The Preparation of N, P-Doped NiSe Nanorod Electrode Materials on Nickel Foam Using the Microwave Method for High-Performance Supercapacitors.

Transition metal selenides have the leading position in the field of energy storage and conversion due to their high theoretical capacity, good electrical conductivity, and cycling stability. Nickel is widely used for the construction of positive electrodes in devices due to its good conductivity, variable valence state, and ideal redox activity. NiSe materials have high internal resistance and are prone to volume change during charging and discharging, thus affecting the practical application of this electrode material, and the reported NiSe materials have not achieved a more desirable capacity value. Therefore, in this study, N, P-NiSe nanoelectrode materials were prepared using nickel foam as the nickel source and hexachlorocyclotriphonitrile as the nitrogen and phosphorus dopant using an efficient, energy-saving, and simple microwave method. It was also characterised by XRD and XPS to confirm the successful preparation of N, P-NiSe materials. In addition, the material yielded a high capacitance value (3184 F g-1) and good cycling stability (72% of the initial capacitance value was retained after 4000 cycles) in electrochemical tests. To demonstrate its excellent suitability for practical applications, an asymmetric supercapacitor was assembled using N, P-NiSe as the anode and activated carbon as the cathode. At an operating voltage of 1.6 V, the device achieved an energy density of 289.06 Wh kg-1 and a power density of 799.26 W kg-1 and retained 80% of its initial capacity after 20,000 cycles.

Comprehensive evaluation of the relationship between biomarker profiles and neoadjuvant chemotherapy outcomes for breast cancer patients.

BACKGROUND: Accurately predicting the response to neoadjuvant chemotherapy (NAC) in breast cancer patients is crucial for guiding treatment strategies and enhancing clinical outcomes. Current studies have primarily focused on a limited set of biomarkers. More importantly, the results of many studies are in conflict. To address this, we conducted a comprehensive evaluation of the predictive value of a diverse range of clinically available molecular biomarkers in breast cancer, including HER2, ER, PR, TOPO II, EGFR, Ki67, CK5/6, AR, and p53. Additionally, we assessed changes in these biomarkers after NAC administration. METHODS: Our study involved 189 patients with invasive breast cancer who underwent NAC at our institute. We examined biomarker profiles in core-needle biopsies taken before NAC and in surgical specimens obtained after NAC. We examined the association between these biomarkers and NAC outcomes, focusing on two main aspects: the rate of pathological complete response (pCR) and the reduction in tumor size. We used Chi-square and Mann-Whitney U tests to compare biomarker status changes between pCR and non-pCR patients. Linear regression analysis was employed to evaluate the relationship between biomarker status and tumor shrinkage rate. Additionally, we compared the expression status of these biomarkers before and after NAC using Chi-square and Wilcoxon signed-rank tests. RESULTS AND CONCLUSIONS: Our results demonstrated significant differences in the expression levels of HER2, ER, PR, TOPO II, EGFR, and Ki67 between pCR and non-pCR patients, underscoring their potential as predictive markers for NAC outcomes. Importantly, our results have shed light on the contentious issue surrounding TOPO II in NAC outcome prediction. We have provided evidence that establishes a significantly positive association between TOPO II expression level and the pCR rate. Notably, tumor size was identified as a relevant predictive factor for achieving pCR. Regarding biomarker profiles, only Ki67 levels and TOPO II status exhibited changes following NAC, resolving previous controversies. While the ER and PR status remained unchanged, their expression values exhibited a slight but significant decrease post-NAC. Our results provide clarity and insights into the value and potential of using these biomarkers to predict NAC responses and prognosis in breast cancer patients.

Microwave Construction of NiSb/NiTe Composites on Ni-Foam for High-Performance Supercapacitors.

In this paper, NiSb/NiTe/Ni composites were smoothly developed via the microwave method for supercapacitors. The synthesis of NiSb/NiTe crystals was revealed by X-ray photoelectron spectroscopy and X-ray diffraction. The analytic results of scanning electron microscopy and energy dispersive spectroscopy uncover the microscopic morphology as well as the constituent elements of the composites. Self-supported NiSb/NiTe is a supercapacitor cathode that combines high capacitance with excellent cycling stability. The obtained composite electrode displayed remarkable electrochemical properties, presenting a special capacitance of 1870 F g-1 (1 A g-1) and 81.5% of the original capacity through 30,000 times (10 A g-1) of the charging/discharging process. Further, an asymmetric supercapacitor was prepared employing NiSb/NiTe as a cathode and activated carbon as an anode. NiSb/NiTe//AC exhibited a high energy density of 224.6 uW h cm-2 with a power density of 750 µW cm-2 and provided a favorable cycling stability of 83% after 10,000 cycles.

