Influence of the continuing COVID-19 epidemic on sleep quality and psychological status of healthcare workers in private institutions.

BACKGROUND: On January 22, 2020, Macao reported its first case of coronavirus disease 2019 (COVID-19) infection. By August 2021, the situation had escalated into a crisis of community transmission. In response, the government launched a recruitment campaign seeking assistance and services of healthcare workers (HCWs) from the private sector throughout Macao. These participants faced concerns about their own health and that of their families, as well as the responsibility of maintaining public health and wellness. This study aims to determine whether the ongoing epidemic has caused them physical and psychological distress. AIM: To examine the influence of COVID-19 on the sleep quality and psychological status of HCWs in private institutions in Macao during the pandemic. METHODS: Data were collected from December 2020 to January 2022. Two consecutive surveys were conducted. The Pittsburgh Sleep Quality Index (PSQI) scale, Self-Rating Anxiety Scale (SAS), and Self-Rating Depression Scale (SDS) were employed as investigation tools. RESULTS: In the first-stage survey, 32% of HCWs experienced a sleep disorder, compared to 28.45% in the second-stage survey. A total of 31.25% of HCWs in the first-stage survey and 28.03% in the second had varying degrees of anxiety. A total of 50.00% of HCWs in the first-stage survey and 50.63% in the second experienced varying degrees of depression. No difference in PSQI scores, SAS scores, or SDS scores were observed between the two surveys, indicating that the COVID-19 epidemic influenced the sleep quality and psychological status of HCWs. The negative influence persisted over both periods but did not increase remarkably for more than a year. However, a positive correlation was observed between the PSQI, SAS, and SDS scores (r = 0.428-0.775, P < 0.01), indicating that when one of these states deteriorated, the other two tended to deteriorate as well. CONCLUSION: The sleep quality, anxiety, and depression of HCWs in private institution in Macao were affected by the COVID-19 epidemic. While these factors did not deteriorate significantly, the negative effects persisted for a year and remained noteworthy.

Suppression of ZEB1 by Ethyl caffeate attenuates renal fibrosis via switching glycolytic reprogramming.

Renal fibrosis (RF) is a common endpoint of various chronic kidney diseases, leading to functional impairment and ultimately progressing to end-stage renal failure. Glycolytic reprogramming plays a critical role in the pathogenesis of fibrosis, which maybe a potential therapeutic target for treating renal fibrosis. Here, we revealed the novel role of ZEB1 in renal fibrosis, and whether targeting ZEB1 is the underlying mechanism for the anti-fibrotic effects of ethyl caffeate (EC) to regulate the glycolytic process. Treatment of EC attenuated the renal fibrosis and inhibited ZEB1 expression in vivo and in vitro, reducing the upregulated expression of glycolytic enzymes (HK2, PKM2, PFKP) and key metabolites (lactic acid, pyruvate). ZEB1 overexpression promoted the renal fibrosis and glycolysis, whereas knockout of ZEB1 apparently attenuated renal fibrosis in vivo and in vitro. EC interacted with ZEB1 to modulate the glycolytic enzymes for suppressing the elevated glycolytic reprogramming during renal fibrosis. In summary, our study reveals that ZEB1 plays an important role in regulating glycolytic reprogramming during the renal tubular epithelial cell fibrosis, suggesting inhibition of ZEB1 may be a potential strategy for treating renal fibrosis. Additionally, EC is a potential new drug candidate for the treatment of renal fibrosis and CKD.

Berberine Inhibits Ferroptosis and Stabilizes Atherosclerotic Plaque through NRF2/SLC7A11/GPX4 Pathway.

