Differential analysis of immunoglobulin gene expression pattern in chickens of distinct breeds and developmental periods.

Immunoglobulin is an essential component of the body's defense against pathogens, aiding in the recognition and clearance of foreign antigens. Research concerning immunoglobulin gene and its diversity of expression across different breeds within the same species is relatively scarce. In this study, we employed RACE (Rapid Amplification of cDNA Ends) technology, prepared DNA libraries, performed high-throughput sequencing, and conducted related bioinformatics analysis to analyze the differences in immunoglobulin gene diversity and expression at different periods in Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens. The study found that the composition of chicken immunoglobulin genes is relatively simple, with both the light chain and heavy chain having a functional V gene. Additionally, the mechanisms of immunoglobulin diversity generation tended to be consistent among different breeds and periods of chickens, primarily relying on abundant junctional diversity, somatic hypermutation (SHM), and gene conversion (GCV) to compensate for the limitations of low-level V(D)J recombination. As the age increased, the junctional diversity of IgH and IgL tended to diversify and showed similar expression patterns among different breeds. In the three chicken breeds, the predominant types of mutations observed in IGHV and IGLV SHM were A to G and G to A transitions. Specifically, IGLV exhibited a preference for A to G mutations, whereas IGHV displayed a bias toward G to A mutations. The regions at the junctions between framework regions (FR) and complementarity-determining regions (CDR) and within the CDR regions themselves are typically prone to mutations. The locations of GCV events in IGLV and IGHV do not show significant differences, and replacement segments are concentrated in the central regions of FR1, CDR, and FR2. Importantly, gene conversion events are not random occurrences. Additionally, our investigation revealed that CDRH3 in chickens of diverse breeds and periods the potential for diversification through the incorporation of cysteine. This study demonstrates that the diversity of immunoglobulin expression tends to converge among Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens, indicating that the immunoglobulin gene expression mechanisms in different breeds of chickens do not exhibit significant differences due to selective breeding.

Immunoglobulins play a key role in the organism's defense against pathogens, and their diverse expression allows the body to generate a wide array of antibodies. This diversity serves as a critical safeguard for the immune system against various pathogens. Natural geographical variances and artificial breeding and selection can potentially lead to different immune responses in distinct populations of the same species when confronted with the same pathogen. In this study, we investigated the diversity of immunoglobulin gene expression in the natural state of different chicken breeds (Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens) and at different periods from the perspective of immunoglobulin gene expression mechanism. We analyzed the diversity of immunoglobulin based on the results of high-throughput sequencing by extracting Fabricius bursa RNA, RACE (Rapid Amplification of cDNA Ends) technique, and constructing DNA libraries. Our study reveals that the junctional diversity, somatic hypermutation, CDR3 diversity, and gene conversion expression of immunoglobulins in Hy-line brown hens, Lueyang black-bone chickens, and Beijing-You chickens converge during the same time period. This indicates that the immunoglobulin gene expression mechanisms in different chicken breeds do not exhibit significant variations as a result of selective breeding.

Effect of Five Different Antioxidants on the Effectiveness of Goat Semen Cryopreservation.

The effective combination of semen cryopreservation and artificial insemination has a positive effect on the conservation of germplasm resources, production and breeding, etc. However, during the process of semen cryopreservation, the sperm cells are very susceptible to different degrees of physical, chemical, and oxidative stress damage. Oxidative damage is the most important factor that reduces semen quality, which is affected by factors such as dilution equilibrium, change of osmotic pressure, cold shock, and enzyme action during the freezing-thawing process, which results in the aggregation of a large amount of reactive oxygen species (ROS) in sperm cells and affects the quality of semen after thawing. Therefore, the method of adding antioxidants to semen cryoprotective diluent is usually used to improve the effect of semen cryopreservation. The aim of this experiment was to investigate the effects of adding five antioxidants (GLP, Mito Q, NAC, SLS, and SDS) to semen cryoprotection diluent on the cryopreservation effect of semen from Saanen dairy goats. The optimal preservation concentrations were screened by detecting sperm viability, plasma membrane integrity, antioxidant capacity, and acrosomal enzyme activities after thawing, and the experimental results were as follows: the optimal concentrations of GLP, Mito Q, NAC, SLS, and SDS added to semen cryopreservation diluent at different concentrations were 0.8 mg/mL, 150 nmol/L, 0.6 mg/mL, 0.15 mg/ mL, 0.6 mg/mL, and 0.15 mg/mL. The optimal concentrations of the five antioxidants were added to the diluent and analyzed after 1 week of cryopreservation, and it was found that sperm viability, plasma membrane integrity, and mitochondrial activity were significantly enhanced after thawing compared with the control group (P < 0.05), and their antioxidant capacity was significantly enhanced (P < 0.05). Therefore, the addition of the above five antioxidants to goat sperm cryodilution solution had a better enhancement of sperm cryopreservation. This study provides a useful reference for exploring the improvement of goat semen cryoprotection effect.