Genetic dissection of maize (Zea mays L.) chlorophyll content using multi-locus genome-wide association studies.

BACKGROUND: The chlorophyll content (CC) is a key factor affecting maize photosynthetic efficiency and the final yield. However, its genetic basis remains unclear. The development of statistical methods has enabled researchers to design and apply various GWAS models, including MLM, MLMM, SUPER, FarmCPU, BLINK and 3VmrMLM. Comparative analysis of their results can lead to more effective mining of key genes. RESULTS: The heritability of CC was 0.86. Six statistical models (MLM, BLINK, MLMM, FarmCPU, SUPER, and 3VmrMLM) and 1.25 million SNPs were used for the GWAS. A total of 140 quantitative trait nucleotides (QTNs) were detected, with 3VmrMLM and MLM detecting the most (118) and fewest (3) QTNs, respectively. The QTNs were associated with 481 genes and explained 0.29-10.28% of the phenotypic variation. Additionally, 10 co-located QTNs were detected by at least two different models or methods, three co-located QTNs were identified in at least two different environments, and six co-located QTNs were detected by different models or methods in different environments. Moreover, 69 candidate genes within or near these stable QTNs were screened based on the B73 (RefGen_v2) genome. GRMZM2G110408 (ZmCCS3) was identified by multiple models and in multiple environments. The functional characterization of this gene indicated the encoded protein likely contributes to chlorophyll biosynthesis. In addition, the CC differed significantly between the haplotypes of the significant QTN in this gene, and CC was higher for haplotype 1. CONCLUSION: This study's results broaden our understanding of the genetic basis of CC, mining key genes related to CC and may be relevant for the ideotype-based breeding of new maize varieties with high photosynthetic efficiency.

Prognostic and Immunological Roles of CES2 in Breast Cancer and Potential Application of CES2-Targeted Fluorescent Probe DDAB in Breast Surgery.

Purpose: The expression and function of CES2 in breast cancer (BRCA) has not been fully elucidated. The purpose of this study was to investigate its clinical significance in BRCA. Patients and Methods: Bioinformatics analysis tools and databases, including The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO) databases, SURVIVAL packages, STRING database, Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, Gene set variation analysis (GSVA), and Tumor Immunity Estimation Resource (TIMER), were utilized to measure the expression level and clarify the clinical significance of CES2 in BRCA. In addition, we verified the expression level of CES2 in BRCA at the cellular and tissue levels by Western blot, immunohistochemistry (IHC) and real-time fluorescence quantitative PCR assays. Furthermore, DDAB is the first reported near-infrared fluorescent probe that can be used to monitor CES2 in vivo. We applied the CES2-targeted fluorescent probe DDAB in BRCA for the first time and verified its physicochemical properties and labeling sorting ability by CCK-8, cytofluorimetric imaging, flow cytometry fluorescence detection, and isolated human tumor tissue imaging assays. Results: The expression of CES2 was higher in normal tissues than that in BRCA tissues. Patients with lower CES2 expression in the BRCA T4 stage had a poorer prognosis. Finally, we applied the CES2-targeted fluorescent probe DDAB in BRCA for the first time, which was demonstrated to have good cellular imaging performance with low biological toxicity in BRCA cells and ex vivo human breast tumor tissue models. Conclusion: CES2 can be considered a potential biomarker to predict the prognosis of breast cancer at stage T4 and might contribute to the development of immunological treatment strategies. Meanwhile, CES2 is able to distinguish between breast normal and tumor tissues, the CES2-targeting NIR fluorescent probe DDAB may have potential for surgical applications in BRCA.

Enhanced Thermoelectric Performance of n-Type PbTe via Carrier Concentration Optimization over a Broad Temperature Range.

The optimal carrier concentration of thermoelectric materials increases with increasing temperature. However, conventional aliovalent doping usually provides an approximately constant carrier concentration over the whole temperature range, which can only match the optimal carrier concentration in a narrow temperature range. In this work, n-type indium and aluminum codoped PbTe were prepared with high-pressure synthesis, followed by spark plasma sintering. While Al doping can provide a roughly constant carrier concentration with varying temperatures, In doping can trap electrons at low temperatures and release them at high temperatures, thus optimizing the carrier concentration over a broad temperature range. As a result, both electrical transport properties and thermal conductivity are optimized, and a significantly enhanced thermoelectric performance is achieved in InxAl0.02Pb0.98Te. The optimal In0.008Al0.02Pb0.98Te shows a peak ZT of 1.3 and an average ZT of 1, with a decent conversion efficiency of 14%. Current work demonstrates that optimizing carrier concentration with varying temperatures is effective to enhance the thermoelectric performance of n-type PbTe.

