Clinical and microbiological features of a cohort of patients with Acinetobacter baumannii bloodstream infections.

PURPOSE: Acinetobacter baumannii is emerging as a pathogen that is a focus of global concern due to the frequent occurrence of the strains those are extensively resistant to antibiotics. This study was aimed to analyze the clinical and microbiological characteristics of a cohort of patients with A. baumannii bloodstream infections (BSIs) in western China. METHODS: A retrospective study of the patients at West China Hospital of Sichuan University with A. baumannii BSIs between Jan, 2018 and May, 2023 was conducted. Antimicrobial susceptibility of A. baumannii isolates was tested by microdilution broth method. Whole-genome sequencing and genetic analysis were also performed for these isolates. RESULTS: Among the 117 patients included, longer intensive care unit stay, higher mortality, and more frequent invasive procedures and use of more than 3 classes of antibiotics were observed among the carbapenem-resistant A. baumannii (CRAB)-infected group (n = 76), compared to the carbapenem-susceptible A. baumannii (CSAB)-infected group (n = 41, all P ≤ 0.001). Twenty-four sequence types (STs) were determined for the 117 isolates, and 98.7% (75/76) of CRAB were identified as ST2. Compared to non-ST2 isolates, ST2 isolates exhibited higher antibiotic resistance, and carried more resistance and virulence genes (P < 0.05). In addition, 80 (68.4%) isolates were CRISPR-positive, showed higher antibiotic susceptibility, and harbored less resistance and virulence genes, in comparison to CRISPR-negative ones (P < 0.05). Phylogenetic clustering based on coregenome SNPs indicated a sporadic occurrence of clonal transmission. CONCLUSION: Our findings demonstrate a high frequency of ST2 among A. baumannii causing BSIs, and high antibiotic susceptibility of non-ST2 and CRISPR-positive isolates. It is necessary to strengthen the surveillance of this pathogen.

Cross-correlation adjustment full-waveform inversion with source encoding in ultrasound computed tomography.

Full-waveform inversion (FWI) is one of the leading-edge techniques in ultrasound computed tomography (USCT). FWI reconstructs the images of sound speed by iteratively minimizing the difference between the predicted and measured signals. The challenges of FWI are to improve its stability and reduce its computational cost. In this paper, a new USCT algorithm based on cross-correlation adjustment FWI with source encoding (CCAFWI-SE) is proposed. In this algorithm, the gradient is adjusted using the intermediate signals as the inversion target rather than the measured signals during iteration. The intermediate signals are generated using the travel time difference calculated by cross-correlation. In the case of conventional FWI failure, using the proposed algorithm, the estimated sound speed can converge toward the ground truth. To reduce the computational cost, an intermittent update strategy is implemented. This strategy only requires one time for the calculation of the travel time difference per stage, so that the source encoding can be used. Simulation and laboratory experiments are implemented to validate this approach. The experiment results show it has successfully recovered the sound speed model, while conventional FWI failed when the initial model greatly differed from the ground truth. This verifies that our approach improves the stability of the reconstruction in USCT. In practice, additional computational costs can be reduced by combining our approach with existing methods. The proposed approach increases the robustness of the FWI and expands its application.

Unique metabolomics characteristics for distinguishing cirrhosis related to different liver diseases: A systematic review and meta-analysis.