Expression of different genotypes of bovine TRDMT1 gene and its polymorphisms association with body measures in Qinchuan cattle (Bos Taurus).

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.

RNA-seq Based Transcriptome Analysis Reveals The Cross-Talk of Macrophage and Adipocyte of Chicken Subcutaneous Adipose Tissue during The Embryonic and Post-Hatch Period.

With high fecundity and short production cycle, poultry is one of the important sources of meat. During the embryonic and post-hatch period, the higher death rate caused huge economic losses in poultry production. Our previous study showed that chick subcutaneous adipose tissue is an important energy supply tissue besides yolk. Therefore, the metabolic mechanism of subcutaneous adipose tissue in chicks could provide a new perspective of brooding. The objectives of the current study were to evaluate the differences between chick subcutaneous adipose tissue and abdominal adipose tissue before and after hatching and reveal the cross-talk of different cells within the chick subcutaneous adipose tissue. The results of RNA-seq and weighted gene co-expression network analysis (WGCNA) of chick subcutaneous and abdominal adipose tissues showed that the function of chick subcutaneous tissue was related to immunoreaction, and macrophage could be the major immune infiltration cell type in chicken subcutaneous adipose tissue, which were also verified by qPCR, HE stain, and IHC. The results of free fatty acids (FFAs)-induced the cross-talk between macrophages and adipocytes showed that FFAs-Ccl2 (chicken CCL26) axis could have an important role in lipid transportation in adipose tissue. The results of Oil Red O and Nile red stain demonstrated that macrophages have the ability to absorb FFAs quickly. Interestingly, according to the genomic organization of CCL family with representative vertebrate species, we found that chicken CCL26 could be the major chemokine in chicken adipocyte as the status of CCL2 in mammal adipocyte. In conclusion, we demonstrate that FFA-induced Ccl2 (chicken CCL26) secretion is crucial in determining fat depot-selective adipose tissue macrophage (ATM) infiltration, which could be an important medium of lipid transportation in chicken subcutaneous adipose tissue. These findings may have multiple important implications for understanding macrophage biology with chick subcutaneous adipose tissue and provide theoretical basis for lipid metabolism in poultry brooding.

Organization and Complexity of the Yak (Bos Grunniens) Immunoglobulin Loci.

As important livestock in Qinghai-Tibet Plateau, yak provides meat and other necessities for Tibetans living. Plateau yak has resistance to diseases and stress, yet is nearly unknown in the structure and expression mechanism of yak immunoglobulin loci. Based on the published immunoglobulin genes of bovids (cattle, sheep and goat), the genomic organization of the yak immunoglobulin heavy chain (IgH) and immunoglobulin light chain (IgL) were described. The assemblage diversity of IgH, Igλ and Igκ in yak was similar to that in bovids, and contributes little to the antibody lineage compared with that in humans and mice. Somatic hypermutation (SHM) had a greater effect on immunoglobulin diversity in yak than in goat and sheep, and in addition to the complementarity-determining region (CDR), some loci in the framework region (FR) also showed high frequency mutations. CDR3 diversity showed that immunological lineages in yak were overwhelmingly generated through linkage diversity in IgH rearrangements. The emergence of new high-throughput sequencing technologies and the yak whole genome (2019) publication have greatly improved our understanding of the immune response in yaks. We had a more comprehensive analysis of yak immunoglobulin expression diversity by PE300, which avoided the disadvantage of missing low-frequency recombination in traditional Sanger sequencing. In summary, we described the schematic structure of the genomic organization of yak IgH loci and IgL loci. The analysis of immunoglobulin expression diversity showed that yak made up for the deficiency of V(D)J recombinant diversity by junctional diversity and CDR3 diversity. In addition, yak, like cattle, also had the same ultra-long IgH CDR3 (CDR3H), which provided more contribution to the diverse expression of yak immunoglobulin. These findings might provide a theoretical basis for disease resistance breeding and vaccine development in yak.