Expression of different genotypes of bovine TRDMT1 gene and its polymorphisms association with body measures in Qinchuan cattle (Bos Taurus).

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.

Sensitization of cervical cancer cells to radiation by the cyclin-dependent kinase inhibitor dinaciclib.

Dinaciclib is a selective cyclin-dependent kinase inhibitor, but its radiosensitizing effect remains unclear. The aim of this study is to investigate the radiosensitizing effect of Dinaciclib on cervical cancer cells. Two cervical cancer cell lines, Hela and Siha, were selected, and the IC50 was determined by CCK8. The radiosensitizing effect of Dinaciclib was verified by plate cloning assay, and the G2/M phase arrest and apoptosis of IR cells were verified by flow cytometry. Immunofluorescence assay was used to verify the formation of γH2AX foci following DNA damage. Western blot was performed to detect cell cycle, apoptosis, autophagy, and DNA damage-related pathways. Dinaciclib increased the cell sensitivity to IR. IR induced G2/M phase arrest and apoptosis, and Dinaciclib enhanced this effect. Further, Dinaciclib delayed DNA repair, including non-homologous end joining repair and homologous recombination repair, and reduced the expression of DNA repair proteins Ku80 (SiHa cells), Ku70, and RAD51, as well as the expression of apoptotic marker Bcl-2. The expression of autophagy marker Beclin1 induced tumor cell death and increased the formation of DNA damage marker γH2AX foci. Dinaciclib improves the sensitivity of cervical cancer cells to IR by inducing cell cycle arrest, delaying DNA repair, and increasing apoptosis. However, further research is needed to unravel the complexity of DNA repair pathways.

U.S. winter wheat yield loss attributed to compound hot-dry-windy events.

Climate extremes cause significant winter wheat yield loss and can cause much greater impacts than single extremes in isolation when multiple extremes occur simultaneously. Here we show that compound hot-dry-windy events (HDW) significantly increased in the U.S. Great Plains from 1982 to 2020. These HDW events were the most impactful drivers for wheat yield loss, accounting for a 4% yield reduction per 10 h of HDW during heading to maturity. Current HDW trends are associated with yield reduction rates of up to 0.09 t ha-1 per decade and HDW variations are atmospheric-bridged with the Pacific Decadal Oscillation. We quantify the "yield shock", which is spatially distributed, with the losses in severely HDW-affected areas, presumably the same areas affected by the Dust Bowl of the 1930s. Our findings indicate that compound HDW, which traditional risk assessments overlooked, have significant implications for the U.S. winter wheat production and beyond.

RNA-seq Based Transcriptome Analysis Reveals The Cross-Talk of Macrophage and Adipocyte of Chicken Subcutaneous Adipose Tissue during The Embryonic and Post-Hatch Period.

With high fecundity and short production cycle, poultry is one of the important sources of meat. During the embryonic and post-hatch period, the higher death rate caused huge economic losses in poultry production. Our previous study showed that chick subcutaneous adipose tissue is an important energy supply tissue besides yolk. Therefore, the metabolic mechanism of subcutaneous adipose tissue in chicks could provide a new perspective of brooding. The objectives of the current study were to evaluate the differences between chick subcutaneous adipose tissue and abdominal adipose tissue before and after hatching and reveal the cross-talk of different cells within the chick subcutaneous adipose tissue. The results of RNA-seq and weighted gene co-expression network analysis (WGCNA) of chick subcutaneous and abdominal adipose tissues showed that the function of chick subcutaneous tissue was related to immunoreaction, and macrophage could be the major immune infiltration cell type in chicken subcutaneous adipose tissue, which were also verified by qPCR, HE stain, and IHC. The results of free fatty acids (FFAs)-induced the cross-talk between macrophages and adipocytes showed that FFAs-Ccl2 (chicken CCL26) axis could have an important role in lipid transportation in adipose tissue. The results of Oil Red O and Nile red stain demonstrated that macrophages have the ability to absorb FFAs quickly. Interestingly, according to the genomic organization of CCL family with representative vertebrate species, we found that chicken CCL26 could be the major chemokine in chicken adipocyte as the status of CCL2 in mammal adipocyte. In conclusion, we demonstrate that FFA-induced Ccl2 (chicken CCL26) secretion is crucial in determining fat depot-selective adipose tissue macrophage (ATM) infiltration, which could be an important medium of lipid transportation in chicken subcutaneous adipose tissue. These findings may have multiple important implications for understanding macrophage biology with chick subcutaneous adipose tissue and provide theoretical basis for lipid metabolism in poultry brooding.