BACKGROUND AND AIM: Clinical evidence for early identification and diagnosis of liver cirrhosis (LC) caused by different types of liver disease is limited. We investigated this topic through a meta-analysis of quantitative metabolomics. METHODS: Four databases were searched until October 31, 2022 for studies comparing metabolite levels between patients with different types of liver disease and control individuals. A random-effects model was applied for the meta-analysis. RESULTS: This study included 55 studies with 8266 clinical participants, covering 348 metabolites. In LC related to drug-induced liver injury (DILI), hepatitis B virus (HBV) infection, and non-alcoholic fatty liver disease (NAFLD), the primary bile acid biosynthesis (taurocholic acid: SMD, 1.08[0.81, 1.35]; P < 0.00001; glycocholic acid: SMD, 1.35[1.07, 1.62]; P < 0.00001; taurochenodeoxycholic acid: SMD, 1.36[0.94, 1.78]; P < 0.00001; glycochenodeoxycholic acid: SMD, 1.49[0.93, 2.06]; P < 0.00001), proline and arginine (l-proline: SMD, 1.06[0.53, 1.58]; P < 0.0001; hydroxyproline: SMD, 0.81[0.30, 1.33]; P = 0.002), and fatty acid biosynthesis (palmitic acid: SMD, 0.44[0.21, 0.67]; P = 0.0002; oleic acid: SMD, 0.46[0.19, 0.73]; P = 0.0008; stearic acid: SMD, 0.37[0.07, 0.68]; P = 0.02) metabolic pathways were significantly altered. CONCLUSION: We identified key biomarkers and metabolic characteristics for distinguishing and identifying LC related to different types of liver disease, providing a new perspective for early diagnosis, disease monitoring, and precise treatment.

Synergistic barium titanate/MXene composite as a high-performance piezo-photocatalyst for efficient dye degradation.

Piezo-photocatalysis combines photocatalysis and piezoelectric effects to enhance catalytic efficiency by creating an internal electric field in the photocatalyst, improving carrier separation and overall performance. This study presents a high-performance piezo-photocatalyst for efficient dye degradation using a synergistic barium titanate (BTO)-MXene composite. The composite was synthesized via a facile method, combining the unique properties of BTO nanoparticles with the high conductivity of MXene. The structural and morphological analysis confirmed the successful formation of the composite, with well-dispersed BTO nanoparticles on the MXene surface. The piezo-photocatalytic activity of the composite was evaluated using a typical dye solution (Rhodamine B: RhB) under ultraviolet irradiation and mechanical agitation. The results revealed a remarkable enhancement in dye degradation (90 % in 15 min for piezo-photocatalysis) compared to individual stimuli (58.2 % for photocatalysis and 95.8 % in 90 min for piezocatalysis), highlighting the synergistic effects between BTO and MXene. The enhanced catalytic performance was attributed to the efficient charge separation and transfer facilitated by the composite's structure, leading to increased reactive species generation and dye molecule degradation. Furthermore, the composite exhibited excellent stability and reusability, showcasing its potential for practical applications in wastewater treatment. Overall, this work represents a promising strategy for designing high-performance synergistic catalysts, addressing the pressing need for sustainable solutions in environmental remediation.

Attitude and willingness of biodiversity conservation in Chinese university students: Associated factors and the mediation of social support.

In this cross-sectional study of 1475 Chinese university students, we explored associated factors of attitude and willingness of biodiversity conservation, analyzed the hypothesized mediation by social support in the association between attitude and willingness of biodiversity conservation. Multivariate logistic regression model revealed that major and social support were prominently related to both attitude and willingness of biodiversity conservation. Besides, path model identified a statistically significant mediation by social support, sex, race, and family residence presented noticeable effect modification on the mediation of social support. These major findings suggest that intervention measures which aiming at enhancing social support could be considered for elevating attitude and willingness of biodiversity conservation among Chinese university students.

Projection neurons from medial entorhinal cortex to basolateral amygdala are critical for the retrieval of morphine withdrawal memory.

The medial entorhinal cortex (MEC) is crucial for contextual memory, yet its role in context-induced retrieval of morphine withdrawal memory remains unclear. This study investigated the role of the MEC and its projection neurons from MEC layer 5 to the basolateral amygdala (BLA) (MEC-BLA neurons) in context-induced retrieval of morphine withdrawal memory. Results show that context activates the MEC in morphine withdrawal mice, and the inactivation of the MEC inhibits context-induced retrieval of morphine withdrawal memory. At neural circuits, context activates MEC-BLA neurons in morphine withdrawal mice, and the inactivation of MEC-BLA neurons inhibits context-induced retrieval of morphine withdrawal memory. But MEC-BLA neurons are not activated by conditioning of context and morphine withdrawal, and the inhibition of MEC-BLA neurons do not influence the coupling of context and morphine withdrawal memory. These results suggest that MEC-BLA neurons are critical for the retrieval, but not for the formation, of morphine withdrawal memory.

