover, some OBPs and CSPs (PyasOBP6, PyasOBP7, PyasOBP16, PyasOBP21, and PyasCSP4) exhibited female-biased expression, indicating that they might take part in several female-specific behaviors. This study will promote the understanding of olfactory mechanism in P. yasumatsui, and our findings lay the groundwork for developing environmentally friendly pest management measures.

Noninvasive Early Diagnosis of Allograft Rejection by a Granzyme B Protease Responsive NIR-II Bioimaging Nanosensor.

Early diagnosis of allograft rejection helps to improve the immune-related management of transplant recipients. The clinically-used core needle biopsy method is invasive and subject to sampling error. In vivo fluorescence imaging for monitoring immune-related processes has the advantages of non-invasiveness, fast feedback and high sensitivity. Herein, we report a responsive second near-infrared (NIR-II) fluorescent nanosensor (ErGZ) to detect early allograft rejection. ErGZ allows ratiometric in vivo fluorescence sensing of granzyme B, which is overexpressed in recipients' T cells during the onset of rejection. The sensor demonstrates efficacious detection of allograft rejection with high sensitivity and specificity, which accomplishes non-invasive diagnosis of rejection in skin and deep buried islets transplant mice models 2 d and 5 d earlier than biopsy, by in vivo fluorescence imaging and urinary detection, respectively, providing a valuable approach for therapeutical management.

First Record of Meloidogyne incognita on Maize (Zea mays) in Shaanxi Province of China.

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it's more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

Comparison of intratumor and local immune response between MV X-ray FLASH and conventional radiotherapies.

Background/Purpose: Investigating the antitumor effect and intratumor as well as local immune response in breast cancer-bearing mice after MV X-ray ultra-high dose rate radiotherapy (FLASH-RT) and conventional dose rate radiotherapy (CONV-RT). Materials/Methods: Six-week-old female C57BL/6 mice were inoculated subcutaneously with Py8119 and Py230 breast tumor cells in the inguinal mammary gland and administered 10 Gy abdominal 6 MV X-ray FLASH-RT (125 Gy/s) or CONV-RT (0.2 Gy/s) 15 days after tumor inoculation. Tumor and spleen tissues were obtained at different time points post-irradiation (PI) for analysis of immune cell infiltration using flow cytometry and immunohistochemical (IHC) staining. Intestine tissues were collected 3 days PI to evaluate normal tissue damage and immune cell infiltration. Results: Both FLASH-RT and CONV-RT significantly delayed tumor growth. Flow cytometry showed increased CD8+/CD3 + and CD8+/CD4 + ratios, and IHC confirmed a similar increased CD8 + T cell infiltration at 2 weeks PI in Py8119 tumor tissues in both irradiation groups. No statistical difference was observed between the irradiation groups in terms of tumor growth and increased T cell infiltration in the tumor. Unexpectedly, significantly smaller spleen weight and substantially higher CD8+/CD3 + and lower CD4+/CD3 + ratios were observed in the spleens of the FLASH-RT group than in the spleens of the non-irradiated control and CONV-RT groups 4 weeks PI. Pathological analysis revealed severe red pulp expansion in several spleens from the CONV-RT group, but not in the spleens of the FLASH-RT group. Reduced intestinal damage, macrophage and neutrophil infiltration were observed in the FLASH-RT group compared with CONV-RT group. Conclusions: FLASH-RT and CONV-RT effectively suppressed tumor growth and promoted CD8 + T cell influx into tumors. FLASH-RT can induce different splenic immune responses and reduce radiation-induced damage in the spleen and intestine, which may potentially enhance the therapeutic ratio of FLASH-RT.

LncCMRR Plays an Important Role in Cardiac Differentiation by Regulating the Purb/Flk1 Axis.

As crucial epigenetic regulators, long noncoding RNAs (lncRNAs) play critical functions in development processes and various diseases. However, the regulatory mechanism of lncRNAs in early heart development is still limited. In this study, we identified cardiac mesoderm-related lncRNA (LncCMRR). Knockout (KO) of LncCMRR decreased the formation potential of cardiac mesoderm and cardiomyocytes during embryoid body differentiation of mouse embryonic stem (ES) cells. Mechanistic analyses showed that LncCMRR functionally interacted with the transcription suppressor PURB and inhibited its binding potential at the promoter region of Flk1, which safeguarded the transcription of Flk1 during cardiac mesoderm formation. We also carried out gene ontology term and signaling pathway enrichment analyses for the differentially expressed genes after KO of LncCMRR, and found significant correlation of LncCMRR with cardiac muscle contraction, dilated cardiomyopathy, and hypertrophic cardiomyopathy. Consistently, the expression level of Flk1 at E7.75 and the thickness of myocardium at E17.5 were significantly decreased after KO of LncCMRR, and the survival rate and heart function index of LncCMRR-KO mice were also significantly decreased as compared with the wild-type group. These findings indicated that the defects in early heart development led to functional abnormalities in adulthood heart of LncCMRR-KO mice. Conclusively, our findings elucidate the main function and regulatory mechanism of LncCMRR in cardiac mesoderm formation, and provide new insights into lncRNA-mediated regulatory network of mouse ES cell differentiation.