Single Dispersion of Fe(H2O)2-Based Polyoxometalate on Polymeric Carbon Nitride for Biomimetic CH4 Photooxidation.

Direct methane conversion to value-added oxygenates under mild conditions with in-depth mechanism investigation has attracted wide interest. Inspired by methane monooxygenase, the K9Na2Fe(H2O)2{[γ-SiW9O34Fe(H2O)]}2·25H2O polyoxometalate (Fe-POM) with well-defined Fe(H2O)2 sites is synthesized to clarify the key role of Fe species and their microenvironment toward CH4 photooxidation. The Fe-POM can efficiently drive the conversion of CH4 to HCOOH with a yield of 1570.0 µmol gPOM -1 and 95.8% selectivity at ambient conditions, much superior to that of [Fe(H2O)SiW11O39]5- with Fe(H2O) active site, [Fe2SiW10O38(OH)]2 14- and [P8W48O184Fe16(OH)28(H2O)4]20- with multinuclear Fe-OH-Fe active sites. Single-dispersion of Fe-POM on polymeric carbon nitride (PCN) is facilely achieved to provide single-cluster functionalized PCN with well-defined Fe(H2O)2 site, the HCOOH yield can be improved to 5981.3 µmol gPOM -1. Systemic investigations demonstrate that the (WO)4-Fe(H2O)2 can supply Fe═O active center for C-H activation via forming (WO)4-Fea-Ot···CH4 intermediate, similar to that for CH4 oxidation in the monooxygenase. This work highlights a promising and facile strategy for single dispersion of ≈1-2 Å metal center with precise coordination microenvironment by uniformly anchoring nanoscale molecular clusters, which provides a well-defined model for in-depth mechanism research.

Earth-abundant Zn-dipyrrin chromophores for efficient CO2 photoreduction.

The development of strong sensitizing and Earth-abundant antenna molecules is highly desirable for CO2 reduction through artificial photosynthesis. Herein, a library of Zn-dipyrrin complexes (Z-1-Z-6) are rationally designed via precisely controlling their molecular configuration to optimize strong sensitizing Earth-abundant photosensitizers. Upon visible-light excitation, their special geometry enables intramolecular charge transfer to induce a charge-transfer state, which was first demonstrated to accept electrons from electron donors. The resulting long-lived reduced photosensitizer was confirmed to trigger consecutive intermolecular electron transfers for boosting CO2-to-CO conversion. Remarkably, the Earth-abundant catalytic system with Z-6 and Fe-catalyst exhibits outstanding performance with a turnover number of >20 000 and 29.7% quantum yield, representing excellent catalytic performance among the molecular catalytic systems and highly superior to that of noble-metal photosensitizer Ir(ppy)2(bpy)+ under similar conditions. Experimental and theoretical investigations comprehensively unveil the structure-activity relationship, opening up a new horizon for the development of Earth-abundant strong sensitizing chromophores for boosting artificial photosynthesis.

Building Co16-N3-Based UiO-MOF to Expand Design Parameters for MOF Photosensitization.

The construction of secondary building units (SBUs) in versatile metal-organic frameworks (MOFs) represents a promising method for developing multi-functional materials, especially for improving their sensitizing ability. Herein, we developed a dual small molecules auxiliary strategy to construct a high-nuclear transition-metal-based UiO-architecture Co16-MOF-BDC with visible-light-absorbing capacity. Remarkably, the N3 - molecule in hexadecameric cobalt azide SBU offers novel modification sites to precise bonding of strong visible-light-absorbing chromophores via click reaction. The resulting Bodipy@Co16-MOF-BDC exhibits extremely high performance for oxidative coupling benzylamine (~100 % yield) via both energy and electron transfer processes, which is much superior to that of Co16-MOF-BDC (31.5 %) and Carboxyl @Co16-MOF-BDC (37.5 %). Systematic investigations reveal that the advantages of Bodipy@Co16-MOF-BDC in dual light-absorbing channels, robust bonding between Bodipy/Co16 clusters and efficient electron-hole separation can greatly boost photosynthesis. This work provides an ideal molecular platform for synergy between photosensitizing MOFs and chromophores by constructing high-nuclear transition-metal-based SBUs with surface-modifiable small molecules.