OBJECTIVE: To investigate potential mechanisms of anti-atherosclerosis by berberine (BBR) using ApoE-/- mice. METHODS: Eight 8-week-old C57BL/6J mice were used as a blank control group (normal), and 56 8-week-old AopE-/- mice were fed a high-fat diet for 12 weeks, according to a completely random method, and were divided into the model group, BBR low-dose group (50 mg/kg, BBRL), BBR medium-dose group (100 mg/kg, BBRM), BBR high-dose group (150 mg/kg, BBRH), BBR+nuclear factor erythroid 2-related factor 2 (NRF2) inhibitor group (100 mg/kg BBR+30 mg/kg ML385, BBRM+ML385), NRF2 inhibitor group (30 mg/kg, ML385), and positive control group (2.5 mg/kg, atorvastatin), 8 in each group. After 4 weeks of intragastric administration, samples were collected and serum, aorta, heart and liver tissues were isolated. Biochemical kits were used to detect serum lipid content and the expression levels of malondialdehyde (MDA) and superoxide dismutase (SOD) in all experimental groups. The pathological changes of atherosclerosis (AS) were observed by aorta gross Oil Red O, aortic sinus hematoxylin-eosin (HE) and Masson staining. Liver lipopathy was observed in mice by HE staining. The morphology of mitochondria in aorta cells was observed under transmission electron microscope. Flow cytometry was used to detect reactive oxygen species (ROS) expression in aorta of mice in each group. The content of ferrous ion Fe2+ in serum of mice was detected by biochemical kit. The mRNA and protein relative expression levels of NRF2, glutathione peroxidase 4 (GPX4) and recombinant solute carrier family 7 member 11 (SLC7A11) were detected by quantitative real time polymerase chain reaction (RT-qPCR) and Western blot, respectively. RESULTS: BBRM and BBRH groups delayed the progression of AS and reduced the plaque area (P<0.01). The characteristic morphological changes of ferroptosis were rarely observed in BBR-treated AS mice, and the content of Fe2+ in BBR group was significantly lower than that in the model group (P<0.01). BBR decreased ROS and MDA levels in mouse aorta, increased SOD activity (P<0.01), significantly up-regulated NRF2/SLC7A11/GPX4 protein and mRNA expression levels (P<0.01), and inhibited lipid peroxidation. Compared with the model group, the body weight, blood lipid level and aortic plaque area of ML385 group increased (P<0.01); the morphology of mitochondria showed significant ferroptosis characteristics; the serum Fe2+, MDA and ROS levels increased (P<0.05 or P<0.01), and the activity of SOD decreased (P<0.01). Compared with BBRM group, the iron inhibition effect of BBRM+ML385 group was significantly weakened, and the plaque area significantly increased (P<0.01). CONCLUSION: Through NRF2/SLC7A11/GPX4 pathway, BBR can resist oxidative stress, inhibit ferroptosis, reduce plaque area, stabilize plaque, and exert anti-AS effects.

Managing immune checkpoint inhibitor-associated gastritis: Insights and strategies.

Immune checkpoint inhibitors (ICIs) are widely used due to their effectiveness in treating various tumors. Immune-related adverse events (irAEs) are defined as adverse effects resulting from ICI treatment. Gastrointestinal irAEs are a common type of irAEs characterized by intestinal side effects, such as diarrhea and colitis, which may lead to the discontinuation of ICIs.

Aspirin suppresses hepatocellular carcinoma progression by inhibiting platelet activity.

BACKGROUND: Hepatocellular carcinoma (HCC) is the most common malignant liver disease in the world. Platelets (PLTs) are known to play a key role in the maintenance of liver homeostasis and the pathophysiological processes of a variety of liver diseases. Aspirin is the most classic antiplatelet agent. However, the molecular mechanism of platelet action and whether aspirin can affect HCC progression by inhibiting platelet activity need further study. AIM: To explore the impact of the antiplatelet effect of aspirin on the development of HCC. METHODS: Platelet-rich plasma, platelet plasma, pure platelet, and platelet lysate were prepared, and a coculture model of PLTs and HCC cells was established. CCK-8 analysis, apoptosis analysis, Transwell analysis, and real-time polymerase chain reaction (RT-PCR) were used to analyze the effects of PLTs on the growth, metastasis, and inflammatory microenvironment of HCC. RT-PCR and Western blot were used to detect the effects of platelet activation on tumor-related signaling pathways. Aspirin was used to block the activation and aggregation of PLTs both in vitro and in vivo, and the effect of PLTs on the progression of HCC was detected. RESULTS: PLTs significantly promoted the growth, invasion, epithelial-mesenchymal transition, and formation of an inflammatory microenvironment in HCC cells. Activated PLTs promoted HCC progression by activating the mitogen-activated protein kinase/protein kinase B/signal transducer and activator of transcription three (MAPK/ AKT/STAT3) signaling axis. Additionally, aspirin inhibited HCC progression in vitro and in vivo by inhibiting platelet activation. CONCLUSION: PLTs play an important role in the pathogenesis of HCC, and aspirin can affect HCC progression by inhibiting platelet activity. These results suggest that antiplatelet therapy has promising application prospects in the treatment and combined treatment of HCC.