The Improvement and Related Mechanism of Microecologics on the Sports Performance and Post-Exercise Recovery of Athletes: A Narrative Review.

The diversity and functionality of gut microbiota may play a crucial role in the function of human motor-related systems. In addition to traditional nutritional supplements, there is growing interest in microecologics due to their potential to enhance sports performance and facilitate post-exercise recovery by modulating the gut microecological environment. However, there is a lack of relevant reviews on this topic. This review provides a comprehensive overview of studies investigating the effects of various types of microecologics, such as probiotics, prebiotics, synbiotics, and postbiotics, on enhancing sports performance and facilitating post-exercise recovery by regulating energy metabolism, mitigating oxidative-stress-induced damage, modulating immune responses, and attenuating bone loss. Although further investigations are warranted to elucidate the underlying mechanisms through which microecologics exert their effects. In summary, this study aims to provide scientific evidence for the future development of microecologics in athletics.

Accurate Density Prediction of Sesquiterpenoid HEDFs and the Multiproperty Computing Server SesquiterPre.

Accurate and rapid evaluation of density is crucial for evaluating the packing and combustion characteristics of high-energy-density fuels (HEDFs). This parameter is pivotal in the selection of high-performance HEDFs. Our study leveraged a polycyclic compound density data set and quantum chemical (QC) descriptors to establish a correlation with the target properties using the XGBoost algorithm. We utilized a recursive feature elimination method to simplify the model and developed a concise and interpretable density prediction model incorporating only six QC descriptors. The model demonstrated robust performance, achieving coefficients of determination (R 2) of 0.967 and 0.971 for internal and external test sets, respectively, and root-mean-square errors (RMSE) of 0.031 and 0.027 g/cm3, respectively. Compared to the other two mainstream methods, the marginal discrepancy between the predicted and actual molecular densities underscores the model's superior predictive ability and more usefulness for energy density calculation. Furthermore, we developed a web server (SesquiterPre, https://sespre.cmdrg.com/#/) that can simultaneously calculate the density, enthalpy of combustion, and energy density of sesquiterpenoid HEDFs, which greatly facilitates the use of researchers and is of great significance for accelerating the design and screening of novel sesquiterpenoid HEDFs.

Discovery of a Double-Stapled Short Peptide as a Long-Acting HIV-1 Inactivator with Potential for Oral Bioavailability.

Different from most antiretroviral drugs that act as passive defenders to inhibit HIV-1 replication inside the host cell, virus inactivators can attack and inactivate HIV-1 virions without relying on their replication cycle. Herein, we describe the discovery of a hydrocarbon double-stapled helix peptide, termed D26. D26 is based on the HIV-1 gp41 protein lentiviral lytic peptide-3 motif (LLP3) sequence, which can efficiently inhibit HIV-1 infection and inactivate cell-free HIV-1 virions. It was noted that D26 was highly resistant to proteolytic degradation and exhibited a remarkably extended in vivo elimination half-life. Additionally, relative to its linear, nonstapled version, D26 exhibited much higher exposure in sanctuary sites for HIV-1. Amazingly, this lead compound also demonstrated detectable oral absorption. Thus, it can be concluded that D26 is a promising candidate for further development as a long-acting, orally applicable HIV-1 inactivator for the treatment of HIV-1 infection.

Microporous Materials in Polymer Electrolytes: The Merit of Order.