Single-cluster Functionalized TiO2 Nanotube Array for Boosting Water Oxidation and CO2 Photoreduction to CH3OH.

Solar-driven CO2 reduction and water oxidation to liquid fuels represents a promising solution to alleviate energy crisis and climate issue, but it remains a great challenge for generating CH3OH and CH3CH2OH dominated by multi-electron transfer. Single-cluster catalysts with super electron acceptance, accurate molecular structure, customizable electronic structure and multiple adsorption sites, have led to greater potential in catalyzing various challenging reactions. However, accurately controlling the number and arrangement of clusters on functional supports still faces great challenge. Herein, we develop a facile electrosynthesis method to uniformly disperse Wells-Dawson- and Keggin-type polyoxometalates on TiO2 nanotube arrays, resulting in a series of single-cluster functionalized catalysts P2M18O62@TiO2 and PM12O40@TiO2 (M=Mo or W). The single polyoxometalate cluster can be distinctly identified and serves as electronic sponge to accept electrons from excited TiO2 for enhancing surface-hole concentration and promote water oxidation. Among these samples, P2Mo18O62@TiO2-1 exhibits the highest electron consumption rate of 1260 µmol g-1 for CO2-to-CH3OH conversion with H2O as the electron source, which is 11 times higher than that of isolated TiO2 nanotube arrays. This work supplied a simple synthesis method to realize the single-dispersion of molecular cluster to enrich surface-reaching holes on TiO2, thereby facilitating water oxidation and CO2 reduction.

Water-Mediated Selectivity Control of CH3 OH versus CO/CH4 in CO2 Photoreduction on Single-Atom Implanted Nanotube Arrays.

Controllable methanol production in artificial photosynthesis is highly desirable due to its high energy density and ease of storage. Herein, single atom Fe is implanted into TiO2 /SrTiO3 (TSr) nanotube arrays by two-step anodization and Sr-induced crystallization. The resulting Fe-TSr with both single Fe reduction centers and dominant oxidation facets (001) contributes to efficient CO2 photoreduction and water oxidation for controlled production of CH3 OH and CO/CH4 . The methanol yield can reach to 154.20 µmol gcat -1 h-1 with 98.90% selectivity by immersing all the catalyst in pure water, and the yield of CO/CH4 is 147.48 µmol gcat -1 h-1 with >99.99% selectivity when the catalyst completely outside water. This CH3 OH yield is 50 and 3 times higher than that of TiO2 and TSr and stands among all the state-of-the-art catalysts. The facile gas-solid and gas-liquid-solid phase switch can selectively control CH3 OH production from ≈0% (above H2 O) to 98.90% (in H2 O) via slowly immersing the catalyst into water, where abundant •OH and H2 O around Fe sites play important role in selective CH3 OH production. This work highlights a new insight for water-mediated CO2 photoreduction to controllably produce CH3 OH.

Intravenous immunoglobulin for treatment of hospitalized COVID-19 patients: an evidence mapping and meta-analysis.

