RESUMO
Glycogen synthase kinase 3ß (GSK-3ß) targets specific signaling pathways in response to distinct upstream signals. We used structural and functional studies to dissect how an upstream phosphorylation step primes the Wnt signaling component ß-catenin for phosphorylation by GSK-3ß and how scaffolding interactions contribute to this reaction. Our crystal structure of GSK-3ß bound to a phosphoprimed ß-catenin peptide confirmed the expected binding mode of the phosphoprimed residue adjacent to the catalytic site. An aspartate phosphomimic in the priming site of ß-catenin adopted an indistinguishable structure but reacted approximately 1000-fold slower than the native phosphoprimed substrate. This result suggests that substrate positioning alone is not sufficient for catalysis and that native phosphopriming interactions are necessary. We also obtained a structure of GSK-3ß with an extended peptide from the scaffold protein Axin that bound with greater affinity than that of previously crystallized Axin fragments. This structure neither revealed additional contacts that produce the higher affinity nor explained how substrate interactions in the GSK-3ß active site are modulated by remote Axin binding. Together, our findings suggest that phosphopriming and scaffolding produce small conformational changes or allosteric effects, not captured in the crystal structures, that activate GSK-3ß and facilitate ß-catenin phosphorylation. These results highlight limitations in our ability to predict catalytic activity from structure and have potential implications for the role of natural phosphomimic mutations in kinase regulation and phosphosite evolution.
Assuntos
Proteína Axina , Glicogênio Sintase Quinase 3 beta , beta Catenina , Humanos , Proteína Axina/metabolismo , Proteína Axina/química , Proteína Axina/genética , beta Catenina/metabolismo , beta Catenina/química , beta Catenina/genética , Domínio Catalítico , Cristalografia por Raios X , Glicogênio Sintase Quinase 3 beta/metabolismo , Glicogênio Sintase Quinase 3 beta/química , Glicogênio Sintase Quinase 3 beta/genética , Modelos Moleculares , Fosforilação , Ligação Proteica , Conformação Proteica , Via de Sinalização WntRESUMO
The CRISPR-Cas system has enabled the development of sophisticated, multigene metabolic engineering programs through the use of guide RNA-directed activation or repression of target genes. To optimize biosynthetic pathways in microbial systems, we need improved models to inform design and implementation of transcriptional programs. Recent progress has resulted in new modeling approaches for identifying gene targets and predicting the efficacy of guide RNA targeting. Genome-scale and flux balance models have successfully been applied to identify targets for improving biosynthetic production yields using combinatorial CRISPR-interference (CRISPRi) programs. The advent of new approaches for tunable and dynamic CRISPR activation (CRISPRa) promises to further advance these engineering capabilities. Once appropriate targets are identified, guide RNA prediction models can lead to increased efficacy in gene targeting. Developing improved models and incorporating approaches from machine learning may be able to overcome current limitations and greatly expand the capabilities of CRISPR-Cas9 tools for metabolic engineering.
Assuntos
Sistemas CRISPR-Cas , Engenharia Metabólica , Engenharia Metabólica/métodos , Sistemas CRISPR-Cas/genética , RNA Guia de Sistemas CRISPR-Cas/genética , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas/genética , Edição de Genes/métodosRESUMO
Directed evolution has emerged as a powerful tool for engineering new biocatalysts. However, introducing new catalytic residues can be destabilizing, and it is generally beneficial to start with a stable enzyme parent. Here we show that the deep learning-based tool ProteinMPNN can be used to redesign Fe(II)/αKG superfamily enzymes for greater stability, solubility, and expression while retaining both native activity and industrially-relevant non-native functions. For the Fe(II)/αKG enzyme tP4H, we performed site-saturation mutagenesis with both the wild-type and stabilized design variant and screened for activity increases in a non-native C-H hydroxylation reaction. We observed substantially larger increases in non-native activity for variants obtained from the stabilized scaffold compared to those from the wild-type enzyme. ProteinMPNN is user-friendly and widely-accessible, and straightforward structural criteria were sufficient to obtain stabilized, catalytically-functional variants of the Fe(II)/αKG enzymes tP4H and GriE. Our work suggests that stabilization by computational sequence redesign could be routinely implemented as a first step in directed evolution campaigns for novel biocatalysts.