Liver X receptor inverse agonist SR9243 attenuates rheumatoid arthritis via modulating glycolytic metabolism of macrophages.

Liver X receptors (LXRs) which link lipid metabolism and inflammation, were overexpressed in experimental rheumatoid arthritis (RA) rats as observed in our previous studies, while suppression of LXRα by silybin ameliorates arthritis and abnormal lipid metabolism. However, the role of LXRs in RA remains undefined. In this study, we investigated the inhibition role of LXRs in the polarization and activation of M1 macrophage by using a special LXRs inverse agonist SR9243, which led to ameliorating the progression of adjuvant-induced arthritis (AIA) in rats. Mechanistically, SR9243 disrupted the LPS/IFN-γ-induced Warburg effect in M1 macrophages, while glycolysis inhibitor 2-DG attenuated the inhibition effect of SR9243 on M1 polarization and the cytokines expression of M1 macrophages including iNOS, TNF-α, and IL-6 in vitro. Furthermore, SR9243 downregulated key glycolytic enzymes, including LDH-A, HK2, G6PD, GLUT1, and HIF-1α in M1 macrophages, which is mediated by increased phosphorylation of AMPK (Thr172) and reduced downstream phosphorylation of mTOR (Ser2448). Importantly, gene silencing of LXRs compromises the inhibition effect of SR9243 on M1 macrophage polarization and activation. Collectively, for the first time, our findings suggest that the LXR inverse agonist SR9243 mitigates adjuvant-induced rheumatoid arthritis and protects against bone erosion by inhibiting M1 macrophage polarization and activation through modulation of glycolytic metabolism via the AMPK/mTOR/HIF-1α pathway.

Clinical Efficacy of Percutaneous Osteoplasty Under Fluoroscopy and Cone-Beam CT Guidance for Painful Sternal Metastases: A Case Series.

Background: Although percutaneous osteoplasty (POP) has been widely accepted and is now being performed for the treatment of painful bone metastases outside the spine. It is emerging as one of the most promising procedures for patients with painful bone metastasis who are unsuitable for surgery or who show resistance to radiotherapy and/or analgesic therapies. However, there are only scarce reports regarding osteoplasty in painful sternal metastases. Subjects and Method: We report four patients with sternal metastases suffered with severe pain of anterior chest wall. The original tumors included lung cancer and thyroid cancer. For the initially pain medication failing, all the four patients received POP procedure under fluoroscopic and cone-beam CT (CBCT) guidance, and obtained satisfying resolution of painful symptoms at 6-month postop follow-up. Conclusion: POP is a safe and effective treatment for pain caused by metastatic bone tumors in the sternum. In practice, however, percutaneous puncture of pathologic sternal fractures can be a challenge because of the long flat contour and the defacement by lytic tumor of bony landmarks. We find that the use of fluoroscopic and CBCT can facilitate POP for flat bone fractures with displacing the trajectory planning, needle advancement, and cement delivery in time.

Dihydroartemisinin-driven selective anti-lung cancer proliferation by binding to EGFR and inhibition of NRAS signaling pathway-induced DNA damage.

Chemotherapeutic agents can inhibit the proliferation of malignant cells due to their cytotoxicity, which is limited by collateral damage. Dihydroartemisinin (DHA), has a selective anti-cancer effect, whose target and mechanism remain uncovered. The present work aims to examine the selective inhibitory effect of DHA as well as the mechanisms involved. The findings revealed that the Lewis cell line (LLC) and A549 cell line (A549) had an extremely rapid proliferation rate compared with the 16HBE cell line (16HBE). LLC and A549 showed an increased expression of NRAS compared with 16HBE. Interestingly, DHA was found to inhibit the proliferation and facilitate the apoptosis of LLC and A549 with significant anti-cancer efficacy and down-regulation of NRAS. Results from molecular docking and cellular thermal shift assay revealed that DHA could bind to epidermal growth factor receptor (EGFR) molecules, attenuating the EGF binding and thus driving the suppressive effect. LLC and A549 also exhibited obvious DNA damage in response to DHA. Further results demonstrated that over-expression of NRAS abated DHA-induced blockage of NRAS. Moreover, not only the DNA damage was impaired, but the proliferation of lung cancer cells was also revitalized while NRAS was over-expression. Taken together, DHA could induce selective anti-lung cancer efficacy through binding to EGFR and thereby abolishing the NRAS signaling pathway, thus leading to DNA damage, which provides a novel theoretical basis for phytomedicine molecular therapy of malignant tumors.