Hydrogenated Boride-Assisted Gram-Scale Production of Platinum-Palladium Alloy Nanoparticles on Carbon Black for PEMFC Cathodes: A Study from a Practical Standpoint.

Platinum-palladium (PtPd) alloy catalysts with high durability are viable substituents to commercial Pt/C for proton exchange membrane fuel cells (PEMFCs). Herein, a facile approach for gram-scale preparation of PtxPd100-x alloy nanoparticles on carbon black is developed. The optimized Pt54Pd46/B-C catalyst shows a mass activity (MA) of 0.549 A mgPt-1 and a specific activity (SA) of 0.463 mA cm-2 at the rotating disk electrode (RDE) level, which are 3.4 and 1.9 times those of commercial Pt/C, respectively. In H2/O2 and H2/air PEMFCs, the membrane electrode assembly (MEA) with Pt54Pd46/B-C achieves peak power densities of 2.33 and 1.04 W cm-2, respectively, and shows negligible performance degradation after 100 h of running in H2/O2 conditions. Moreover, the MA of MEA with Pt54Pd46/B-C in H2/O2 PEMFC reaches 0.978 A mgPt+Pd-1 beyond the 2020 target of the Department of Energy (DOE) of 0.44 A mgPt-1. After 30k cyclic voltammetry cycles in PEMFC, the MA loss and cell voltage loss of MEA with Pt54Pd46/B-C are well within the DOE 2020 target. Density functional theory calculations reveal that the PtPd(111) surface can weaken the adsorption of *OOH and *OH compared to the Pt(111) surface, indicating that Pt54Pd46/B-C is more energetically favorable for the oxygen reduction reaction (ORR) than commercial Pt/C. This study offers a new approach for batch preparation of PtPd alloy-based catalysts for PEMFCs.

Texture Analysis of Enhanced MRI and Pathological Slides Predicts EGFR Mutation Status in Breast Cancer.

Objective: Image texture information was extracted from enhanced magnetic resonance imaging (MRI) and pathological hematoxylin and eosin- (HE-) stained images of female breast cancer patients. We established models individually, and then, we combine the two kinds of data to establish model. Through this method, we verified whether sufficient information could be obtained from enhanced MRI and pathological slides to assist in the determination of epidermal growth factor receptor (EGFR) mutation status in patients. Methods: We obtained enhanced MRI data from patients with breast cancer before treatment and selected diffusion-weighted imaging (DWI), T1 fast-spin echo (T1 FSE), and T2 fast-spin echo (T2 FSE) as the data sources for extracting texture information. Imaging physicians manually outlined the 3D regions of interest (ROIs) and extracted texture features according to the gray level cooccurrence matrix (GLCM) of the images. For the HE staining images of the patients, we adopted a specific normalization algorithm to simulate the images dyed with only hematoxylin or eosin and extracted textures. We extracted texture features to predict the expression of EGFR. After evaluating the predictive power of each model, the models from the two data sources were combined for remodeling. Results: For enhanced MRI data, the modeling of texture information of T1 FSE had a good predictive effect for EGFR mutation status. For pathological images, eosin-stained images can achieve a better prediction effect. We selected these two classifiers as the weak classifiers of the final model and obtained good results (training group: AUC, 0.983; 95% CI, 0.95-1.00; accuracy, 0.962; specificity, 0.936; and sensitivity, 0.979; test group: AUC, 0.983; 95% CI, 0.94-1.00; accuracy, 0.943; specificity, 1.00; and sensitivity, 0.905). Conclusion: The EGFR mutation status of patients with breast cancer can be well predicted based on enhanced MRI data and pathological data. This helps hospitals that do not test the EGFR mutation status of patients with breast cancer. The technology gives clinicians more information about breast cancer, which helps them make accurate diagnoses and select suitable treatments.

Efficacy and Safety of Mitoxantrone Hydrochloride Injection for Tracing Axillary Sentinel Nodes in Breast Cancer: A Self-Controlled Clinical Trial.

Background: Mitoxantrone hydrochloride injection for tracing (MHI), a new strategy to identify lymph nodes, has not been tested for axillary node staging in breast cancer. This multicenter, self-controlled, non-inferiority trial aimed to evaluate MHI's efficacy and safety in sentinel lymph node biopsy (SLNB). Methods: The trial was conducted across seven hospitals from December 2019 to December 2020. Patients with early-stage breast cancer received MHI and technetium-99m (99mTc) during the surgery. Sentinel node detection rates were compared between MHI and 99mTc to evaluate non-inferiority and concordance. Non-inferiority was valid if the lower limit of the 95% CI of sentinel node relative detection rate difference was ≥-5%. Results: SLN relative detection rate of MHI was 97.31% (362/372). Of the SLNs, 79.69% (871/1093) were co-detected by both tracers. Of the patients, 4.13% (16/387) had adverse events and recovered during the follow-up. Conclusions: MHI is a lymphatic tracer with comparable efficacy to radionuclides and can be used alone or in combination with radioactive substances for SLNB. Clinical Trial Registration: http://www.chinadrugtrials.org.cn, CTR20192435.

Organization and Complexity of the Yak (Bos Grunniens) Immunoglobulin Loci.

As important livestock in Qinghai-Tibet Plateau, yak provides meat and other necessities for Tibetans living. Plateau yak has resistance to diseases and stress, yet is nearly unknown in the structure and expression mechanism of yak immunoglobulin loci. Based on the published immunoglobulin genes of bovids (cattle, sheep and goat), the genomic organization of the yak immunoglobulin heavy chain (IgH) and immunoglobulin light chain (IgL) were described. The assemblage diversity of IgH, Igλ and Igκ in yak was similar to that in bovids, and contributes little to the antibody lineage compared with that in humans and mice. Somatic hypermutation (SHM) had a greater effect on immunoglobulin diversity in yak than in goat and sheep, and in addition to the complementarity-determining region (CDR), some loci in the framework region (FR) also showed high frequency mutations. CDR3 diversity showed that immunological lineages in yak were overwhelmingly generated through linkage diversity in IgH rearrangements. The emergence of new high-throughput sequencing technologies and the yak whole genome (2019) publication have greatly improved our understanding of the immune response in yaks. We had a more comprehensive analysis of yak immunoglobulin expression diversity by PE300, which avoided the disadvantage of missing low-frequency recombination in traditional Sanger sequencing. In summary, we described the schematic structure of the genomic organization of yak IgH loci and IgL loci. The analysis of immunoglobulin expression diversity showed that yak made up for the deficiency of V(D)J recombinant diversity by junctional diversity and CDR3 diversity. In addition, yak, like cattle, also had the same ultra-long IgH CDR3 (CDR3H), which provided more contribution to the diverse expression of yak immunoglobulin. These findings might provide a theoretical basis for disease resistance breeding and vaccine development in yak.

Habitat Analysis of Breast Cancer-Enhanced MRI Reflects BRCA1 Mutation Determined by Immunohistochemistry.

Objective: To use habitat analysis (also termed habitat imaging) for classifying untreated breast cancer-enhanced magnetic resonance imaging (MRI) in women. Moreover, we intended to obtain clustering parameters to predict the BReast CAncer gene 1 (BRCA1) gene mutation and to determine the use of MRI as a noninvasive examination tool. Methods: We obtained enhanced MRI data of patients with breast cancer before treatment and selected some sequences as the source of habitat imaging. We used the k-means clustering to classify these images. According to the formed subregions, we calculated several parameters to evaluate the clustering. We used immunohistochemistry to detect BRCA1 mutations. Moreover, we separately determined the ability of these parameters through independent modeling or multiple parameter joint modeling to predict these mutations. Results: Of all extracted values, separation (SP) demonstrated the best prediction performance for a single parameter (area under the receiver operating characteristic curve (AUC), 0.647; 95% confidence interval (CI), 0.557-0.731). Simultaneously, models based on the Calinski-Harabasz Index and sum of square error performed better in the training (AUC, 0.903; 95% CI, 0.831-0.96) and verification (AUC, 0.845; 95% CI, 0.723-0.942) sets for multiparameter joint modeling. Conclusion: Based on the enhanced MRI of breast tumors and the subregions generated according to the habitat imaging theory, the parameters extracted to describe the clustering effect could reflect the BRCA1 status. Differences between clusters, including the general differences of cluster centers and clusters and the similarity of samples within clusters, were the embodiment of this mutation. We propose an algorithm to predict the BRCA1 mutation of a patient according to the enhanced MRI of the breast tumor.

A novel 17 bp InDel polymorphism within the PPARGC1A gene is significantly associated with growth traits in sheep.

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Fresh perspectives on an established technique: Pulsed amplitude modulation chlorophyll a fluorescence.

Pulsed amplitude modulation (PAM) chlorophyll a fluorescence provides information about photosynthetic energy transduction. When reliably measured, chlorophyll a fluorescence provides detailed information about critical in vivo photosynthetic processes. Such information has recently provided novel and critical insights into how the yield potential of crops can be improved and it is being used to understand remotely sensed fluorescence, which is termed solar-induced fluorescence and will be solely measured by a satellite scheduled to be launched this year. While PAM chlorophyll a fluorometers measure fluorescence intensity per se, herein we articulate the axiomatic criteria by which instrumentally detected intensities can be assumed to assess fluorescence yield, a phenomenon quite different than fluorescence intensity and one that provides critical insight about how solar energy is variably partitioned into the biosphere. An integrated mathematical, phenomenological, and practical discussion of many useful chlorophyll a fluorescence parameters is presented. We draw attention to, and provide examples of, potential uncertainties that can result from incorrect methodological practices and potentially problematic instrumental design features. Fundamentals of fluorescence measurements are discussed, including the major assumptions underlying the signals and the methodological caveats about taking measurements during both dark- and light-adapted conditions. Key fluorescence parameters are discussed in the context of recent applications under environmental stress. Nuanced information that can be gleaned from intra-comparisons of fluorescence-derived parameters and intercomparisons of fluorescence-derived parameters with those based on other techniques is elucidated.

Identification of novel biomarkers in breast cancer via integrated bioinformatics analysis and experimental validation.

Breast cancer (BC), an extremely aggressive malignant tumor, causes a large number of deaths worldwide. In this study, we pooled profile datasets from three cohorts to illuminate the underlying key genes and pathways of BC. Expression profiles GSE42568, GSE45827, and GSE124646, including 244 BC tissues and 28 normal breast tissues, were integrated and analyzed. Differentially expressed genes (DEGs) were screened out based on these three datasets. Functional analysis including Gene Ontology (GO) and Kyoto Encyclopedia of Gene and Genome (KEGG) pathway were performed using The Database for Annotation, Visualization and Integrated Discovery (DAVID). Moreover, Cytoscape with Search Tool for the Retrieval of Interacting Genes (STRING) and Molecular Complex Detection (MCODE) plugin were utilized to visualize protein protein interaction (PPI) of these DEGs. The module with the highest connectivity of gene interactions was selected for further analysis. All of these hub genes had a significantly worse prognosis in BC by survival analysis. Additionally, four genes (CDK1, CDC20, AURKA, and MCM4) dramatically were enriched in oocyte meiosis and cell cycle pathways through re-analysis of DAVID. Moreover, the mRNA and protein levels of CDK1, CDC20, AURKA, and MCM4 were significantly increased in BC patients. In addition, knockdown of CDK1 and CDC20 by small interfering RNA remarkably suppressed cell migration and invasion in MCF-7 and MDA-MB-231 cells. In conclusion, our results suggested that CDK1, CDC20, AURKA, and MCM4 were reliable biomarkers of BC via bioinformatics analysis and experimental validation and may act as prospective targets for BC diagnosis and treatment.

Laying down of gold nanorods monolayers on solid surfaces for surface enhanced Raman spectroscopy applications.

Laying-down gold nanorods (GNRs) of a monolayer immobilized on a solid substrate was realized with a hybrid method, a combination of three elemental technologies: surface modification, electrophoresis, and solvent evaporation. The self-assembly of CTAB-protected GNRs in the solution was induced by 0.05 mM of EDTA. The assembled GNRs were deposited in a laying-down form on the solid surface during the hybrid method. The final coverage was over 71% on the substrate with an area larger than 0.6 cm2. The spacing between the sides of the GNRs was fixed to be 4.6 ± 0.9 nm by the thermal annealing-promoted crystalline packing of the bilayer of CTAB salt-bridged with EDTA. The obtained laying-down GNRs of a monolayer on the gold substrate show a small shift of the transverse LSPR around 550-570 nm (with a width of around 100 nm) and a large red shift of the longitudinal LSPR to be 900-1050 nm (with a width of 500 nm), because of the strong electromagnetic coupling between the GNRs and gold substrate. Therefore it can be used in a wide range of wavelengths for surface enhanced Raman spectroscopy (SERS) applications. The film has a high enhancement factor with 105 for R6G.