BACKGROUND: The clinical efficacy and safety of intravenous immunoglobulin (IVIg) treatment for COVID-19 remain controversial. This study aimed to map the current status and gaps of available evidence, and conduct a meta-analysis to further investigate the benefit of IVIg in COVID-19 patients. METHODS: Electronic databases were searched for systematic reviews/meta-analyses (SR/MAs), primary studies with control groups, reporting on the use of IVIg in patients with COVID-19. A random-effects meta-analysis with subgroup analyses regarding study design and patient disease severity was performed. Our outcomes of interest determined by the evidence mapping, were mortality, length of hospitalization (days), length of intensive care unit (ICU) stay (days), number of patients requiring mechanical ventilation, and adverse events. RESULTS: We included 34 studies (12 SR/MAs, 8 prospective and 14 retrospective studies). A total of 5571 hospitalized patients were involved in 22 primary studies. Random-effects meta-analyses of very low to moderate evidence showed that there was little or no difference between IVIg and standard care or placebo in reducing mortality (relative risk [RR] 0.91; 95% CI 0.78-1.06; risk difference [RD] 3.3% fewer), length of hospital (mean difference [MD] 0.37; 95% CI - 2.56, 3.31) and ICU (MD 0.36; 95% CI - 0.81, 1.53) stays, mechanical ventilation use (RR 0.92; 95% CI 0.68-1.24; RD 2.8% fewer), and adverse events (RR 0.98; 95% CI 0.84-1.14; RD 0.5% fewer) of patients with COVID-19. Sensitivity analysis using a fixed-effects model indicated that IVIg may reduce mortality (RR 0.76; 95% CI 0.60-0.97), and increase length of hospital stay (MD 0.68; 95% CI 0.09-1.28). CONCLUSION: Very low to moderate certainty of evidence indicated IVIg may not improve the clinical outcomes of hospitalized patients with COVID-19. Given the discrepancy between the random- and fixed-effects model results, further large-scale and well-designed RCTs are warranted.

Identification of Crucial Photosensitizing Factors to Promote CO2 -to-CO Conversion.

The sensitizing ability of a catalytic system is closely related to the visible-light absorption ability, excited-state lifetime, redox potential, and electron-transfer rate of photosensitizers (PSs), however it remains a great challenge to concurrently mediate these factors to boost CO2 photoreduction. Herein, a series of Ir(III)-based PSs (Ir-1-Ir-6) were prepared as molecular platforms to understand the interplay of these factors and identify the primary factors for efficient CO2 photoreduction. Among them, less efficient visible-light absorption capacity results in lower CO yields of Ir-1, Ir-2 or Ir-4. Ir-3 shows the most efficient photocatalytic activity among these mononuclear PSs due to some comprehensive parameters. Although the Kobs of Ir-3 is ≈10 times higher than that of Ir-5, the CO yield of Ir-3 is slightly higher than that of Ir-5 due to the compensation of Ir-5's strong visible-light-absorbing ability. Ir-6 exhibits excellent photocatalytic performance due to the strong visible-light absorption ability, comparable thermodynamic driving force, and electron transfer rate among these PSs. Remarkably, the CO2 photoreduction to CO with Ir-6 can achieve 91.5 µmol, over 54 times higher than Ir-1, and the optimized TONC-1 can reach up to 28160. Various photophysical properties of the PSs were concurrently adjusted by fine ligand modification to promote CO2 photoreduction.

Ordered Integration and Heterogenization of Catalysts and Photosensitizers in Metal-/Covalent-Organic Frameworks for Boosting CO2 Photoreduction.