TyG-GGT is a Reliable Non-Invasive Predictor of Advanced Liver Fibrosis in Overweight or Obese Individuals.

BACKGROUND: Liver fibrosis is a predisposing factor for liver cancer. This study will investigate the predictive role of the Triglyceride-glucose and Gamma-glutamyl transferase index (TyG-GGT) as a non-invasive indicator of advanced liver fibrosis in individuals with obesity or overweight. METHOD: We enrolled patients who underwent metabolic and bariatric surgery as well as intraoperative liver biopsies at Zhejiang provincial people's hospital from August 2020 to March 2023. Clinical characteristics, comorbidities, laboratory data, and pathological variables of patients were collected and analysed. Then, we conducted logistics regression model to compare the performance of the TyG-GGT index with other 4 non-invasive models. RESULTS: A total of 65 patients were included in this study. 43(66.2%) of them were female, with the mean body mass index (BMI) of 39.0 ± 7.3 kg/m2. Meanwhile, 24(36.9%) patients were diagnosed with diabetes. Advanced liver fibrosis were observed in 16.9% of patients, while liver cirrhosis was found in 4.6% of patients. The multivariable logistics regression showed that TyG-GGT was an independent risk factor of advanced liver fibrosis (OR = 6.989, P = 0.049). Additionally, compared to another 4 non-invasive liver fibrosis models (NFS = 0.66, FIB4 = 0.65, METS-IR = 0.68, APRI = 0.65), TyG-GGT exhibits the highest AUC value of 0.75. CONCLUSIONS: More than one-third of patients undergoing metabolic and bariatric surgery are afflicted with nonalcoholic steatohepatitis (NASH), and a significant proportion exhibit advanced fibrosis. TyG-GGT was a potentially reliable predictor for screening individuals with overweight or obesity at high risk of advanced liver fibrosis, thus providing clinical guidance for early intervention in this targeted group.

Objective Assessment of Visual Field Defects Caused by Optic Chiasm and Its Posterior Visual Pathway Injury.

OBJECTIVES: To investigate the characteristics and objective assessment method of visual field defects caused by optic chiasm and its posterior visual pathway injury. METHODS: Typical cases of visual field defects caused by injuries to the optic chiasm, optic tracts, optic radiations, and visual cortex were selected. Visual field examinations, visual evoked potential (VEP) and multifocal visual evolved potential (mfVEP) measurements, craniocerebral CT/MRI, and retinal optical coherence tomography (OCT) were performed, respectively, and the aforementioned visual electrophysiological and neuroimaging indicators were analyzed comprehensively. RESULTS: The electrophysiological manifestations of visual field defects caused by optic chiasm injuries were bitemporal hemianopsia mfVEP abnormalities. The visual field defects caused by optic tract, optic radiation, and visual cortex injuries were all manifested homonymous hemianopsia mfVEP abnormalities contralateral to the lesion. Mild relative afferent pupil disorder (RAPD) and characteristic optic nerve atrophy were observed in hemianopsia patients with optic tract injuries, but not in patients with optic radiation or visual cortex injuries. Neuroimaging could provide morphological evidence of damages to the optic chiasm and its posterior visual pathway. CONCLUSIONS: Visual field defects caused by optic chiasm, optic tract, optic radiation, and visual cortex injuries have their respective characteristics. The combined application of mfVEP and static visual field measurements, in combination with neuroimaging, can maximize the assessment of the location and degree of visual pathway damage, providing an effective scheme for the identification of such injuries.

Targeting abnormal lipid metabolism of T cells for systemic lupus erythematosus treatment.