RESUMO
Engineering metabolism to efficiently produce chemicals from multi-step pathways requires optimizing multi-gene expression programs to achieve enzyme balance. CRISPR-Cas transcriptional control systems are emerging as important tools for programming multi-gene expression, but poor predictability of guide RNA folding can disrupt expression control. Here, we correlate efficacy of modified guide RNAs (scRNAs) for CRISPR activation (CRISPRa) in E. coli with a computational kinetic parameter describing scRNA folding rate into the active structure (rS = 0.8). This parameter also enables forward design of scRNAs, allowing us to design a system of three synthetic CRISPRa promoters that can orthogonally activate (>35-fold) expression of chosen outputs. Through combinatorial activation tuning, we profile a three-dimensional design space expressing two different biosynthetic pathways, demonstrating variable production of pteridine and human milk oligosaccharide products. This RNA design approach aids combinatorial optimization of metabolic pathways and may accelerate routine design of effective multi-gene regulation programs in bacterial hosts.
Assuntos
Sistemas CRISPR-Cas , Escherichia coli , RNA Guia de Sistemas CRISPR-Cas , Escherichia coli/genética , Escherichia coli/metabolismo , RNA Guia de Sistemas CRISPR-Cas/genética , RNA Guia de Sistemas CRISPR-Cas/metabolismo , Engenharia Metabólica/métodos , Vias Biossintéticas/genética , Regiões Promotoras Genéticas , Humanos , Regulação Bacteriana da Expressão Gênica , Dobramento de RNARESUMO
Robust control over gene translation at arbitrary mRNA targets is an outstanding challenge in microbial synthetic biology. The development of tools that can regulate translation will greatly expand our ability to precisely control genes across the genome. In Escherichia coli, most genes are contained in multi-gene operons, which are subject to polar effects where targeting one gene for repression leads to silencing of other genes in the same operon. These effects pose a challenge for independently regulating individual genes in multi-gene operons. Here, we use CRISPR-dCas13 to address this challenge. We find dCas13-mediated repression exhibits up to 6-fold lower polar effects compared to dCas9. We then show that we can selectively activate single genes in a synthetic multi-gene operon by coupling dCas9 transcriptional activation of an operon with dCas13 translational repression of individual genes within the operon. We also show that dCas13 and dCas9 can be multiplexed for improved biosynthesis of a medically-relevant human milk oligosaccharide. Taken together, our findings suggest that combining transcriptional and translational control can access effects that are difficult to achieve with either mode independently. These combined tools for gene regulation will expand our abilities to precisely engineer bacteria for biotechnology and perform systematic genetic screens.
Assuntos
Sistemas CRISPR-Cas , Escherichia coli , Óperon , Biossíntese de Proteínas , Transcrição Gênica , Humanos , Escherichia coli/genética , Escherichia coli/metabolismo , Regulação Bacteriana da Expressão Gênica , Biologia Sintética/métodosRESUMO
Bacterial therapeutics have emerged as promising delivery systems to target tumors. These engineered live therapeutics can be harnessed to modulate the tumor microenvironment or to deliver and selectively release therapeutic payloads to tumors. A major challenge is to deliver bacteria systemically without causing widespread inflammation, which is critical for the many tumors that are not accessible to direct intratumoral injection. We describe potential strategies to address this challenge, along with approaches for specific payload delivery and biocontainment to ensure safety. These strategies will pave the way for the development of cost-effective, widely applicable next-generation cancer therapeutics.
Assuntos
Imunoterapia , Neoplasias , Humanos , Neoplasias/terapia , Bactérias , Microambiente TumoralRESUMO
Multiple signaling pathways regulate the kinase GSK3ß by inhibitory phosphorylation at Ser9, which then occupies the GSK3ß priming pocket and blocks substrate binding. Since this mechanism should affect GSK3ß activity toward all primed substrates, it is unclear why Ser9 phosphorylation does not affect other GSK3ß-dependent pathways, such as Wnt signaling. We used biochemical reconstitution and cell culture assays to evaluate how Wnt-associated GSK3ß is insulated from cross-activation by other signals. We found that the Wnt-specific scaffold protein Axin allosterically protects GSK3ß from phosphorylation at Ser9 by upstream kinases, which prevents accumulation of pS9-GSK3ß in the Axinâ¢GSK3ß complex. Scaffold proteins that protect bound proteins from alternative pathway reactions could provide a general mechanism to insulate signaling pathways from improper crosstalk.