ConspectusSolar-driven CO2 reduction into value-added chemicals, such as CO, HCOOH, CH4, and C2+ products, has been regarded as a potential way to alleviate environmental pollution and the energy crisis. In the past decades, numerous pioneered homogeneous catalytic systems composed of soluble photosensitizers (PSs) and catalytic active sites (CASs) have been explored for CO2 photoreduction. Nevertheless, inefficient electron migration based on random collision between CASs and PSs in homogeneous catalytic systems usually causes mediocre performance. Moreover, the relatively poor separation/recycling capability of the homogeneous systems has inevitably reduced their reusability and practicality. The rational combination of PSs and CASs have been proven to play critical roles in the development of highly efficient heterogeneous catalysts to improve their performance, such as anchoring them onto the solid matrixes or connecting them through bridging ligands. However, developing effective assembly strategies to achieve the ordered orientation and uniform heterogenization of PSs and CASs remains a great challenge, mainly due to the lack of crystallinity heterogeneous transformation and structural tailoring ability of traditional solid catalysts. Moreover, due to the lack of assembly and synthesis strategies, many efficient homogeneous photocatalytic systems are still unable to achieve high crystallinity heterogeneous transformation.Metal-organic frameworks (MOFs) and covalent-organic frameworks (COFs) have recently attracted broad interest toward CO2 photocatalysis because of their diverse precursors, well-defined and tailorable structures, abundant exposed CASs and high surface areas, etc. Especially, the highly ordered orientation and uniform combination of PSs and CASs in MOFs and COFs are beneficial for improved light harvesting and charge separation, greatly helping to address the aforementioned challenges. Moreover, the well-defined crystalline structures of MOFs and COFs facilitate the establishment of the structure-activity relationship. Therefore, it is increasingly important to summarize the integration of PSs and catalysts to provide deep insight into MOF/COF-based photocatalysts.In this Account, we summarize the ordered integration of PSs and CASs in MOFs and COFs for CO2 photoconversion and describe the structure-activity relationships to guide the design of effective catalysts. Given the unique structural features of MOFs and COFs, we have emphasized the integration of PSs and CASs to optimize their photocatalytic performance, including the confinement of catalytic active nanoparticles (NPs) into photosensitizing frameworks, co-coordination of PSs and CASs, and ligand-to-metal charge-transfer and anchoring CASs on the secondary building units of the photosensitizing frameworks. The catalytic activity, selectivity, sacrificial agent, and stability of these systems were then discussed. More importantly, MOFs and COFs provide powerful platforms to understand the key steps for boosting CO2 photoreduction and exploring the catalytic mechanism, involving light harvesting, electron-hole separation/migration, and surface redox reactions. Finally, the perspective and challenge of CO2 photoreduction in MOF/COF platforms are further proposed and discussed. It is expected that this Account would provide deep insight into the integration of PSs and catalysts in COFs and MOFs with well-defined structures and afford significant inspiration toward enhanced performance in heterogeneous catalysis.

Microplastics affect soil bacterial community assembly more by their shapes rather than the concentrations.

Polyethylene film mulching is a key technology for soil water retention in dryland agriculture, but the aging of the films can generate a large number of microplastics with different shapes. There exists a widespread misunderstanding that the concentrations of microplastics might be the determinant affecting the diversity and assembly of soil bacterial communities, rather than their shapes. Here, we examined the variations of soil bacteria community composition and functioning under two-year field incubation by four shapes (ball, fiber, fragment and powder) of microplastics along the concentration gradients (0.01%, 0.1% and 1%). Data showed that specific surface area of microplastics was significantly positively correlated with the variations of bacterial community abundance and diversity (r=0.505, p<0.05). The fragment- and fiber-shape microplastics displayed more pronounced interfacial continuity with soil particles and induced greater soil bacterial α-diversity, relative to the powder- and ball-shape ones. Strikingly, microplastic concentrations were not significantly correlated with bacterial community indices (r=0.079, p>0.05). Based on the variations of the ßNTI, bacterial community assembly actually followed both stochastic and deterministic processes, and microplastic shapes significantly modified soil biogeochemical cycle and ecological functions. Therefore, the shapes of microplastics, rather than the concentration, significantly affected soil bacterial community assembly, in association with microplastic-soil-water interfaces.

CO2 Cycloaddition under Ambient Conditions over Cu-Fe Bimetallic Metal-Organic Frameworks.

Carbon dioxide cycloaddition into fine chemicals is prospective technology to solve energy crisis and environmental issues. However, high temperature and pressure are usually required in the conventional cycloaddition reactions of CO2 with epoxides. Moreover, metal active sites play a vital role in the CO2 cycloaddition, but it is still unclear. Herein, we select the isostructural MOF-919-Cu-Fe and MOF-919-Cu-Al as models to promote the performance and clarify the effects of metal type on the CO2 cycloaddition. The MOF-919-Cu-Fe with exposed Fe and Cu Lewis acid sites reaches the CO2 cycloaddition with over 99.9% conversion and over 99.9% selectivity at room temperature and a 1 bar CO2 atmosphere, 3.0- and 52.6-fold higher than those of the MOF-919-Cu-Al with Al and Cu sites (33.8%) and the 1H-pyrazole-4-carboxylic acid, Fe, and Cu mixed system (1.9%), respectively. The proposed mechanism demonstrated that the exposed Fe3+ sites facilitate the ring opening of epoxide and CO2 activation to boost the CO2 cycloaddition reaction. This work provides a new insight to tune the catalytic sites of MOFs to achieve high performance for CO2 fixation.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Photoacoustic imaging-guided triple-responsive nanoparticles with tumor hypoxia relief for improving chemotherapy/ photothermal/photodynamic synergistic therapy against breast cancer.