A novel 17 bp InDel polymorphism within the PPARGC1A gene is significantly associated with growth traits in sheep.

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Small RNA-Seq Analysis Reveals miRNA Expression of Short Distance Transportation Stress in Beef Cattle Blood.

Transportation is a crucial phase in the beef cattle industry, and the annual losses caused by beef cattle transport stress are substantial. Because of its huge economic losses, such as lower growth rate and even death, long-distance transportation stress has attracted more attention from beef production practitioners because of its huge economic losses. Compared with the long-distance transportation stress, the short-distance transportation stress was ignored for the reason of no obvious symptoms in cattle. Our previous study showed that the disorder of B cell function could be a potential health risk after short-distance transportation. However, the transcriptome details of the changes in the cattle blood after short-distance transportation and the molecular mechanisms for the regulation of the developmental process are not clearly known. In this study, a total of 10 Qinchuan cattle were used to compare the molecular characteristics of blood before and after short-distance transportation. The miRNA-seq showed that 114 differentially expressed miRNAs (DEMs) were found (40 upregulated and 74 downregulated) between two groups before and after transportation. Furthermore, more than 90% of the miRNAs with counts of more than 10 were used to construct a co-expression network by weighted correlation network analysis (WGCNA), and four independent modules were identified. According to their relationship with 30 hub genes, the turquoise module was the key module in this study. The regulator network of hub genes and miRNAs in the turquoise module was constructed by miRNAs targeting genes predicting, and the miRNAs had targeting sites within hub genes that could be identified as hub-miRNAs. Further, it showed that CD40 and ITPKB had the same targeting miRNAs (miR-339a/b), and the newly discovered hub miRNAs filled the gaps in our previous study about the relationship between hub genes in short-distance transportation stress and provided the potential utility for predicting and treatment of short-distance transportation stress in beef cattle.

Function of Chick Subcutaneous Adipose Tissue During the Embryonic and Posthatch Period.

Since excess abdominal fat is one of the main problems in the broiler industry for the development of modern broiler and layer industry, the importance of subcutaneous adipose tissue has been neglected. However, chick subcutaneous adipose tissue appeared earlier than abdominal adipose tissue and more than abdominal adipose tissue. Despite a wealth of data, detailed information is lacking about the development and function of chick subcutaneous adipose tissue during the embryonic and posthatch period. Therefore, the objective of the current study was to determine the developmental changes of adipocyte differentiation, lipid synthesis, lipolysis, fatty acid ß-oxidation, and lipid contents from E12 to D9.5. The results showed that subcutaneous adipose tissue was another important energy supply tissue during the posthatch period. In this stage, the mitochondrial copy number and fatty acid ß-oxidation level significantly increased. It revealed that chick subcutaneous adipose tissue not only has the function of energy supply by lipidolysis but also performs the same function as brown adipose tissue to some extent, despite that the brown adipose tissue does not exist in birds. In addition, this finding improved the theory of energy supply in the embryonic and posthatch period and might provide theoretical basis on physiological characteristics of lipid metabolism in chicks.

Detection of genetic variation and activity analysis of the promoter region of the cattle tRNA-modified gene TRDMT1.

The tRNA modification gene in eukaryotes is relatively conservative. As an important modification gene, the TRDMT1 gene plays an important role in maintaining tRNA structural maintenance and reducing mistranslation of protein translation by methylation of specific tRNA subpopulations. Mouse and zebrafish TRDMT1 knockout experiments indicate that it may mediate growth and development through tRNA modification. However, there are no systematic reports on the function of tRNA-modified genes in livestock. In this study, Qinchuan cattle DNA pool sequencing technology was used. A G > C mutation in the - 1223  bp position upstream of the TRDMT1 translation initiator codon was found. At this locus, the dual-luciferase assay indicated that different genotypes cause differences in transcriptional activity ( P < 0.05 ). Our experiment detected a natural genetic variation of a tRNA modification gene TRDMT1, which may provide potential natural molecular materials for the study of tRNA modification.

