Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 75
Filtrar
1.
J Matern Fetal Neonatal Med ; 37(1): 2397722, 2024 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-39284761

RESUMO

OBJECTIVE: The inconsistency in conclusions from early observational studies has sparked our interest in elucidating the relationship between lipid levels and susceptibility to hyperemesis gravidarum (HG). This study wishes to employed Mendelian randomization analysis to investigate the causal relationship between low-density lipoprotein cholesterol (LDL-C) and HG. METHODS: We employed Tow-Sample MR analysis to investigate the causal associations between LDL-C and HG. Specific variables were selected from GWAS database for MR analysis, using single nucleotide polymorphisms (SNPs) as our instruments. The threshold for significant SNPs as genetic instruments has been set at 5 × 10-8. F-statistic was employed to validate the strength of exposure instruments. The causality was mainly evaluated by Inverse Variance Weighted method (IVW). To address potential bias from the selection of genetic variants with pleiotropic effects, sensitivity analysis was performed by Cochrane Q-test, MR Egger, weighted median, MR-PRESSO and Leave-one-out methods. To validate the directionality of causal relationships, we employed Steiger test to filter SNPs. At last, we conducted reverse MR to exclude the causal impact of HG on LDL-C levels. RESULTS: Our MR results identified the effect of genetically predicted increased LDL-C levels on increased genetic susceptibility to HG (OR:1.30; 95%CI:1.03-1.65; p = 0.028). In reverse MR analyses, no evidence was found for causal effect of HG on LDL-C levels (OR:1.00; 95%CI:1.00-1.01; p = 0.163). Sensitivity analyses were used to confirm reliability. CONCLUSION: This study may have provided evidence of genetically predicted increased LDL-C levels on increased genetic susceptibility to HG. Appropriate lowering LDL-C levels may serve as a preventive and treatment measure for HG.


Assuntos
LDL-Colesterol , Hiperêmese Gravídica , Análise da Randomização Mendeliana , Polimorfismo de Nucleotídeo Único , Humanos , Feminino , Gravidez , LDL-Colesterol/sangue , Hiperêmese Gravídica/genética , Hiperêmese Gravídica/sangue , Hiperêmese Gravídica/epidemiologia , Estudo de Associação Genômica Ampla , Predisposição Genética para Doença , Fatores de Risco
2.
Int J Pediatr Otorhinolaryngol ; 181: 111979, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38739980

RESUMO

BACKGROUND: Maternally inherited hearing loss has been associated with mitochondrial genes, including MT-RNR1, MT-TL1, MT-TS1, MT-TK and MT-TE. Among these genes, MT-RNR1 is known to be a hotspot for pathogenic variants related to aminoglycoside ototoxicity and nonsyndromic hearing loss. However, the frequency and spectrum of variants in these genes, particularly in multi-ethnic hearing loss patients from Southwestern China, are still not fully understood. METHODS: In this study, we enrolled 460 hearing loss patients from various ethnic backgrounds (Han, Yi, Dai, Hani, etc.) in Southwestern China. Next-generation sequencing was used to analyze the mitochondrial MT-RNR1, MT-TL1, MT-TS1, MT-TK and MT-TE genes. Subsequently, bioinformatical methods were employed to evaluate the identified variants. RESULTS: Among the patients with hearing loss, we identified 70 variants in MT-RNR1 (78.6 %, 55/70), MT-TL1 (4.3 %, 3/70), MT-TS1 (4.3 %, 3/70), MT-TK (7.1 %, 5/70) and MT-TE (5.7 %, 4/70) genes. We found that 15 variants were associated with hearing loss, including m.1555 A > G and m.1095 T > C. Additionally, we discovered three reported mitochondrial variants (m.676 G > A, m.7465 insC, and m.7474 A > G) newly correlated with hearing loss. Notably, certain pathogenic variants, such as m.1555 A > G, displayed non-consistent distributions among the multi-ethnic patients with hearing loss. Furthermore, the number of variants associated with hearing loss was higher in the Sinitic group (n = 181) and Tibeto-Burman group (n = 215) compared to the Kra-Dai group (n = 38) and Hmong-Mien group (n = 26). CONCLUSIONS: This present study revealed the distribution of mitochondrial variants linked to hearing loss across various ethnic groups in Southwestern China. These data suggest a potential correlation between the distribution of mitochondrial variants associated with hearing loss and ethnic genetic backgrounds.


Assuntos
Genes Mitocondriais , Perda Auditiva , Humanos , China , Masculino , Feminino , Criança , Pré-Escolar , Perda Auditiva/genética , Adolescente , Adulto , Lactente , Adulto Jovem , Sequenciamento de Nucleotídeos em Larga Escala , DNA Mitocondrial/genética
3.
Int J Neonatal Screen ; 10(2)2024 Mar 29.
Artigo em Inglês | MEDLINE | ID: mdl-38651393