Chemo-photothermal/photodynamic synergistic therapy is a new effective cancer treatment method to overcome the limitations of single chemotherapy. However, the limited low photothermal conversion efficiency, the hypoxic tumor microenvironment, and premature leakage of the drug constrain their clinical applications. To address these challenges, an all-in-one biodegradable polydopamine-coated UiO-66 framework nanomedicine (DUPM) was developed to co-deliver the drug doxorubicin hydrochloride (DOX) and the excellent photothermal material MoOx nanoparticles (NPs). The results showed that DUPM exhibited good physicochemical stability and efficiently accumulated tumor tissues under pH-, glutathione-, and NIR-triggered drug release behaviour. Of note, the synthesized MoOx NPs endowed DUPM with self-supporting oxygen production and generated more reactive oxygen species (1O2 and·OH), besides, it induces Mo-mediated redox reaction to deplete excessive glutathione thus relieving tumor hypoxia to enhance PDT, further improving synergistic therapy. Meanwhile, DUPM showed strong absorption in the near-infrared range and high photothermal conversion efficiency at 808 nm (51.50%) to realize photoacoustic imaging-guided diagnosis and treatment of cancer. Compared with monotherapy, the in vivo anti-tumor efficacy results showed that DUMP exerted satisfactory tumor growth inhibition effects (94.43%) with good biocompatibility. This study provides a facile strategy to develop intelligent multifunctional nanoparticles with tumor hypoxia relief for improving synergistic therapy and diagnosis against breast cancer.

Adjuvant-Free COVID-19 Vaccine with Glycoprotein Antigen Oxidized by Periodate Rapidly Elicits Potent Immune Responses.

Modification of antigens to improve their immunogenicity represents a promising direction for the development of protein vaccine. Here, we designed facilely prepared adjuvant-free vaccines in which the N-glycan of SARS-CoV-2 receptor-binding domain (RBD) glycoprotein was oxidized by sodium periodate. This strategy only minimally modifies the glycans and does not interfere with the epitope peptides. The RBD glycoprotein oxidized by high concentrations of periodate (RBDHO) significantly enhanced antigen uptake mediated by scavenger receptors and promoted the activation of antigen-presenting cells. Without any external adjuvant, two doses of RBDHO elicited 324- and 27-fold increases in IgG antibody titers and neutralizing antibody titers, respectively, compared to the unmodified RBD antigen. Meanwhile, the RBDHO vaccine could cross-neutralize all of the SARS-CoV-2 variants of concern. In addition, RBDHO effectively enhanced cellular immune responses. This study provides a new insight for the development of adjuvant-free protein vaccines.

Construction of a non-negative matrix factorization model of immunogenic cell death-related genes in lung adenocarcinoma and analysis of survival prognosis.

Purpose: To explore the effectiveness of the model based on non-negative matrix factorization (NMF), analyze the tumor microenvironment and immune microenvironment for evaluating the prognosis of lung adenocarcinoma, establish a risk model, and screen independent prognostic factors. Methods: Downloading the transcription data files and clinical information files of lung adenocarcinoma from TCGA database and GO database, the R software was used to establish the NMF cluster model, and then the survival analysis between groups, tumor microenvironment analysis, and immune microenvironment analysis was performed according to the NMF cluster result. R software was used to construct prognostic models and calculate risk scores. Survival analysis was used to compare survival differences between different risk score groups. Results: Two ICD subgroups were established according to the NMF model. The survival of the ICD low-expression subgroup was better than that of the ICD high-expression subgroup. Univariate COX analysis screened out HSP90AA1, IL1, and NT5E as prognostic genes, and the prognostic model established on this basis has clinical guiding significance. Conclusion: The model based on NMF has the prognostic ability for lung adenocarcinoma, and the prognostic model of ICD-related genes has a certain guiding significance for survival.