Solid-state batteries (SSBs) have garnered significant attention in the critical field of sustainable energy storage due to their potential benefits in safety, energy density, and cycle life. The large-scale, cost-effective production of SSBs necessitates the development of high-performance solid-state electrolytes. However, the manufacturing of SSBs relies heavily on the advancement of suitable solid-state electrolytes. Composite polymer electrolytes (CPEs), which combine the advantages of ordered microporous materials (OMMs) and polymer electrolytes, meet the requirements for high ionic conductivity/transference number, stability with respect to electrodes, compatibility with established manufacturing processes, and cost-effectiveness, making them particularly well-suited for mass production of SSBs. This review delineates how structural ordering dictates the fundamental physicochemical properties of OMMs, including ion transport, thermal transfer, and mechanical stability. The applications of prominent OMMs are critically examined, such as metal-organic frameworks, covalent organic frameworks, and zeolites, in CPEs, highlighting how structural ordering facilitates the fulfillment of property requirements. Finally, an outlook on the field is provided, exploring how the properties of CPEs can be enhanced through the dimensional design of OMMs, and the importance of uncovering the underlying "feature-function" mechanisms of various CPE types is underscored.

Multispectral Imaging-Based System for Detecting Tissue Oxygen Saturation With Wound Segmentation for Monitoring Wound Healing.

OBJECTIVE: Blood circulation is an important indicator of wound healing. In this study, a tissue oxygen saturation detecting (TOSD) system that is based on multispectral imaging (MSI) is proposed to quantify the degree of tissue oxygen saturation (StO2) in cutaneous tissues. METHODS: A wound segmentation algorithm is used to segment automatically wound and skin areas, eliminating the need for manual labeling and applying adaptive tissue optics. Animal experiments were conducted on six mice in which they were observed seven times, once every two days. The TOSD system illuminated cutaneous tissues with two wavelengths of light - red ([Formula: see text] nm) and near-infrared ([Formula: see text] nm), and StO2 levels were calculated using images that were captured using a monochrome camera. The wound segmentation algorithm using ResNet34-based U-Net was integrated with computer vision techniques to improve its performance. RESULTS: Animal experiments revealed that the wound segmentation algorithm achieved a Dice score of 93.49%. The StO2 levels that were determined using the TOSD system varied significantly among the phases of wound healing. Changes in StO2 levels were detected before laser speckle contrast imaging (LSCI) detected changes in blood flux. Moreover, statistical features that were extracted from the TOSD system and LSCI were utilized in principal component analysis (PCA) to visualize different wound healing phases. The average silhouette coefficients of the TOSD system with segmentation (ResNet34-based U-Net) and LSCI were 0.2890 and 0.0194, respectively. CONCLUSION: By detecting the StO2 levels of cutaneous tissues using the TOSD system with segmentation, the phases of wound healing were accurately distinguished. This method can support medical personnel in conducting precise wound assessments. Clinical and Translational Impact Statement-This study supports efforts in monitoring StO2 levels, wound segmentation, and wound healing phase classification to improve the efficiency and accuracy of preclinical research in the field.

Peptide Drug Design Using Alchemical Free Energy Calculation: An Application and Validation on Agonists of Ghrelin Receptor.

With recent large-scale applications and validations, the relative binding free energy (RBFE) calculated using alchemical free energy methods has been proven to be an accurate measure to probe the binding of small-molecule drug candidates. On the other hand, given the flexibility of peptides, it is of great interest to find out whether sufficient sampling could be achieved within the typical time scale of such calculation, and a similar level of accuracy could be reached for peptide drugs. However, the systematic evaluation of such calculations on protein-peptide systems has been less reported. Most reported studies of peptides were restricted to a limited number of data points or lacking experimental support. To demonstrate the applicability of the alchemical free energy method for protein-peptide systems in a typical real-world drug discovery project, we report an application of the thermodynamic integration (TI) method to the RBFE calculation of ghrelin receptor and its peptide agonists. Along with the calculation, the synthesis and in vitro EC50 activity of relamorelin and 17 new peptide derivatives were also reported. A cost-effective criterion to determine the data collection time was proposed for peptides in the TI simulation. The average of three TI repeats yielded a mean absolute error of 0.98 kcal/mol and Pearson's correlation coefficient (R) of 0.77 against the experimental free energy derived from the in vitro EC50 activity, showing good repeatability of the proposed method and a slightly better agreement than the results obtained from the arbitrary time frames up to 20 ns. Although it is limited by having one target and a deduced binding pose, we hope that this study can add some insights into alchemical free energy calculation of protein-peptide systems, providing theoretical assistance to the development of peptide drugs.