RESUMO

The aim of this study was to observe the outcomes of newborn screening (NBS) in a certain population by using next-generation sequencing (NGS) as a first-tier screening test combined with tandem mass spectrometry (MS/MS). We performed a multicenter study of 29,601 newborns from eight screening centers with NBS via NGS combined with MS/MS. A custom-designed panel targeting the coding region of the 142 genes of 128 inborn errors of metabolism (IEMs) was applied as a first-tier screening test, and expanded NBS using MS/MS was executed simultaneously. In total, 52 genes associated with the 38 IEMs screened by MS/MS were analyzed. The NBS performance of these two methods was analyzed and compared respectively. A total of 23 IEMs were diagnosed via NGS combined with MS/MS. The incidence of IEMs was approximately 1 in 1287. Within separate statistical analyses, the positive predictive value (PPV) for MS/MS was 5.29%, and the sensitivity was 91.3%. However, for genetic screening alone, the PPV for NGS was 70.83%, with 73.91% sensitivity. The three most common IEMs were methylmalonic academia (MMA), primary carnitine deficiency (PCD) and phenylketonuria (PKU). The five genes with the most common carrier frequencies were PAH (1:42), PRODH (1:51), MMACHC (1:52), SLC25A13 (1:55) and SLC22A5 (1:63). Our study showed that NBS combined with NGS and MS/MS improves the performance of screening methods, optimizes the process, and provides accurate diagnoses.

4.
Curr Pharm Des ; 30(15): 1178-1193, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38561613

RESUMO

BACKGROUND: Spinal Muscular Atrophy (SMA) is a severe motor neuronal disorder with high morbidity and mortality. Securinine has shown the potential to treat SMA; however, its anti-SMA role remains unclear. OBJECTIVE: This study aims to reveal the anti-SMA mechanisms of securinine. METHODS: Securinine-associated targets were acquired from Herbal Ingredients' Targets (HIT), Similarity Ensemble Approach (SEA), and SuperPred. SMA-associated targets were obtained from GeneCards and Dis- GeNET. Protein-protein Interaction (PPI) network was constructed using GeneMANIA, and hug targets were screened using cytoHubba. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed using ClusterProfifiler. Molecular docking was conducted using Pymol and Auto- Dock. In vitro assays were used to verify the anti-SMA effects of securinine. RESULTS: Twenty-six intersection targets of securinine and SMA were obtained. HDAC1, HDAC2, TOP2A, PIK3R1, PRMT5, JAK2, HSP90AB1, TERT, PTGS2, and PAX8 were the core targets in PPI network. GO analysis demonstrated that the intersecting targets were implicated in the regulation of proteins, steroid hormones, histone deacetylases, and DNA transcription. KEGG analysis, pathway-pathway, and hub target-pathway networks revealed that securinine might treat SMA through TNF, JAK-STAT, Ras, and PI3K-Akt pathways. Securinine had a favorable binding affinity with HDAC1, HSP90AB, JAK2, PRMT5, PTGS2, and TERT. Securinine rescued viability suppression, mitochondria damage, and SMN loss in the SMA cell model. Furthermore, securinine increased HDAC1 and PRMT5 expression, decreased PTGS2 expression, suppressed the JAK2-STAT3 pathway, and promoted the PI3K-Akt pathway. CONCLUSION: Securinine might alleviate SMA by elevating HDAC1 and PRMT5 expression and reducing PTGS2 via JAK2-STAT3 suppression and PI3K-Akt activation.


Assuntos
Atrofia Muscular Espinal , Farmacologia em Rede , Plantas Medicinais , Atrofia Muscular Espinal/tratamento farmacológico , Atrofia Muscular Espinal/metabolismo , Atrofia Muscular Espinal/patologia , Humanos , Plantas Medicinais/química , Simulação de Acoplamento Molecular , Azepinas/farmacologia , Azepinas/química , Azepinas/isolamento & purificação , Lactonas/farmacologia , Lactonas/química , Lactonas/isolamento & purificação , Estrutura Molecular , Compostos Heterocíclicos de Anel em Ponte , Piperidinas
5.
BMC Med Genomics ; 17(1): 55, 2024 Feb 20.
Artigo em Inglês | MEDLINE | ID: mdl-38378613

RESUMO

BACKGROUND: Gene variants are responsible for more than half of hearing loss, particularly in nonsyndromic hearing loss (NSHL). The most common pathogenic variant in SLC26A4 gene found in East Asian populations is c.919-2A > G followed by c.2168A > G (p.H723R). This study was to evaluate their variant frequencies in patients with NSHL from special education schools in nine different areas of Southwest China's Yunnan. METHODS: We performed molecular characterization by PCR-products directly Sanger sequencing of the SLC26A4 c.919-2AG and c.2168 A > G variants in 1167 patients with NSHL including 533 Han Chinese and 634 ethnic minorities. RESULTS: The SLC26A4 c.919-2A > G variant was discovered in 8 patients with a homozygous state (0.69%) and twenty-five heterozygous (2.14%) in 1167 patients with NSHL. The total carrier rate of the c.919-2A > G variant was found in Han Chinese patients with 4.50% and ethnic minority patients with 1.42%. A significant difference existed between the two groups (P < 0.05). The c.919-2A > G allele variant frequency was ranged from 3.93% in Kunming to zero in Lincang and Nvjiang areas of Yunnan. We further detected the SLC26A4 c.2168 A > G variant in this cohort with one homozygotes (0.09%) and seven heterozygotes (0.60%), which was detected in Baoshan, Honghe, Licang and Pu`er areas. Between Han Chinese group (0.94%) and ethnic minority group (0.47%), there was no statistical significance (P > 0.05). Three Han Chinese patients (0.26%) carried compound heterozygosity for c.919-2A > G and c.2168 A > G. CONCLUSION: These data suggest that the variants in both SLC26A4 c.919-2A > G and c.2168 A > G were relatively less frequencies in this cohort compared to the average levels in most regions of China, as well as significantly lower than that in Han-Chinese patients. These results broadened Chinese population genetic information resources and provided more detailed information for regional genetic counselling for Yunnan.