Systemic lupus erythematosus (SLE) is an autoimmune disease in which the immune system attacks its own tissues and organs. However, the causes of SLE remain unknown. Dyslipidemia is a common symptom observed in SLE patients and animal models and is closely correlated to disease activity. Lipid metabolic reprogramming has been considered as a hallmark of the dysfunction of T cells in patients with SLE, therefore, manipulating lipid metabolism provides a potential therapeutic target for treating SLE. A better understanding of the underlying mechanisms for the metabolic events of immune cells under pathological conditions is crucial for tuning immunometabolism to manage autoimmune diseases such as SLE. In this review, we aim to summarize the cross-link between lipid metabolism and the function of T cells as well as the underlying mechanisms, and provide light on the novel therapeutic strategies of active compounds from herbals for the treatment of SLE by targeting lipid metabolism in immune cells.

ß-Elemene enhances erlotinib sensitivity through induction of ferroptosis by upregulating lncRNA H19 in EGFR-mutant non-small cell lung cancer.

Nearly half of all Asian non-small cell lung cancer (NSCLC) patients harbour epidermal growth factor receptor (EGFR) mutations, and first-generation EGFR tyrosine kinase inhibitors (TKIs) are one of the first-line treatments that have improved the outcomes of these patients. Unfortunately, 20% of these patients can not benefit from the treatment. The basis of this primary resistance is poorly understood. Therefore, overcoming EGFR-TKI primary resistance and maintaining the efficacy of TKIs has become a key issue. ß-Elemene, a sesquiterpene compound extracted from Curcuma aromatica Salisb. (wenyujing), has shown potent antitumor effects. In this research, we found that ß-elemene combined with erlotinib enhanced the cytotoxicity of erlotinib to primary EGFR-TKI-resistant NSCLC cells with EGFR mutations and that ferroptosis was involved in the antitumor effect of the combination treatment. We found that lncRNA H19 was significantly downregulated in primary EGFR-TKI-resistant NSCLC cell lines and was upregulated by the combination treatment. Overexpression or knockdown of H19 conferred sensitivity or resistance to erlotinib, respectively, in both in vitro and in vivo studies. The high level of H19 enhanced the cytotoxicity of erlotinib by inducing ferroptosis. In conclusion, our data showed that ß-elemene combined with erlotinib could enhance sensitivity to EGFR-TKIs through induction of ferroptosis via H19 in primary EGFR-TKI-resistant lung cancer, providing a promising strategy to overcome EGFR-TKI resistance in NSCLC patients.

Traditional Herbal Medicine: A Potential Therapeutic Approach for Adjuvant Treatment of Non-small Cell Lung Cancer in the Future.

Lung carcinoma is the primary reason for cancer-associated mortality, and it exhibits the highest mortality and incidence in developed and developing countries. Non-small cell lung cancer (NSCLC) and SCLC are the 2 main types of lung cancer, with NSCLC contributing to 85% of all lung carcinoma cases. Conventional treatment mainly involves surgery, chemoradiotherapy, and immunotherapy, but has a dismal prognosis for many patients. Therefore, identifying an effective adjuvant therapy is urgent. Historically, traditional herbal medicine has been an essential part of complementary and alternative medicine, due to its numerous targets, few side effects and substantial therapeutic benefits. In China and other East Asian countries, traditional herbal medicine is increasingly popular, and is highly accepted by patients as a clinical adjuvant therapy. Numerous studies have reported that herbal extracts and prescription medications are effective at combating tumors. It emphasizes that, by mainly regulating the P13K/AKT signaling pathway, the Wnt signaling pathway, and the NF-κB signaling pathway, herbal medicine induces apoptosis and inhibits the proliferation and migration of tumor cells. The present review discusses the anti-NSCLC mechanisms of herbal medicines and provides options for future adjuvant therapy in patients with NSCLC.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Kuwanon G protects HT22 cells from advanced glycation end product-induced damage.