Assuntos
Via de Sinalização Wnt , Proteína Axina , Glicogênio Sintase Quinase 3 beta , Fosforilação , Ligação Proteica/fisiologiaRESUMO
Dynamic, multi-input gene regulatory networks (GRNs) are ubiquitous in nature. Multilayer CRISPR-based genetic circuits hold great promise for building GRNs akin to those found in naturally occurring biological systems. We develop an approach for creating high-performing activatable promoters that can be assembled into deep, wide, and multi-input CRISPR-activation and -interference (CRISPRa/i) GRNs. By integrating sequence-based design and in vivo screening, we engineer activatable promoters that achieve up to 1,000-fold dynamic range in an Escherichia coli-based cell-free system. These components enable CRISPRa GRNs that are six layers deep and four branches wide. We show the generalizability of the promoter engineering workflow by improving the dynamic range of the light-dependent EL222 optogenetic system from 6-fold to 34-fold. Additionally, high dynamic range promoters enable CRISPRa systems mediated by small molecules and protein-protein interactions. We apply these tools to build input-responsive CRISPRa/i GRNs, including feedback loops, logic gates, multilayer cascades, and dynamic pulse modulators. Our work provides a generalizable approach for the design of high dynamic range activatable promoters and enables classes of gene regulatory functions in cell-free systems.
Assuntos
Proteínas de Escherichia coli , Escherichia coli , Regiões Promotoras Genéticas/genética , Escherichia coli/genética , Proteínas de Escherichia coli/genética , Redes Reguladoras de Genes , Sistemas CRISPR-Cas/genéticaRESUMO
CRISPR-Cas transcriptional tools have been widely applied for programmable regulation of complex biological networks. In comparison to eukaryotic systems, bacterial CRISPR activation (CRISPRa) has stringent target site requirements for effective gene activation. While genes may not always have an NGG protospacer adjacent motif (PAM) at the appropriate position, PAM-flexible dCas9 variants can expand the range of targetable sites. Here we systematically evaluate a panel of PAM-flexible dCas9 variants for their ability to activate bacterial genes. We observe that dxCas9-NG provides a high dynamic range of gene activation for sites with NGN PAMs while dSpRY permits modest activity across almost any PAM. Similar trends were observed for heterologous and endogenous promoters. For all variants tested, improved PAM-flexibility comes with the trade-off that CRISPRi-mediated gene repression becomes less effective. Weaker CRISPR interference (CRISPRi) gene repression can be partially rescued by expressing multiple sgRNAs to target many sites in the gene of interest. Our work provides a framework to choose the most effective dCas9 variant for a given set of gene targets, which will further expand the utility of CRISPRa/i gene regulation in bacterial systems.
Assuntos
Bactérias , Sistemas CRISPR-Cas , Sistemas CRISPR-Cas/genética , Bactérias/genética , Ativação Transcricional , Genes BacterianosRESUMO
GTPase switches are hubs for multiple distinct cell signaling inputs and outputs. In a new study combining genetic and biochemical methods, Perica, Mathy et al. identify an unexpected connection between the kinetics of a GTPase switch cycle and functional specificity.
Assuntos
Proteínas de Saccharomyces cerevisiae , GTP Fosfo-Hidrolases/metabolismo , Cinética , Proteínas Nucleares/metabolismo , Saccharomyces cerevisiae/metabolismo , Proteínas de Saccharomyces cerevisiae/metabolismo , Transdução de SinaisRESUMO
CRISPR-Cas transcriptional circuits hold great promise as platforms for engineering metabolic networks and information processing circuits. Historically, prokaryotic CRISPR control systems have been limited to CRISPRi. Creating approaches to integrate CRISPRa for transcriptional activation with existing CRISPRi-based systems would greatly expand CRISPR circuit design space. Here, we develop design principles for engineering prokaryotic CRISPRa/i genetic circuits with network topologies specified by guide RNAs. We demonstrate that multi-layer CRISPRa/i cascades and feedforward loops can operate through the regulated expression of guide RNAs in cell-free expression systems and E. coli. We show that CRISPRa/i circuits can program complex functions by designing type 1 incoherent feedforward loops acting as fold-change detectors and tunable pulse-generators. By investigating how component characteristics relate to network properties such as depth, width, and speed, this work establishes a framework for building scalable CRISPRa/i circuits as regulatory programs in cell-free expression systems and bacterial hosts. A record of this paper's transparent peer review process is included in the supplemental information.