Assuntos
Surdez , Etnicidade , Proteínas de Membrana Transportadoras , Humanos , Etnicidade/genética , Mutação , Proteínas de Membrana Transportadoras/genética , Grupos Minoritários , China/epidemiologia , Conexinas/genética , Transportadores de Sulfato/genética
6.
Eur J Pharmacol ; 968: 176404, 2024 Apr 05.
Artigo em Inglês | MEDLINE | ID: mdl-38382804

RESUMO

ß-thalassemia, a globally prevalent genetic disorder, urgently requires innovative treatment options. Fetal hemoglobin (HbF) induction stands as a key therapeutic approach. This investigation focused on Ginsenoside Rg1 from the Panax genus for HbF induction. Employing K562 cells and human erythroid precursor cells (ErPCs) derived from neonatal cord blood, the study tested Rg1 at different concentrations. We measured its effects on γ-globin mRNA levels and HbF expression, alongside assessments of cell proliferation and differentiation. In K562 cells, Rg1 at 400 µM significantly increased γ-globin mRNA expression by 4.24 ± 1.08-fold compared to the control. In ErPCs, the 800 µM concentration was most effective, leading to an over 80% increase in F-cells and a marked upregulation in HbF expression. Notably, Rg1 did not adversely affect cell proliferation or differentiation, with the 200 µM concentration showing an increase in γ-globin mRNA by 2.33 ± 0.58-fold, and the 800 µM concentration enhancing HbF expression by 2.59 ± 0.03-fold in K562 cells. Our results underscore Rg1's potential as an effective and safer alternative for ß-thalassemia treatment. By significantly enhancing HbF levels without cytotoxicity, Rg1 offers a notable advantage over traditional treatments like Hydroxyurea. While promising, these in vitro findings warrant further in vivo exploration to confirm Rg1's therapeutic efficacy and to unravel its underlying mechanistic pathways.


Assuntos
Ginsenosídeos , Talassemia beta , Recém-Nascido , Humanos , Talassemia beta/genética , Hemoglobina Fetal , gama-Globinas/genética , RNA Mensageiro/genética , RNA Mensageiro/metabolismo
7.
Mol Neurobiol ; 61(4): 2390-2410, 2024 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-37875709

RESUMO

The human fetal thyroid gland is not capable of producing thyroid hormones independently until 20 weeks of gestation, and if maternal thyroid hormone synthesis is inadequate in early pregnancy, fetal brain and nerve development may be affected by maternal hypothyroidism. Curcumin, which is isolated from turmeric (Curcuma longa), has been shown to be effective in repairing neurological disorders and is effective in relieving nerve damage when consumed over a long period of time. In this experiment, we investigated the effect of curcumin supplementation on synaptic development of rat hippocampal neurons. A cell model of oxidative damage and a young rat model of hypothyroidism were constructed, and model cells and rats were treated with triiodothyronine (T3), tetraiodothyronine (T4), and curcumin, respectively. Damage of nerve cells and animal brain tissues was examined, and the effect of curcumin in alleviating the blocked neurodevelopment was investigated. Further modulation of GSK-3ß/ß-catenin was performed to investigate the mechanism of action of curcumin. Ultimately, we found that T3-, T4-, and curcumin-treated model cells and young rats had increased numbers of synapses and good neurodevelopment. At the same time, we found that curcumin inhibited the production of GSK-3ß and Axin to activate ß-catenin. The inhibition of ß-catenin weakened the therapeutic effect of curcumin, and the differences between the indicators and the model group disappeared. Both cellular and animal experiments supported that curcumin effectively alleviated the oxidative cell damage caused by thyroxine deficiency and activated the synaptogenic ability of nerve synapses by inhibiting GSK-3ß and protecting ß-catenin activity.


Assuntos
Curcumina , Hipotireoidismo , Ratos , Humanos , Animais , Curcumina/farmacologia , Glicogênio Sintase Quinase 3 beta , beta Catenina/metabolismo , Neurônios/metabolismo , Sinapses/metabolismo , Hipocampo/metabolismo , Suplementos Nutricionais
8.
Nutr Bull ; 48(4): 535-545, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-37864477