The incidence of diabetic encephalopathy is increasing as the population ages. Evidence suggests that formation and accumulation of advanced glycation end products (AGEs) plays a pivotal role in disease progression, but limited research has been carried out in this area. A previous study demonstrated that Kuwanon G (KWG) had significant anti-oxidative stress and anti-inflammatory properties. As AGEs are oxidative products and inflammation is involved in their generation it is hypothesized that KWG may have effects against AGE-induced neuronal damage. In the present study, mouse hippocampal neuronal cell line HT22 was used. KWG was shown to significantly inhibit AGE-induced cell apoptosis in comparison with a control treatment, as determined by both MTT and flow cytometry. Compared with the AGEs group, expression of pro-apoptotic protein Bax was reduced and expression of anti-apoptotic protein Bcl-2 was increased in the AGEs + KWG group. Both intracellular and extracellular levels of acetylcholine and choline acetyltransferase were significantly elevated after KWG administration in comparison with controls whilethe level of acetylcholinesterase decreased. These changes in protein expression were accompanied by increased levels of superoxide dismutase and glutathione peroxidase synthesis and reduced production of malondialdehyde and reactive oxygen species. Intracellular signaling pathway protein levels were determined by western blot and immunocytochemistry. KWG administration was found to prevent AGE-induced changes to the phosphorylation levels of Akt, IκB-α, glycogen synthase kinase 3 (GSK3)-α and ß, p38 MAPK and NF-κB p65 suggesting a potential neuroprotective effect of KWG against AGE-induced damage was via the PI3K/Akt/GSK3αß signaling pathway. The findings of the present study suggest that KWG may be a potential treatment for diabetic encephalopathy.

Spectrum of ß-Thalassemia Mutations in Some Areas of Guangxi Zhuang Autonomous Region of Southern China: A Study on a Pediatric Population Aged 0-15 Years.

ß-Thalassemia (ß-thal), one of the most common form of single-gene inheritable blood diseases in the world, is highly prevalent in southern China, especially in the Guangxi Zhuang Autonomous Region. To update the ß-thal mutation spectrum in this region, we performed hematological and genetic analyses on 888 ß-thal major (ß-TM), ß-thal intermedia (ß-TI) and ß-thal carrier patients, aged 0-15 years old, from different parts of Guangxi Province. We identified 55 genotypes and 18 ß-thal mutations. The codons 41/42 (-TTCT) (HBB: c.126_129delCTTT) (43.97%), codon 17 (A>T) (HBB: c.52A>T) (25.43%), -28(A>G) (HBB: c.-78A>G) (8.18%), IVS-II-654 (C>T) (HBB: c.316-197C>T) (7.85%) and codon 26 (G>A) (HBB: c.79G>A) (5.02%) were the five most common, accounting for more than 90.0%. The results of our study are providing an up-to-date ß-thal mutation spectrum in the 0-15-year-old pediatric population, which will help genetic counseling and prevention of ß-TM in mainland China's most endemic region, Guangxi Zhuang Autonomous Region.

Vagus nerve plays a pivotal role in CD4+ T cell differentiation during CVB3-induced murine acute myocarditis.

Abnormalities in CD4+ T cell (Th cell) differentiation play an important role in the pathogenesis of viral myocarditis (VMC). Our previous studies demonstrated that activation of the cholinergic anti-inflammatory pathway (CAP) alleviated the inflammatory response. In addition, we observed that right cervical vagotomy aggravates VMC by inhibiting CAP. However, the vagus nerve's effect on differentiation of CD4+ T cells has not been studied in VMC mice to date. In this study, we investigated the effects of cervical vagotomy and the α7nAChR agonist pnu282987 on CD4+ T cell differentiation in a murine myocarditis model (BALB/c) infected with coxsackievirus B3 (CVB3). Splenic CD4+ T cells from CVB3-induced mice obtained and cultured to investigate the potential mechanism of CD4+ T cell differentiation. Each Th cell subset was analyzed by flow cytometry. Our results showed that right cervical vagotomy increased proportions of Th1 and Th17 cells and decreased proportions of Th2 and Treg cells in the spleen. Vagotomy-induced upregulation of T-bet, Ror-γ, IFN-γ, and IL-17 expression while downregulating the expression of Gata3, Foxp3, and IL-4 in the heart. In addition, we observed upregulated levels of proinflammatory cytokines, aggravated myocardial lesions and cellular infiltration, and worsened cardiac function in VMC mice. Pnu282987 administration reversed these outcomes. Furthermore, vagotomy inhibited JAK2-STAT3 activation and enhanced NF-κB activation in splenic CD4+ T cells. The CD4+ T cell differentiation was related to JAK2-STAT3 and NF-κB signal pathways. In conclusion, vagus nerve modulates the inflammatory response by regulating CD4+ T cell differentiation in response to VMC.

Molecular Dynamics Simulations of Mite Aquaporin DerfAQP1 from the Dust Mite Dermatophagoides farinae (Acariformes: Pyroglyphidae).