Identification of differentially expressed mRNAs as novel predictive biomarkers for gastric cancer diagnosis and prognosis.

BACKGROUND: Gastric cancer (GC) has a high mortality rate worldwide. Despite significant progress in GC diagnosis and treatment, the prognosis for affected patients still remains unfavorable. AIM: To identify important candidate genes related to the development of GC and identify potential pathogenic mechanisms through comprehensive bioinformatics analysis. METHODS: The Gene Expression Omnibus database was used to obtain the GSE183136 dataset, which includes a total of 135 GC samples. The limma package in R software was employed to identify differentially expressed genes (DEGs). Thereafter, enrichment analyses of Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were performed for the gene modules using the clusterProfile package in R software. The protein-protein interaction (PPI) networks of target genes were constructed using STRING and visualized by Cytoscape software. The common hub genes that emerged in the cohort of DEGs that was retrieved from the GEPIA database were then screened using a Venn Diagram. The expression levels of these overlapping genes in stomach adenocarcinoma samples and non-tumor samples and their association with prognosis in GC patients were also obtained from the GEPIA database and Kaplan-Meier curves. Moreover, real-time quantitative polymerase chain reaction (RT-qPCR) and western blotting were performed to determine the mRNA and protein levels of glutamic-pyruvic transaminase (GPT) in GC and normal immortalized cell lines. In addition, cell viability, cell cycle distribution, migration and invasion were evaluated by cell counting kit-8, flow cytometry and transwell assays. Furthermore, we also conducted a retrospective analysis on 70 GC patients diagnosed and surgically treated in Wenzhou Central Hospital, Dingli Clinical College of Wenzhou Medical University, The Second Affiliated Hospital of Shanghai University between January 2017 to December 2020. The tumor and adjacent normal samples were collected from the patients to determine the potential association between the expression level of GPT and the clinical as well as pathological features of GC patients. RESULTS: We selected 19214 genes from the GSE183136 dataset, among which there were 250 downregulated genes and 401 upregulated genes in the tumor samples of stage III-IV in comparison to those in tumor samples of stage I-II with a P-value < 0.05. In addition, GO and KEGG results revealed that the various upregulated DEGs were mainly enriched in plasma membrane and neuroactive ligand-receptor interaction, whereas the downregulated DEGs were primarily enriched in cytosol and pancreatic secretion, vascular smooth muscle contraction and biosynthesis of the different cofactors. Furthermore, PPI networks were constructed based on the various upregulated and downregulated genes, and there were a total 15 upregulated and 10 downregulated hub genes. After a comprehensive analysis, several hub genes, including runt-related transcription factor 2 (RUNX2), salmonella pathogenicity island 1 (SPI1), lysyl oxidase (LOX), fibrillin 1 (FBN1) and GPT, displayed prognostic values. Interestingly, it was observed that GPT was downregulated in GC cells and its upregulation could suppress the malignant phenotypes of GC cells. Furthermore, the expression level of GPT was found to be associated with age, lymph node metastasis, pathological staging and distant metastasis (P < 0.05). CONCLUSION: RUNX2, SPI1, LOX, FBN1 and GPT were identified key hub genes in GC by bioinformatics analysis. GPT was significantly associated with the prognosis of GC, and its upregulation can effectively inhibit the proliferative, migrative and invasive capabilities of GC cells.

Stabilizing High-Voltage Performance of Nickel-Rich Cathodes via Facile Solvothermally Synthesized Niobium-Doped Strontium Titanate.