RESUMO

Vitamin D deficiency is widespread in different populations and regions worldwide and has become a global health issue. The vitamin D status of the population in the Yunnan Province of Southwest China has not been evaluated to date. Therefore, in this study, we evaluated the vitamin D status according to the serum concentrations of 25-hydroxyvitamin D (25(OH)D) in individuals of Yunnan Province, a low-latitude, high-altitude and multiracial region in China. The data on 25(OH)D concentrations from October 2012 to December 2017 were retrospectively collected and assessed using the laboratory information system from 52 950 hospital-based participants (age, 1 day-96 years; females, 73.74%). The serum concentration of 25(OH)D was evaluated using a chemiluminescent immunoassay. The analysis was stratified by sex, age, sampling season, testing year, minority, residential district, latitude, altitude and meteorological factors. Vitamin D status was classified as follows: severe deficiency: <10 ng/mL; deficiency: <20 ng/mL; insufficiency: <30 ng/mL; and sufficiency: ≥30 ng/mL. The results showed that vitamin D deficiency is highly prevalent in Yunnan Province in a hospital-based cohort, with a deficiency and severe deficiency rate of 65.1% and a sufficiency rate of 5.30%. Significantly lower vitamin D levels and sufficiency rates were observed in females than in males (20.13 ± 7.22 ng/mL vs. 17.56 ± 6.66 ng/mL and 8.20% vs. 4.20%; p < 0.01, respectively); in spring and winter (16.93 ± 6.24 ng/mL; 2.97% and 16.38 ± 6.43 ng/mL; 3.06%, respectively) than in summer and autumn (20.23 ± 7.14 ng/mL; 8.02% and 19.10 ± 6.97 ng/mL; 6.61% [p < 0.01], respectively); and in older individuals (0-6 years: 28.29 ± 13.13 ng/mL vs. >60 years: 14.88 ± 8.39 ng/mL; p < 0.01). Relatively higher vitamin D levels were observed in individuals of Yi, Zhuang, Hani, Dai, Miao and Lisu minorities and lower levels in individuals of Hui and Zang minorities compared with those of the Han nationality (p < 0.01). The mean sunlight duration, mean air temperature, maximum ultraviolet value and latitude were significantly correlated with vitamin D levels (r = -0.53, 0.60, 0.31, -0.68, respectively; p < 0.05). These results suggest that vitamin D status is influenced by sex, age, minority, latitude and some meteorological factors in areas with high and low altitudes. Hence, new public health policies, such as advice on sunshine exposure, food fortification and nutrition education, as well as the implementation of vitamin D supplementation programmes must be considered to alleviate vitamin D deficiency in Yunnan province, Southwest China.


Assuntos
Colestanos , Deficiência de Vitamina D , Masculino , Feminino , Humanos , Idoso , Estudos Transversais , Estudos Retrospectivos , Altitude , China/epidemiologia , Vitamina D , Calcifediol , Deficiência de Vitamina D/epidemiologia , Vitaminas
9.
JAMA Netw Open ; 6(9): e2331162, 2023 09 05.
Artigo em Inglês | MEDLINE | ID: mdl-37656460

RESUMO

Importance: Newborn screening via biochemical tests is in use worldwide. The availability of genetic sequencing has allowed rapid screening for a substantial number of monogenic disorders. However, the outcomes of this strategy have not been evaluated in a general newborn population. Objective: To evaluate the outcomes of applying gene panel sequencing as a first-tier newborn screening test. Design, Setting, and Participants: This cohort study included newborns who were prospectively recruited from 8 screening centers in China between February 21 and December 31, 2021. Neonates with positive results were followed up before July 5, 2022. Exposures: All participants were concurrently screened using dried blood spots. The screen consisted of biochemical screening tests and a targeted gene panel sequencing test for 128 conditions. The biochemical and genomic tests could both detect 43 of the conditions, whereas the other 85 conditions were screened solely by the gene panel. Main Outcomes and Measures: The primary outcomes were the number of patients detected by gene panel sequencing but undetected by the biochemical test. Results: This study prospectively recruited 29 601 newborns (15 357 [51.2%] male). The mean (SD) gestational age was 39.0 (1.5) weeks, and the mean (SD) birth weight was 3273 (457) g. The gene panel sequencing screened 813 infants (2.7%; 95% CI, 2.6%-2.9%) as positive. By the date of follow-up, 402 infants (1.4%; 95% CI, 1.2%-1.5%) had been diagnosed, indicating the positive predictive value was 50.4% (95% CI, 50.0%-53.9%). The gene panel sequencing identified 59 patients undetected by biochemical tests, including 20 patients affected by biochemically and genetically screened disorders and 39 patients affected by solely genetically screened disorders, which translates into 1 out of every 500 newborns (95% CI, 1/385-1/625) benefiting from the implementation of gene panels as a first-tier screening test. Conclusions and Relevance: In this cohort study, the use of gene panel sequencing in a general newborn population as a first-tier screening test improved the detection capability of traditional screening, providing an evidence-based suggestion that it could be considered as a crucial method for first-tier screening.