Assuntos
Sistemas CRISPR-Cas , Escherichia coli , Bactérias/genética , Sistemas CRISPR-Cas/genética , Escherichia coli/genética , Escherichia coli/metabolismo , Redes Reguladoras de Genes/genética , RNA Guia de Cinetoplastídeos/metabolismo , Ativação TranscricionalRESUMO
To investigate the relationship between genome structure and function, we have developed a programmable CRISPR-Cas system for nuclear peripheral recruitment in yeast. We benchmarked this system at the HMR and GAL2 loci, both of which are well-characterized model systems for localization to the nuclear periphery. Using microscopy and gene silencing assays, we demonstrate that CRISPR-Cas-mediated tethering can recruit the HMR locus but does not detectably silence reporter gene expression. A previously reported Gal4-mediated tethering system does silence gene expression, and we demonstrate that the silencing effect has an unexpected dependence on the properties of the protein tether. The CRISPR-Cas system was unable to recruit GAL2 to the nuclear periphery. Our results reveal potential challenges for synthetic genome structure perturbations and suggest that distinct functional effects can arise from subtle structural differences in how genes are recruited to the periphery.
Assuntos
Sistemas CRISPR-Cas/genética , Núcleo Celular/genética , Expressão Gênica/genética , Inativação Gênica/fisiologia , Saccharomyces cerevisiae/genética , Proteínas de Ligação a DNA/genética , Genes Reporter/genética , Técnicas Genéticas , Genoma Bacteriano/genéticaRESUMO
CRISPR-Cas transcriptional programming in bacteria is an emerging tool to regulate gene expression for metabolic pathway engineering. Here we implement CRISPR-Cas transcriptional activation (CRISPRa) in P. putida using a system previously developed in E. coli. We provide a methodology to transfer CRISPRa to a new host by first optimizing expression levels for the CRISPRa system components, and then applying rules for effective CRISPRa based on a systematic characterization of promoter features. Using this optimized system, we regulate biosynthesis in the biopterin and mevalonate pathways. We demonstrate that multiple genes can be activated simultaneously by targeting multiple promoters or by targeting a single promoter in a multi-gene operon. This work will enable new metabolic engineering strategies in P. putida and pave the way for CRISPR-Cas transcriptional programming in other bacterial species.
Assuntos
Engenharia Metabólica , Pseudomonas putida , Sistemas CRISPR-Cas/genética , Escherichia coli/genética , Pseudomonas putida/genética , Ativação Transcricional/genéticaRESUMO
To spatially control biochemical functions at specific sites within a genome, we have engineered a synthetic switch that activates when bound to its DNA target site. The system uses two CRISPR-Cas complexes to colocalize components of a de novo-designed protein switch (Co-LOCKR) to adjacent sites in the genome. Colocalization triggers a conformational change in the switch from an inactive closed state to an active open state with an exposed functional peptide. We prototype the system in yeast and demonstrate that DNA binding triggers activation of the switch, recruitment of a transcription factor, and expression of a downstream reporter gene. This DNA-triggered Co-LOCKR switch provides a platform to engineer sophisticated functions that should only be executed at a specific target site within the genome, with potential applications in a wide range of synthetic systems including epigenetic regulation, imaging, and genetic logic circuits.
Assuntos
Proteína 9 Associada à CRISPR/genética , DNA/metabolismo , Edição de Genes/métodos , DNA/química , Genes Reporter , RNA Guia de Cinetoplastídeos/metabolismo , Proteínas Recombinantes de Fusão/genética , Proteínas Recombinantes de Fusão/metabolismo , Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/metabolismoRESUMO
Creating CRISPR gene activation (CRISPRa) technologies in industrially promising bacteria could be transformative for accelerating data-driven metabolic engineering and strain design. CRISPRa has been widely used in eukaryotes, but applications in bacterial systems have remained limited. Recent work shows that multiple features of bacterial promoters impose stringent requirements on CRISPRa-mediated gene activation. However, by systematically defining rules for effective bacterial CRISPRa sites and developing new approaches for encoding complex functions in engineered guide RNAs, there are now clear routes to generalize synthetic gene regulation in bacteria. When combined with multi-omics data collection and machine learning, the full development of bacterial CRISPRa will dramatically improve the ability to rapidly engineer bacteria for bioproduction through accelerated design-build-test-learn cycles.