Transcriptome Characterization of Short Distance Transport Stress in Beef Cattle Blood.

The transportation is a crucial phase in beef cattle industry, and the annual losses caused by beef cattle transport stress are substantial. Several studies have described the effect of long distance transportation stress on animal health, such as disorder in nervous, endocrine, immune, and metabolic system. However, molecular mechanisms underlying short distance transportation stress is still poorly understood. Present study aims to investigate the effect of short distance transportation by measuring the hematological indices and transcriptomic analysis. In this study, a total 10 Qinchuan cattle were used to compare the molecular characteristics of blood before and after transportation. We have found that a stress-related marker "white blood cell count (WBC)" increased significantly after transportation. The decrease in triglyceride (TG), cholestenone (CHO), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) showed that energy expenditure was increased after transportation, but not enough to activate fatty decomposition. Intriguingly, the decrease of malondialdehyde (MDA) showed that cattle were more resilience to oxidative stress. The RNA-seq showed that 1,092 differentially expressed genes (DEGs) were found (329 up-regulated and 763 down-regulated) between group before and group after. The GO and KEGG enrichment showed that the metabolic pathway and B cell function related pathways were enriched. Furthermore, median absolute deviation (MAD) top 5,000 genes were used to construct a co-expression network by weighted correlation network analysis (WGCNA), and 11 independent modules were identified. Combing with protein-protein interaction (PPI) analysis, the verification of quantitative real-time PCR (qPCR) and the correlation of B cell function, structural maintenance of chromosomes 3 (SMC3), jun proto-oncogene (JUN), and C-X-C motif chemokine ligand 10 (CXCL10) were suggested as potential molecular markers in identification of short distance transportation. Collectively, the blood RNA-seq analysis and WGCNA indicated that the disorder of B cell differentiation, proliferation, survival, and apoptosis were the potential molecular mechanism in short distance transportation stress. In conclusion, our results provide the novel insight about potential biomarkers for short distance transportation stress, which may serve as for diagnosing and preventing this condition in beef industry.

miR-18b regulates the function of rabbit ovary granulosa cells.

MicroRNAs (miRNAs) have been determined to participate in the process of oestradiol production. Generally, there are two pathways by which oestradiol levels change, one being the state of cells (i.e. the status of enzymes involved in the synthesis of hormones such as oestradiol) and the other being the number of cells that secrete oestradiol. It is known that oestrogens are the main steroids produced by granulosa cells (GCs) of mature ovarian follicles. In this study we explored the function of miR-18b in rabbit GCs by overexpressing or inhibiting its activity. We found that miR-18b silencing promoted the secretion of oestradiol by significantly affecting the expression of steroidogenesis-related genes. Thus, miR-18b may act as a negative regulator of the production of enzymes related to oestradiol synthesis and affect oestradiol production. Furthermore, the effects of miR-18b on the proliferation, cell cycle and apoptosis of GCs were investigated using a cell counting kit (CCK-8) proliferation assay, detection of annexin V-fluorescein isothiocyanate apoptosis, flow cytometry and quantitative polymerase chain reaction. The results showed that miR-18b upregulated GC apoptosis (miR-18b overexpression decreases cell growth and stimulates apoptosis). These findings suggest that miR-18b and the oestrogen receptor 1 (ESR1) gene may be attractive targets to further explore the molecular regulation of GCs. The miR-18b may also explain, in part, the abnormal folliculogenesis in mammals caused by conditions such as polycystic ovary syndrome, primary ovarian insufficiency, and others.

Detection of key gene InDels in TGF-ß pathway and its relationship with growth traits in four sheep breeds.

TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.

Liver Expression of IGF2 and Related Proteins in ZBED6 Gene-Edited Pig by RNA-Seq.