Assuntos
Genômica , Triagem Neonatal , Recém-Nascido , Lactente , Humanos , Masculino , Feminino , Estudos de Coortes , Peso ao Nascer , China
10.
BMC Pregnancy Childbirth ; 23(1): 624, 2023 Aug 30.
Artigo em Inglês | MEDLINE | ID: mdl-37648962

RESUMO

BACKGROUND: Aneuploidy pregnancy is a severe major birth defect and causes about 50% spontaneous miscarriages with unknown etiology. To date, only a few epidemiological studies with small sample sizes have investigated the risk factors for aneuploidy pregnancy. TP53, MDM2, and miR-34b/c genes are implicated in tumorigenesis with aneuploidy, yet the function of their polymorphisms in aneuploidy pregnancy susceptibility needs to be clarified. OBJECTIVE: To elucidate the association of TP53 rs1042522 G > C, MDM2 rs2279744 309 T > G, and miR-34b/c rs4938723 T > C specific polymorphisms with aneuploidy pregnancy. METHODS: In the retrospective case-control study, 330 aneuploidies pregnancy women and 813 normal pregnancy controls were recruited between January 2018 and April 2022 at the First People's Hospital of Yunnan Province, Kunming, China. Three functional polymorphisms, the TP53 rs1042522 G > C (Arg72Pro), MDM2 rs2279744 309 T > G, and miR-34b/c rs4938723 T > C, were genotyped using the snapshot method. RESULTS: The frequency distribution of three genotypic variants was not different between case and control pregnant women and was similar to with Hardy-Weinberg Equilibrium (HWE). However, in the younger subgroup (less than 35 years old), a significant difference was detected in allele and recessive model (p = 0.01). In the advanced age subgroup (more than or equal to 35 years old), G of MDM2 rs2279744 T > G revealed a significantly higher frequency in cases than controls (p = 0.045), and miR-34b/c rs4938723 T > C revealed a significant difference under the dominant model (p = 0.03), but no significant differences were observed in other models and in both younger and older subgroup (p > 0.05, respectively). These results suggest that individual polymorphisms were not associated with aneuploidy pregnancy, combined with age, they may serve as a risk factor for aneuploidy pregnancy. CONCLUSION: Combination of TP53 rs1042522 G > C, MDM2 rs2279744 T > G, and miR-34b/c rs4938723 T > C polymorphisms with maternal age may be related to aneuploidy pregnancy susceptibility. These findings might elaborate on the genetic etiology of aneuploidy pregnancy.


Assuntos
Aneuploidia , MicroRNAs , Gravidez , Humanos , Feminino , Adulto , Estudos de Casos e Controles , China , Estudos Retrospectivos , MicroRNAs/genética , Proteína Supressora de Tumor p53/genética , Proteínas Proto-Oncogênicas c-mdm2/genética
11.
Mol Genet Genomic Med ; 11(12): e2273, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-37605493

RESUMO

BACKGROUND: HIST1H1E is a member of the H1 gene family. Excess de novo likely gene-disruptive variants involving the C-terminal tail of HIST1H1E have been reported in neurodevelopmental disorders. Although clinical phenotypes in some patients have been described in single studies, few studies have reviewed the genotype and phenotype relationships using a relatively large cohort of patients with HIST1H1E variants. METHODS: Whole-exome sequencing (WES) was performed on the proband. The variant was validated using Sanger sequencing in both proband and parents. Published HIST1H1E variants in neuropsychiatric disorders were reviewed. RESULTS: Herein, we reported a new de novo frameshift mutation in HIST1H1E (NM_005321.2, c.416_419dupAGAA, p.Ala141GlufsTer56) in an individual with Rahman syndrome. To explore the genotype-phenotype correlations for HIST1H1E variants in neurodevelopmental disorders, we comprehensively curated and summarized 23 variants and the clinical features from 52 patients. Our findings revealed that likely gene-disrupting variants in HIST1H1E contribute to a wide range of neurodevelopmental phenotypes. We observed the common phenotypes including craniofacial features, ID, hypotonia, and autism/behavior problem in patients with HIST1H1E variants. While the different genotypes corresponding to different phenotypes or the same phenotype were also observed. CONCLUSION: These data provide scientific evidence for the genetic diagnosis and precision clinical management.


Assuntos
Deficiência Intelectual , Humanos , Deficiência Intelectual/genética , Mutação , Histonas/genética , Genótipo , Estudos de Associação Genética
12.
J Perinat Med ; 51(8): 1082-1096, 2023 Oct 26.
Artigo em Inglês | MEDLINE | ID: mdl-37486214

RESUMO

OBJECTIVES: To evaluate the association between maternal polymorphisms of NANOS3 rs2016163, HELQ rs4693089, PRIM1 rs2277339, TLK1 rs10183486, ERCC6 rs2228526, EXO1 rs1635501, DMC1 rs5757133, and MSH5 rs2075789 and fetal chromosomal abnormality. METHODS: This retrospective case-control study included 571 women with fetal chromosome abnormalities (330 pregnant women diagnosed with fetal aneuploidy, 241 with fetal de novo structural chromosome pregnancy) and 811 healthy pregnant women between January 2018 and April 2022. All the above polymorphisms were tested using SNaPshot. RESULTS: All the eight polymorphisms were analyzed for genotypes, alleles, under dominant and recessive genetic models. Significant distribution differences of TLK1 rs10183486 in fetal chromosome structural abnormality were found between the case group and control subjects who were <35 years of age [Genotype: p=0.029; Dominant: OR (95 %CI)=0.46 (0.25-0.82), p=0.01 and allele: OR (95 %CI)=0.47 (0.27-0.82), p=0.01 respectively], while no difference was found in the recessive model [OR (95 %CI)=2.49 (0.31-20.40), p=0.39]. In advanced age subgroups for fetal aneuploidy, significant differences were found in genotypes analysis of PRIM1 rs2277339 (p=0.008), allele analysis of TLK1 rs10183486 [OR (95 %CI)=0.62 (0.42-0.91), p=0.02]. For the fetal chromosome structural abnormality population, HELQ rs4693089 revealed a significant distribution difference (p=0.01) but not in the allele, dominant and recessive genetic models analysis (p>0.05 individually). CONCLUSIONS: For older women, maternal PRIM1 rs2277339 and TLK1 rs10183486 polymorphisms may be associated with fetal aneuploidy, while HELQ rs4693089 may be associated with fetal chromosome structural abnormality. Also, carriers of T allele of TLK1 rs10183486 have a lower risk of fetal chromosome structural abnormality in younger women.