Assuntos
Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas , Engenharia Metabólica , Bactérias/genética , Sistemas CRISPR-Cas/genética , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas/genética , RNA Guia de CinetoplastídeosRESUMO
Scaffold proteins are thought to promote signaling specificity by accelerating reactions between bound kinase and substrate proteins. To test the long-standing hypothesis that the scaffold protein Axin accelerates glycogen synthase kinase 3ß (GSK3ß)-mediated phosphorylation of ß-catenin in the Wnt signaling network, we measured GSK3ß reaction rates with multiple substrates in a minimal, biochemically reconstituted system. We observed an unexpectedly small, â¼2-fold Axin-mediated rate increase for the ß-catenin reaction when measured in isolation. In contrast, when both ß-catenin and non-Wnt pathway substrates are present, Axin accelerates the ß-catenin reaction by preventing competition with alternative substrates. At high competitor concentrations, Axin produces >10-fold rate effects. Thus, while Axin alone does not markedly accelerate the ß-catenin reaction, in physiological settings where multiple GSK3ß substrates are present, Axin may promote signaling specificity by suppressing interactions with competing, non-Wnt pathway targets. This mechanism for scaffold-mediated control of competition enables a shared kinase to perform distinct functions in multiple signaling networks.
Assuntos
Proteína Axina/metabolismo , Proteínas Repressoras/metabolismo , Humanos , Fosforilação , Via de Sinalização WntRESUMO
Scaffold proteins are thought to accelerate protein phosphorylation reactions by tethering kinases and substrates together, but there is little quantitative data on their functional effects. To assess the contribution of tethering to kinase reactivity, we compared intramolecular and intermolecular kinase reactions in a minimal model system. We found that tethering can enhance reaction rates in a flexible tethered kinase system and that the magnitude of the effect is sensitive to the structure of the tether. The largest effective molarity we obtained was â¼0.08 µM, which is much lower than the effects observed in small molecule model systems and other tethered protein reactions. We further demonstrated that the tethered intramolecular reaction only makes a significant contribution to the observed rates when the scaffolded complex assembles at concentrations below the effective molarity. These findings provide a quantitative framework that can be applied to understand endogenous protein scaffolds and engineer synthetic networks.
Assuntos
Proteínas Quinases Dependentes de AMP Cíclico/metabolismo , Animais , Proteínas Quinases Dependentes de AMP Cíclico/química , Camundongos , Fosforilação , Especificidade por SubstratoRESUMO
In bacterial systems, CRISPR-Cas transcriptional activation (CRISPRa) has the potential to dramatically expand our ability to regulate gene expression, but we lack predictive rules for designing effective gRNA target sites. Here, we identify multiple features of bacterial promoters that impose stringent requirements on CRISPRa target sites. Notably, we observe narrow, 2-4 base windows of effective sites with a periodicity corresponding to one helical turn of DNA, spanning ~40 bases and centered ~80 bases upstream of the TSS. However, we also identify two features suggesting the potential for broad scope: CRISPRa is effective at a broad range of σ70-family promoters, and an expanded PAM dCas9 allows the activation of promoters that cannot be activated by S. pyogenes dCas9. These results provide a roadmap for future engineering efforts to further expand and generalize the scope of bacterial CRISPRa.
Assuntos
Bactérias/genética , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas , Regulação Bacteriana da Expressão Gênica , Proteínas Associadas a CRISPR/genética , Proteínas Associadas a CRISPR/metabolismo , Sistemas CRISPR-Cas , Escherichia coli/genética , Proteínas de Escherichia coli , Genes Bacterianos/genética , Regiões Promotoras Genéticas , RNA Guia de Cinetoplastídeos/genética , Transativadores , Ativação TranscricionalRESUMO
Synthetic CRISPR-Cas transcription factors enable the construction of complex gene-expression programs, and chemically inducible systems allow precise control over the expression dynamics. To provide additional modes of regulatory control, we have constructed a chemically inducible CRISPR activation (CRISPRa) system in yeast that is mediated by recruitment to MS2-functionalized guide RNAs. We use reporter gene assays to systematically map the dose dependence, time dependence, and reversibility of the system. Because the recruitment function is encoded at the level of the guide RNA, it is straightforward to target multiple genes and independently regulate expression dynamics at individual targets. This approach provides a new method to engineer sophisticated, multigene programs with precise control over the dynamics of gene expression.
Assuntos
Proteína 9 Associada à CRISPR/genética , Sistemas CRISPR-Cas/genética , RNA Guia de Cinetoplastídeos/genética , Saccharomyces cerevisiae/genética , Expressão GênicaRESUMO
In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.