Zinc finger BED-type containing 6 (ZBED6), a highly conservative transcription factor of placental mammals, has conservative interaction of insulin-like growth factor 2 (IGF2) based on the 16 bp binding sites of ZBED6 on the IGF2 sequence. IGF2 is related to embryo growth and cell proliferation. At the same time, its functions in muscle and adipose in mammals have been widely mentioned in recent studies. To further investigate the mechanism of ZBED6 on IGF2, we detected the expression of IGF2 and related genes in ZBED6 single allele knockout (ZBED6-SKO) pig tissues and analyzed the transcriptome of ZBED6-SKO pig liver. Through RNA-seq, we captured nine up-regulated genes and eight down-regulated genes which related to lipid metabolism. The results showed that the mRNA of IGF2 had an upward trend after the partial knockout of ZBED6 in liver and had no significant difference in protein expression of IGF2. In summary, ZBED6-SKO could affect the secretion of IGF2 in pig liver and its own lipid metabolism. Our research has provided basic information for revealing the regulatory mechanism of the interaction between ZBED6 and IGF2 in mammals.

Novel InDels of GHR, GHRH, GHRHR and Their Association with Growth Traits in Seven Chinese Sheep Breeds.

The GH growth axis plays an important role in the growth and development of animals and runs through the whole life of animals. Many studies have shown that molecular mutations in key genes of the GH axis will affect the growth and development of animals. The purpose of this study was to explore the distribution characteristics of InDels of GHR, GHRH, and GHRHR in seven Chinese sheep populations, and to further explore the relationship between InDels and sheep growth traits. GHR showed high variation in Chinese sheep, and GHR-53 showed the highest minimum allele frequency (MAF). There was only one InDel mutation site in both GHRH and GHRHR. The genotype frequencies of Hu sheep (HS), Tong sheep (TS), and Lanzhou fat-tail sheep (LFTS) were quite different from other breeds. The association between GHR, GHRH, and GHRHR InDels and body size traits in seven varieties were analyzed. The results showed that there was no significant relationship between GHRH and body size traits in the seven sheep populations. There was a positive association between GHR-21 and hip height of LFSH (p < 0.05). GHR-43 reduced body height and chest depth of Small tail han sheep (STHS) and hip width of TS. GHR-44 significantly affected the body weight of HS, the body height of STHS and the head depth of TS. GHR-53 significantly reduced cannon girth of HS, chest of STHS and forehead width of TS. GHRHR-2 significantly reduced the body weight of LFHS. To sum up, this study revealed the effects of GHR, GHRH, and GHRHR InDels on sheep phenotypic traits, which indicated their potential application prospects in the genetic improvement of mutton sheep.

Functional Analysis of Haplotypes in Bovine PSAP Gene and Their Relationship with Beef Cattle Production Traits.

The purpose of this study was to explore functional variants in the prosaposin (PSAP) three prime untranslated region (3' UTR) and clarify the relationship between the variants and morphological traits. Through Sanger sequencing, 13 variations were identified in bovine PSAP in four Chinese cattle breeds, with six of them being loci in 3' UTR. In particular, Nanyang (NY) cattle had a special genotype and haplotype distribution compared to the other three breeds. NY cattle with ACATG and GCGTG haplotypes had higher morphological traits than GTACA and GTACG haplotypes. The results of dual-luciferase reporter assay showed that ACATG and GCGTG haplotypes affected the morphological traits of NY cattle by altering the secondary structure of PSAP 3' UTR rather than the miR-184 target sites. The findings of this study could be an evidence of a complex and varying mechanism between variants and animal morphological traits and could be used to complement candidate genes for molecular breeding.

Production of isoprene, one of the high-density fuel precursors, from peanut hull using the high-efficient lignin-removal pretreatment method.