13.
Hemoglobin ; 47(2): 49-51, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-37247201

RESUMO

Deletional α-thalassemia is characterized by reduced hemoglobin A2 and involves the deletion of a few nucleotides, which is a rare hereditary disease. However, the detection of rare mutations using commonly used genetic tests is highly challenging. In the present study, next-generation sequencing (NGS) was used to identify a novel 7-bp deletion α-thalassemia in one individual from a Chinese family. Hematological parameters of the family members were determined using an automated cell counter, and hemoglobin electrophoresis was performed using a capillary electrophoresis system. Subsequently, NGS was performed on the genomic DNA of the patient and her family members. The 7-bp deletion (named Hb Honghe [HBA1: c.401_407delGCACCGT]) of α-thalassemia in the α-globin gene was confirmed using Sanger sequencing. The patient's father was also a heterozygous carrier of HBA1: c.401_407delGCACCGT deletion, but not her mother or sister. The application of the combined molecular approach is essential for the accurate diagnosis of rare thalassemia. This study reports a novel case of α- thalassemia. The characterization of the mutation might provide new insights into genetic counseling and accurate diagnosis of thalassemia.


Assuntos
Talassemia alfa , Humanos , Talassemia alfa/diagnóstico , Talassemia alfa/genética , alfa-Globinas/genética , Hemoglobinas Glicadas , População do Leste Asiático , Mutação , Família Multigênica , Deleção de Genes
14.
Front Genet ; 14: 1105184, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37007941

RESUMO

Background: The genetic etiology of fetal chromosome abnormalities remains unknown, which brings about an enormous burden for patients, families, and society. The spindle assembly checkpoint (SAC) controls the normal procedure of chromosome disjunction and may take part in the process. Objective: The aim of this study was to explore the association between polymorphisms of MAD1L1 rs1801368 and MAD2L1 rs1283639804, involved in SAC and fetal chromosome abnormalities. Methods: The case-control study collected 563 cases and 813 health controls to test the genotypes of MAD1L1 rs1801368 and MAD2L1 rs1283639804 polymorphisms by polymerase chain reaction-restrictive fragment length polymorphism methods (PCR-RFLP). Results: MAD1L1 rs1801368 polymorphism was associated with fetal chromosome abnormalities alone or combined to lower homocysteine (HCY) levels (alone: dominant: OR: 1.75, 95%CI: 1.19-2.57, and p = 0.005; CT vs. CC: OR = 0.73, 95%CI: 0.57-0.94, and p = 0.016; lower HCY: C vs. T: OR = 0.74, 95%CI: 0.57-0.95, and p = 0.02; dominant: OR = 1.75, 95%CI: 0.79-1.92, and p = 0.005). No significant differences were found in other genetic models or subgroups (p > 0.05, respectively). MAD2L1 rs1283639804 polymorphism revealed a sole genotype in the studied population. HCY is significantly associated with fetal chromosome abnormalities in younger groups (OR: 1.78, 95%CI: 1.28-2.47, and p = 0.001). Conclusion: The results implied that the polymorphism of MAD1L1 rs1801368 may become the susceptibility factor to fetal chromosome abnormalities alone or combined to lower HCY levels but not to MAD2L1 rs1283639804 polymorphism. In addition, HCY significantly affects fetal chromosomal abnormalities in younger women.

15.
BMC Pregnancy Childbirth ; 23(1): 236, 2023 Apr 10.
Artigo em Inglês | MEDLINE | ID: mdl-37038108

RESUMO

OBJECTIVE: To investigate the ultrasonographic classification of fetal umbilical-portal-systemic venous shunts (UPSVS) and the correlations with fetal chromosomal abnormalities. METHODS: We retrospectively analyzed the ultrasound characteristics and the corresponding chromosomal abnormalities of 26 cases of fetal UPSVS prenatally diagnosed. RESULTS: A total of 26 fetuses diagnosed as UPSVS were included, including four cases of type I UPSVS, ten of type II, three of type IIIA, and nine of type IIIB. Four cases of type I were all complicated by fetal heart enlargement and heart insufficiency, of which one case had multiple malformations, and all four cases terminated pregnancies. Six of ten cases of type II terminated pregnancies, including four of Down's syndrome, one of twin reversed arterial perfusion sequence, one of fetal edema but with normal copy number variation (CNV) by chorionic villus sampling. The other four of ten cases were isolated type II with normal chromosomes, which were delivered at full term and were normal in growth and development when followed up 34 months after birth. Three cases of type IIIA all terminated pregnancies, of which one had multiple malformations, one had right multicystic dysplastic kidney, and one had fetal heart enlargement and heart failure. Among nine of type IIIB, seven with chromosomal abnormalities and/ or complicated malformations terminated pregnancies, and two with isolated type IIIB and normal chromosomes were delivered at full term, and were normal in growth and development (one was followed up to 33 months after birth and the other 20 months after birth). CONCLUSION: Fetal UPSVS can be clearly diagnosed and typed by prenatal ultrasonography. Fetal prognosis is determined by the types of UPSVS and complicated malformations and/ or chromosomal abnormalities. The probability of fetal chromosomal abnormalities in UPSVS fetuses is related to the ultrasonographic classification.