Aquaporins are a large family of transmembrane channel proteins that facilitate the passive but highly selective transport of water and other small solutes across biological membranes. House dust mite (Dermatophagoides farinae) is the major source of household immunogens, and we have recently reported six cDNA sequence encoding aquaporins from this mite species. To better understand the structure and role of mite aquaporin, we constructed a tertiary structure for DerfAQP1 by homology modeling from the X-ray structure of malaria aquaporin PfAQP (Protein Data Bank code No. 3C02) and conducted molecular dynamics simulation. The simulation arranged seven water molecules in a single file through the pores of the DerfAQP1. Further, two conserved Asn-Pro-Ala motifs were located on Asn203 and Asn77; residues Arg206, Trp57, Met190, Gly200, and Asp207 constituted an extracellular vestibule of the pore; and residues His75, Val80, Ile65, and Ile182 constituted the cytoplasmic portions. The overall free energy profile for water transport through DerfAQP1 revealed an energy barrier of ~2.5 kcal/mol. These results contribute to the understanding of mite physiology and pathology.

Association between CYP2B6 polymorphism and acute leukemia in a Han population of Northwest China.

BACKGROUND: The aim of this study was to investigate potential associations between CYP2B6 c.516G>T polymorphism and the occurrence and prognosis of acute leukemias (AL) in the Han population of Northwest China. METHODS: The CYP2B6 gene polymorphism was analyzed by PCR-RFLP and Sanger DNA sequencing in 126 patients with AL and 161 healthy controls. RESULTS: Compared with controls, there were significantly higher frequencies of GT and TT genotypes and T alleles in AL patients (p < .05), particularly in fusion gene-positive AL patients. There was no significant difference in CYP2B6 polymorphic genotypes and T alleles between AL patients with complete remission after the first course of chemotherapy and controls (p > .05), while the frequencies in AL patients with partial remission and no remission were significantly higher. The CYP2B6 allele frequency in Han Chinese in Northwest China was significantly different to that reported in Han Chinese and other ethnic minorities in southern China, Uygur Chinese, Vietnamese, African, German, British, Spanish, Turkish, and Argentinian populations; however, there was no significant difference compared with allele frequencies reported in Tibetan and Mongolian Chinese, Japanese, Korean, and American populations. CONCLUSION: Our findings show a strong correlation of the CYP2B6 c.516G>T polymorphism in the Han population of Northwest China with AL, especially fusion gene-positive AL, and indicate a poor prognosis after the first course of chemotherapy. Our findings also implicate the T allele in AL susceptibility and indicate the existence of racial and geographical differences in allele frequencies of CYP2B6 c.516G>T polymorphism.

[Extraction of land-cover and wetland area in Bohai Rim region based on Google Earth Engine.] / 基于Google Earth Engine的环渤海地区土地覆盖分类.

The land cover of Bohai Rim region has changed greatly due to urbanization and economic development. Monitoring the land cover with high accuracy and real time is the most important basis for relevant researches. Traditional single-machine processing mode is difficult to realize rapid monitoring for large-scale and long-time series. The emergence of remote sensing big data makes it possible to combine computing platform and massive data. The land cover maps of study area were interpreted based on Google Earth Engine (GEE) platform with decision tree (CART) method from 2000 to 2019. The land cover change was analyzed, and the interpretation results using different data sources were compared. The results showed that the GEE platform could realize the rapid land cover interpretation in a large area, which interpreted coastal wetlands and other cover types with high accuracy over 80% comparing the surveyed points. Compared with Landsat images, the Sentinel-2A images interpretation results had a great improvement in accuracy, which increased from 85% to 95%, and thus more detailed surface information could be reflected. In 2000, the area of wetland, build-up area, farmland, forest, and water in the study area were 1612.5, 5734.9, 32074.8, 11853 and 3504.3 km2, accounting for 2.9%, 10.5%, 58.6%, 21.6% and 6.4% respectively. By 2019, wetlands had been reduced by 775.1 km2, with a decline of 40.1%; built-up area increased by 5310.5 km2 with an increasing rate of 92.6%. The area of farmland, forestland and water area decreased 1841.6, 1823.5 and 870.3 km2, with a decreasing rate of 5.7%, 24.8% and 48.1%, respectively. The coastal urbanization process caused the occupation of built-up area to other land use types, which was the main driving force of land cover change in the study area.