BACKGROUND: Isoprene as the feedstock can be used to produce renewable energy fuels, providing an alternative to replace the rapidly depleting fossil fuels. However, traditional method for isoprene production could not meet the demands for low-energy consumption and environment-friendliness. Moreover, most of the previous studies focused on biofuel production out of lignocellulosic materials such as wood, rice straw, corn cob, while few studies concentrated on biofuel production using peanut hull (PH). As is known, China is the largest peanut producer in the globe with an extremely considerable amount of PH to be produced each year. Therefore, a novel, renewable, and environment-friendly pretreatment strategy to increase the enzymatic hydrolysis efficiency of cellulose and reduce the inhibitors generation was developed to convert PH into isoprene. RESULTS: The optimal pretreatment conditions were 100 °C, 60 min, 10% (w/v) solid loading with a 2:8 volume ratio of phosphoric acid and of hydrogen peroxide. In comparison with the raw PH, the hemicellulose and lignin were reduced to 85.0 and 98.0%, respectively. The cellulose-glucose conversion of pretreated PH reached up to 95.0% in contrast to that of the raw PH (19.1%). Only three kinds of inhibitors including formic acid, levulinic acid, and a little furfural were formed during the pretreatment process, whose concentrations were too low to inhibit the isoprene yield for Escherichia coli fermentation. Moreover, compared with the isoprene yield of pure glucose fermentation (298 ± 9 mg/L), 249 ± 6.7 and 294 ± 8.3 mg/L of isoprene were produced using the pretreated PH as the carbon source by the engineered strain via separate hydrolysis and fermentation and simultaneous saccharification and fermentation (SSF) methods, respectively. The isoprene production via SSF had a 9.8% glucose-isoprene conversion which was equivalent to 98.8% of isoprene production via the pure glucose fermentation. CONCLUSIONS: The optimized phosphoric acid/hydrogen peroxide combination pretreatment approach was proved effective to remove lignin and hemicellulose from lignocellulosic materials. Meanwhile, the pretreated PH could be converted into isoprene efficiently in the engineered Escherichia coli. It is concluded that this novel strategy of isoprene production using lignocellulosic materials pretreated by phosphoric acid/hydrogen peroxide is a promising alternative to isoprene production using traditional way which can fully utilize non-renewable fossil sources.

Effect of H2O Adsorption on Negative Differential Conductance Behavior of Single Junction.

Large negative differential conductance (NDC) at lower bias regime is a very desirable functional property for single molecular device. Due to the non-conjugated segment separating two conjugated branches, the single thiolated arylethynylene molecule with 9,10-dihydroanthracene core (denoted as TADHA) presents excellent NDC behavior in lower bias regime. Based on the ab initio calculation and non-equilibrium Green's function formalism, the NDC behavior of TADHA molecular device and the H2O-molecule-adsorption effects are studied systematically. The numerical results show that the NDC behavior of TADHA molecular junction originates from the Stark effect of the applied bias which splits the degeneration of the highest occupied molecular orbital (HOMO) and HOMO-1. The H2O molecule adsorbed on the terminal sulphur atom strongly suppresses the conductance of TADHA molecular device and destroys the NDC behavior in the lower bias regime. Single or separated H2O molecules adsorbed on the backbone of TADHA molecule can depress the energy levels of molecular orbitals, but have little effects on the NDC behavior of the TADHA molecular junction. Aggregate of several H2O molecules adsorbed on one branch of TADHA molecule can dramatically enhance the conductance and NDC behavior of the molecular junction, and result in rectifier behavior.

Isoprene Production on Enzymatic Hydrolysate of Peanut Hull Using Different Pretreatment Methods.

The present study is about the use of peanut hull for isoprene production. In this study, two pretreatment methods, hydrogen peroxide-acetic acid (HPAC) and popping, were employed prior to enzymatic hydrolysis, which could destroy the lignocellulosic structure and accordingly improve the efficiency of enzymatic hydrolysis. It is proven that the isoprene production on enzymatic hydrolysate with HPAC pretreatment is about 1.9-fold higher than that of popping pretreatment. Moreover, through High Performance Liquid Chromatography (HPLC) analysis, the amount and category of inhibitors such as formic acid, acetic acid, and HMF were assayed and were varied in different enzymatic hydrolysates, which may be the reason leading to a decrease in isoprene production during fermentation. To further increase the isoprene yield, the enzymatic hydrolysate of HPAC was detoxified by activated carbon. As a result, using the detoxified enzymatic hydrolysate as the carbon source, the engineered strain YJM21 could accumulate 297.5 mg/L isoprene, which accounted for about 90% of isoprene production by YJM21 fermented on pure glucose (338.6 mg/L). This work is thought to be the first attempt on isoprene production by E. coli using peanut hull as the feedstock. More importantly, it also shows the prospect of peanut hull to be considered as an alternative feedstock for bio-based chemicals or biofuels production due to its easy access and high polysaccharide content.