Graphene Oxide-Mediated Synthesis of Ultrathin Co-MOL for CO2 Photoreduction.

Metal-organic framework (MOF) materials have broad application prospects in catalysis because of their ordered structure and molecular adjustability. However, the large volume of bulky MOF usually leads to insufficient exposure of the active sites and the obstruction of charge/mass transfer, which greatly limits their catalytic performance. Herein, we developed a simple graphene oxide (GO) template method to fabricate ultrathin Co-metal-organic layer (2.0 nm) on reduced GO (Co-MOL@r-GO). The as-synthesized hybrid material Co-MOL@r-GO-2 exhibits highly efficient photocatalytic performance for CO2 reduction, and the CO yield can reach as high as 25,442 µmol/gCo-MOL, which is over 20 times higher than that of the bulky Co-MOF. Systematic investigations demonstrate that GO can act as a template for the synthesis of the ultrathin Co-MOL with more active sites and can be used as the electron transport medium between the photosensitizer and the Co-MOL to enhance the catalytic activity for CO2 photoreduction.

Spin Manipulation in a Metal-Organic Layer through Mechanical Exfoliation for Highly Selective CO2 Photoreduction.

Spin manipulation of transition-metal catalysts has great potential in mimicking enzyme electronic structures to improve activity and/or selectivity. However, it remains a great challenge to manipulate room-temperature spin state of catalytic centers. Herein, we report a mechanical exfoliation strategy to in situ induce partial spin crossover from high-spin (s=5/2) to low-spin (s=1/2) of the ferric center. Due to spin transition of catalytic center, mixed-spin catalyst exhibits a high CO yield of 19.7 mmol g-1 with selectivity of 91.6 %, much superior to that of high-spin bulk counterpart (50 % selectivity). Density functional theory calculations reveal that low-spin 3d-orbital electronic configuration performs a key function in promoting CO2 adsorption and reducing activation barrier. Hence, the spin manipulation highlights a new insight into designing highly efficient biomimetic catalysts via optimizing spin state.

[Coupling Relationship Between Soil Functions and Environmental Factors Along an Altitudinal Gradient: A Case Study of the Meili Mountain].

Soil respiration and extracellular enzyme activity are important components of the material cycle of mountain ecosystems and play key roles in maintaining ecosystem functions. To explore the coupling relationship between soil functions and environmental factors, the soil functional indicators, environmental factors, and effects of altitude on the soil function of 36 soil samples from 12 altitudes of the Meili Mountain were analyzed. The results showed that there were significant differences in soil respirations and enzyme activities among altitudes of Meili Mountain, and high-altitude areas had higher soil functions. Soil functions increased with altitudinal difference. PCA analysis showed that the first three axes explained 56.7%, 17.4%, and 8.7% of the variance in soil functional elevation change, respectively, indicating that the functional changes related to carbon and phosphorus were higher than those related to nitrogen. There were significant correlations between environmental factors and soil functional indicators; soil function indicators had stronger correlations with soil physicochemical properties than with climatic factors. Altitude mainly affected soil function indirectly by affecting soil physicochemical properties and climatic factors. These results have great scientific significance for improving the understanding of the material cycle and ecological function of the Meili Mountain ecosystem and provide an important reference for in-depth study of the altitude distribution pattern and evolution characteristics of the soil function of the mountain ecosystem.

pH-Sensitive and Biodegradable Mn3(PO4)2·3H2O Nanoparticles as an Adjuvant of Protein-Based Bivalent COVID-19 Vaccine to Induce Potent and Broad-Spectrum Immunity.