Ni-rich layered ternary cathodes are promising candidates thanks to their low toxic Co-content and high energy density (∼800 Wh/kg). However, a critical challenge in developing Ni-rich cathodes is to improve cyclic stability, especially under high voltage (>4.3 V), which directly affects the performance and lifespan of the battery. In this study, niobium-doped strontium titanate (Nb-STO) is successfully synthesized via a facile solvothermal method and used as a surface modification layer onto the LiNi0.8Co0.1Mn0.1O2 (NCM811) cathode. The results exhibited that the Nb-STO modification significantly improved the cycling stability of the cathode material even under high-voltage (4.5 V) operational conditions. In particular, the best sample in our work could provide a high discharge capacity of ∼190 mAh/g after 100 cycles under 1 C with capacity retention over 84% in the voltage range of 3.0-4.5 V, superior to the pristine NCM811 (∼61%) and pure STO modified STO-811-600 (∼76%) samples under the same conditions. The improved electrochemical performance and stability of NCM811 under high voltage should be attributed to not only preventing the dissolution of the transition metals, further reducing the electrolyte's degradation by the end of charge, but also alleviating the internal resistance growth from uncontrollable cathode-electrolyte interface (CEI) evolution. These findings suggest that the as-synthesized STO with an optimized Nb-doping ratio could be a promising candidate for stabilizing Ni-rich cathode materials to facilitate the widespread commercialization of Ni-rich cathodes in modern LIBs.

Comparison of the use of a spiral nasojejunal tube and transendoscopic enteral tubing in washed microbiota transplantation via the mid-gut route.

Background: Methods for washed microbiota transplantation (WMT) through the mid-gut include transendoscopic enteral tubing (TET) and manual spiral nasojejunal tube (SNT) placement have not been studied. Methods: This prospective interventional study was performed at a single centre. Patients were divided into the SNT and mid-gut TET groups based on their conditions and wishes. In the SNT group, an SNT was passively inserted into the stomach, and abdominal X-rays were taken within 24 h to confirm tube placement in the small intestine. In the mid-gut TET group, mid-gut TET was placed in the small intestine for gastroscopy. Data on the clinical efficacy of WMT, intubation time, cost, overall comfort score, adverse reactions, etc., were collected from the two groups. Results: Sixty-three patients were included in the study (SNT group (n = 40) and mid-gut TET group (n = 23)). The clinical efficacy of WMT in the SNT and mid-gut TET groups was 90 % and 95.7 %, respectively (P = 0.644). Compared with the mid-gut TET group, the SNT group showed a shorter operation time (120 s vs. 258 s, P = 0.001) and a lower average cost (641.7 yuan vs. 1702.1 yuan, P = 0.001). There was no significant difference in the overall comfort score or the incidence of common discomfort symptoms between the two groups. Conclusion: The different implantation methods have different advantages; compared with mid-gut TET placement, manual SNT placement provides some benefits.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Multifaceted roles of lymphatic and blood endothelial cells in the tumor microenvironment of hepatocellular carcinoma: A comprehensive review.

The tumor microenvironment is a complex network of cells, extracellular matrix, and signaling molecules that plays a critical role in tumor progression and metastasis. Lymphatic and blood vessels are major routes for solid tumor metastasis and essential parts of tumor drainage conduits. However, recent studies have shown that lymphatic endothelial cells (LECs) and blood endothelial cells (BECs) also play multifaceted roles in the tumor microenvironment beyond their structural functions, particularly in hepatocellular carcinoma (HCC). This comprehensive review summarizes the diverse roles played by LECs and BECs in HCC, including their involvement in angiogenesis, immune modulation, lymphangiogenesis, and metastasis. By providing a detailed account of the complex interplay between LECs, BECs, and tumor cells, this review aims to shed light on future research directions regarding the immune regulatory function of LECs and potential therapeutic targets for HCC.