Assuntos
Anormalidades Múltiplas , Aberrações Cromossômicas , Variações do Número de Cópias de DNA , Veias Umbilicais , Feminino , Humanos , Gravidez , Cardiomegalia , Coração Fetal , Estudos Retrospectivos , Ultrassonografia Pré-Natal , Veias Umbilicais/diagnóstico por imagem , Veias Umbilicais/anormalidades
16.
Eur J Hum Genet ; 31(5): 504-511, 2023 05.
Artigo em Inglês | MEDLINE | ID: mdl-36198806

RESUMO

Pathogenic large inversions are rarely reported on DMD gene due to the lack of effective detection methods. Here we report two DMD pedigrees and proposed a reliable pipeline to define large inversions in DMD patients. In the first pedigree, conventional approaches including multiplex ligation-dependent probe amplification, and whole-exome sequencing by next generation sequencing were failed to detect any pathologic variant. Then an advanced analysis pipeline which consists of RNA-seq, cDNA array capture sequencing, optical mapping, long-read sequencing was built. RNA-seq and cDNA capture sequencing showed a complete absence of transcripts of exons 3-55. Optical mapping identified a 55 Mb pericentric inversion between Xp21 and Xq21. Subsequently, long-read sequencing and Sanger sequencing determined the inversion breakpoints at 32,915,769 and 87,989,324 of the X chromosomes. In the second pedigree, long-read sequencing was directly conducted and Sanger sequencing was performed to verify the mutation. Long-read sequencing and Sanger sequencing found breakpoints at 32,581,576 and 127,797,236 on DMD gene directly. In conclusion, large inversion might be a rare but important mutation type in DMD gene. An effective pipeline was built in detecting large inversion mutations based on long-read sequencing platforms.


Assuntos
Sequenciamento de Nucleotídeos em Larga Escala , Distrofia Muscular de Duchenne , Humanos , Linhagem , Mutação , Éxons , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Sequenciamento do Exoma , Distrofia Muscular de Duchenne/diagnóstico , Distrofia Muscular de Duchenne/genética , Distrofina/genética
17.
Zhejiang Da Xue Xue Bao Yi Xue Ban ; 51(3): 306-313, 2022 Jun 25.
Artigo em Inglês | MEDLINE | ID: mdl-36207832

RESUMO

OBJECTIVE: To investigate molecular and clinical characteristics of children with permanent congenital hypothyroidism (CH) in Yunnan, China. METHODS: The clinical data of 40 children with CH diagnosed and treated in the First People's Hospital of Yunnan Province during January 2016 and January 2019 were retrospectively analyzed. All children were followed up to 3 years old, and Gesell intelligent score was evaluated at age of 1, 2 and 3 years, respectively. Developmental status and prognosis were evaluated. Next-generation sequencing (NGS) was used to screen all exons and exon-intron boundary sequences of the 27 known CH associated genes, and the relationship between genotypes and clinical phenotypes was analyzed. RESULTS: Among the 40 children, the thyroid related pathogenic gene mutations were detected in 23 cases with a rate of 57.5%, and a total of 32 mutations of 8 genes were detected. Mutations in DUOX2, TPO and TSHR genes were the most common ones with mutation frequencies of 65.9%(29/44), 11.4%(5/44) and 9.1%(4/44), respectively. DUOX2 gene mutations were detected in 17 children with CH, and a total of 17 mutation types were detected. p.K530* was the most common mutation in DUOX2 gene, accounting for 20.7%(6/29). There was no significant difference in physical development and intelligence assessment between children with DUOX2 heterozygous mutation and compound heterozygous mutations. None of patients could terminate medication at 3 years of the follow-up and all of them were provisionally assessed as permanent CH. The physical and mental development assessment of children with other gene mutations were also in the normal range. CONCLUSION: The detection rate of DUOX2, TPO and TSHR pathogenic mutations are high among children with permanent CH in Yunnan area, and no correlation is observed between gene mutation types and prognosis in children with CH.