Developing a novel and potent adjuvant with great biocompatibility for immune response augmentation is of great significance to enhance vaccine efficacy. In this work, we prepared a long-term stable, pH-sensitive, and biodegradable Mn3(PO4)2·3H2O nanoparticle (nano-MnP) by simply mixing MnCl2/NaH2PO4/Na2HPO4 solution for the first time and employed it as an immune stimulant in the bivalent COVID-19 protein vaccine comprised of wild-type S1 (S1-WT) and Omicron S1 (S1-Omicron) proteins as antigens to elicit a broad-spectrum immunity. The biological experiments indicated that the nano-MnP could effectively activate antigen-presenting cells through the cGAS-STING pathway. Compared with the conventional Alum-adjuvanted group, the nano-MnP-adjuvanted bivalent vaccine elicited approximately 7- and 8-fold increases in IgG antibody titers and antigen-specific IFN-γ secreting T cells, respectively. Importantly, antisera of the nano-MnP-adjuvanted group could effectively cross-neutralize the SARS-CoV-2 and its five variants of concern (VOCs) including Alpha, Beta, Gamma, Delta, and Omicron, demonstrating that this bivalent vaccine based on S1-WT and S1-Omicron proteins is an effective vaccine design strategy to induce broad-spectrum immune responses. Collectively, this nano-MnP material may provide a novel and efficient adjuvant platform for various prophylactic and therapeutic vaccines and provide insights for the development of the next-generation manganese adjuvant.

Self-Adjuvanting Protein Vaccine Conjugated with a Novel Synthetic TLR4 Agonist on Virus-Like Liposome Induces Potent Immunity against SARS-CoV-2.

Exploring potent adjuvants and new vaccine strategies is crucial for the development of protein vaccines. In this work, we synthesized a new TLR4 agonist, structurally simplified lipid A analogue GAP112, as a potent built-in adjuvant to improve the immunogenicity of SARS-CoV-2 spike RBD protein. The new TLR4 agonist GAP112 was site-selectively conjugated on the N-terminus of RBD to construct an adjuvant-protein conjugate vaccine in a liposomal formulation. It is the first time that a TLR4 agonist is site-specifically and quantitatively conjugated to a protein antigen. Compared with an unconjugated mixture of GAP112/RBD, a two-dose immunization of the GAP112-RBD conjugate vaccine strongly activated innate immune cells, elicited a 223-fold increase in RBD-specific antibodies, and markedly enhanced T-cell responses. Antibodies induced by GAP112-RBD also effectively cross-neutralized SARS-CoV-2 variants (Delta/B.1.617.2 and Omicron/B.1.1.529). This conjugate strategy provides an effective method to greatly enhance the immunogenicity of antigen in protein vaccines against SARS-CoV-2 and other diseases.

Novel sialoglycan linkage for constructing adjuvant-protein conjugate as potent vaccine for COVID-19.

Self-adjuvanting protein vaccines have been proved to be highly immunogenic with efficient codelivery of adjuvant and antigen. Current protein vaccines with built-in adjuvants are all modified at the peptide backbone of antigen protein, which could not achieve minor epitope interference and adjuvant multivalency at the same time. Herein, we developed a new conjugate strategy to construct effective adjuvant-protein vaccine with adjuvant cluster effect and minimal epitope interference. The toll-like receptor 7 agonist (TLR7a) is covalently conjugated on the terminal sialoglycans of SARS-CoV-2-S1 protein, leading to intracellular release of the small-molecule stimulators with greatly reduced risks of systemic toxicity. The resulting TLR7a-S1 conjugate elicited strong activation of immune cells in vitro, and potent antibody and cellular responses with a significantly enhanced Th1-bias in vivo. TLR7a-S1-induced antibody also effectively cross-neutralized all variants of concern. This sialoglycoconjugation approach to construct protein conjugate vaccines will have more applications to combat SARS-CoV-2 and other diseases.