Assuntos
Hipotireoidismo Congênito , China , Hipotireoidismo Congênito/diagnóstico , Hipotireoidismo Congênito/genética , Oxidases Duais/genética , Humanos , Mutação , Estudos Retrospectivos
18.
Diagnostics (Basel) ; 12(5)2022 Apr 27.
Artigo em Inglês | MEDLINE | ID: mdl-35626254

RESUMO

In China, low-pass whole-genome sequencing (low-pass WGS) is emerging as an alternative diagnostic test to detect copy number variants (CNVs). This survey aimed to study the laboratory practice, service quality, and case volumes of low-pass WGS-based CNV analysis among national accredited Chinese tertiary hospitals that have routinely applied low-pass WGS for more than a year and that have been certified in next-generation sequencing (NGS) clinical applications for more than three years. The questionnaire focused on (1) the composition of patients' referral indications for testing and annual case volumes; (2) the capacity of conducting laboratory assays, bioinformatic analyses, and reporting; (3) the sequencing platforms and parameters utilized; and (4) CNV nomenclature in reports. Participants were required to respond based on their routine laboratory practices and data audited in a 12-month period from February 2019 to January 2020. Overall, 24 participants representing 24 tertiary referral hospitals from 21 provincial administrative regions in China returned the questionnaires. Excluding three hospitals routinely applying low-pass WGS for non-invasive prenatal testing (NIPT) only, the analysis only focused on the data submitted by the rest 21 hospitals. These hospitals applied low-pass WGS-based CNV analysis for four primary applications: high-risk pregnancies, spontaneous abortions, couples with adverse pregnancy history, and children with congenital birth defects. The overall estimated annual sample volume was over 36,000 cases. The survey results showed that the most commonly reported detection limit for CNV size (resolution) was 100 kb; however, the sequencing methods utilized by the participants were variable (single-end: 61.90%, 13/21; paired-end: 28.57%, 6/21; both: 9.52%, 2/21). The diversity was also reflected in the sequencing parameters: the mean read count was 13.75 million reads/case (95% CI, 9.91-17.60) and the read-length median was 65 bp (95% CI, 75.17-104.83). To assess further the compliance of the CNV reporting nomenclature according to the 2016 edition of International System for Human Cytogenomics Nomenclature (ISCN 2016), a scoring metric was applied and yielded responses from 19 hospitals; the mean compliance score was 7.79 out of 10 points (95% CI, 6.78-8.80). Our results indicated that the low-pass WGS-based CNV analysis service is in great demand in China. From a quality control perspective, challenges remain regarding the establishment of standard criteria for low-pass WGS-based CNV analysis and data reporting formats. In summary, the low-pass WGS-based method is becoming a common diagnostic approach, transforming the possibilities for genetic diagnoses for patients in China.

19.
BMC Pregnancy Childbirth ; 22(1): 320, 2022 Apr 14.
Artigo em Inglês | MEDLINE | ID: mdl-35421926

RESUMO

BACKGROUND: Most embryos that spontaneously abort during early pregnancy are found to have chromosomal abnormalities. The purpose of this study is to explore the factors involved in chromosome aberrations during embryogenesis. METHODS: A case-case study was performed to compare the risk factors for spontaneous abortion with and without embryo chromosome aberration. A total of 160 cases of spontaneous abortion were enrolled from a tertiary general hospital in Kunming. KaryoLite BACs-on-Beads (KL-BoBs) and fluorescence in situ hybridization (FISH) were employed to determine chromosomal constitution of abortion chorion villus samples. Maternal serum levels of homocysteine (Hcy) were detected by high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Information about clinical background and environmental exposure was collected through a self-designed questionnaire. To identify the inherited chromosomal abnormalities, couples with chromosomal abnormalities in abortus were recalled for karyotyping. RESULTS: The overall rate of chromosomal abnormalities was 62.5% (100/160, KL-BoBs combined with FISH) including 51.9% (83/160) aneuploidies, 6.3% (10/160) polyploidies, and 4.4% (7/160) structural abnormalities. Only one case of structural abnormality was found to be inherited from maternal balanced translocation. Compared to abortus with normal karyotype, abortus with abnormal karyotype showed a positive association with parental age and elevated maternal serum homocysteine (Hcy) level, but negative association with previous miscarriage and perceived noise. CONCLUSIONS: Embryonic chromosomal aberrations accounted for the majority of spontaneous abortion cases. A combination of internal and external factors may induce spontaneous abortion through fetal chromosomal aberrations or other pathogenic mechanisms.


Assuntos
Aborto Espontâneo , Aborto Espontâneo/genética , Aberrações Cromossômicas , Feminino , Homocisteína , Humanos , Hibridização in Situ Fluorescente , Cariótipo , Cariotipagem , Gravidez , Espectrometria de Massas em Tandem
20.
Mol Genet Genomic Med ; 9(12): e1835, 2021 12.
Artigo em Inglês | MEDLINE | ID: mdl-34708592

RESUMO

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.


Assuntos
Mutação , alfa-Globinas/genética , Talassemia alfa/diagnóstico , Talassemia alfa/genética , Globinas beta/genética , Talassemia beta/diagnóstico , Talassemia beta/genética , Adulto , Alelos , Substituição de Aminoácidos , China , Biologia Computacional/métodos , Análise Mutacional de DNA , Índices de Eritrócitos , Família , Feminino , Estudos de Associação Genética , Predisposição Genética para Doença , Genótipo , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Fenótipo , Análise de Sequência de DNA , Talassemia alfa/sangue , Talassemia beta/sangue
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA