Global marine microbial diversity and its potential in bioprospecting.

The past two decades has witnessed a remarkable increase in the number of microbial genomes retrieved from marine systems1,2. However, it has remained challenging to translate this marine genomic diversity into biotechnological and biomedical applications3,4. Here we recovered 43,191 bacterial and archaeal genomes from publicly available marine metagenomes, encompassing a wide range of diversity with 138 distinct phyla, redefining the upper limit of marine bacterial genome size and revealing complex trade-offs between the occurrence of CRISPR-Cas systems and antibiotic resistance genes. In silico bioprospecting of these marine genomes led to the discovery of a novel CRISPR-Cas9 system, ten antimicrobial peptides, and three enzymes that degrade polyethylene terephthalate. In vitro experiments confirmed their effectiveness and efficacy. This work provides evidence that global-scale sequencing initiatives advance our understanding of how microbial diversity has evolved in the oceans and is maintained, and demonstrates how such initiatives can be sustainably exploited to advance biotechnology and biomedicine.

Effects of Yellow Sea Warm Current on zooplankton community composition and functional groups in winter.

The Yellow Sea Warm Current (YSWC) constitutes a significant hydrological feature in the Yellow Sea, particularly prominent during winter, facilitating the transport of warm, saline waters and warm-water species from the open sea to the Bohai and Yellow Seas. The YSWC induces alterations in the community structure and function of zooplankton. However, the effects of the YSWC on the functional trait compositions and functional groups of zooplankton remain unclear. This study aimed to elucidate the influence of the YSWC on the community structure, functional trait composition, and functional groups of zooplankton during winter of 2016. The YSWC significantly impacted the zooplankton assemblage in the central Yellow Sea (CYSA), resulting in notable distinctions from the Shandong coastal assemblage (SCA) and Jiangsu coastal assemblage (JCA). Compared to the SCA and JCA (comprising 45 and 34 taxa, with abundances of 119.4 ± 114.6 ind·m-3 and 82.8 ± 62.1 ind·m-3, respectively), the CYSA exhibited higher species richness and abundance (with 51 taxa and 144.4 ± 103.4 ind·m-3, respectively). This study documented a total of 11 warm-water species, showing a decreasing trend in both species richness and abundance from south to north. The CYSA was characterized by the predominance of medium‒sized, current‒feeding, omnivorous‒herbivorous broadcast spawners, whereas the SCA and the JCA were predominantly dominated by giant‒sized, ambush‒feeding carnivores. The Qingdao-Shidao anticyclonic eddy in the southern of Shandong Province led to a significant increase in the abundance of zooplankton, potentially impacting Yellow Sea fishery resource. This research contributed to a deeper understanding of how YSWC influence the zooplankton community and offered fresh insights into the effects of YSWC on zooplankton function traits and functional groups.

Atmospheric deposition and river runoff stimulate the utilization of dissolved organic phosphorus in coastal seas.

In coastal seas, the role of atmospheric deposition and river runoff in dissolved organic phosphorus (DOP) utilization is not well understood. Here, we address this knowledge gap by combining microcosm experiments with a global approach considering the relationship between the activity of alkaline phosphatases and changes in phytoplankton biomass in relation to the concentration of dissolved inorganic phosphorus (DIP). Our results suggest that the addition of aerosols and riverine water stimulate the biological utilization of DOP in coastal seas primarily by depleting DIP due to increasing nitrogen concentrations, which enhances phytoplankton growth. This "Anthropogenic Nitrogen Pump" was therefore identified to make DOP an important source of phosphorus for phytoplankton in coastal seas but only when the ratio of chlorophyll a to DIP [Log10 (Chl a / DIP)] is larger than 1.20. Our study therefore suggests that anthropogenic nitrogen input might contribute to the phosphorus cycle in coastal seas.

Trait-based approach revealed the seasonal variation of mesozooplankton functional groups in the South Yellow Sea.

Functional traits determine the fitness of organisms and mirror their ecological functions. Although trait-based approaches provide ecological insights, it is underexploited for marine zooplankton, particularly with respect to seasonal variation. Here, based on four major functional traits, including body length, feeding type, trophic group, and reproduction mode, we quantified the seasonal variations of mesozooplankton functional groups in the South Yellow Sea (SYS) in the spring, summer, and autumn of 2018. Strong seasonal dynamics were identified for all traits but patterns varied among traits. Small zooplankton (47.7-88.6%), omnivores-herbivores (81.3-97.6%), and free spawners (54.8-92.5%) dominated in three seasons, while ambush feeders and current feeders dominated in spring (45.7%), and autumn (73.4%), respectively. Cluster analysis of the functional traits showed that the mesozooplankton in the SYS can be classified into eight functional groups. The biogeographic and seasonal variations of functional groups can be partially explained by environmental drivers. Group 1, represented by omnivores-herbivores, was the most dominant functional group, the abundance of which peaked in spring and was positively correlated with chlorophyll a concentration, indicating its close association with phytoplankton dynamics. The contribution of giant, active ambush carnivores, passive ambush carnivore jellyfish, current omnivores-detritivores, and parthenogenetic cladocerans increased with sea surface temperature. The proportion of giant, active ambush carnivores and active ambush omnivore-carnivore copepods decreased with salinity in autumn. This study presents a new perspective for understanding the dynamics of zooplankton and paves the way for further research on the functional diversity of zooplankton in the SYS. Supplementary Information: The online version contains supplementary material available at 10.1007/s42995-022-00156-9.

Latitudinal transition of epipelagic mesozooplankton in the northwestern Pacific in winter.

The northwestern Pacific (NWP) is a hotspot of marine biodiversity study, and zooplankton is a crucial secondary producer in the marine ecosystem. It is of utmost importance to do extensive study on the distribution of zooplankton community in the NWP. The distribution of epipelagic zooplankton community in the 143-146°E section between the equator and 36°N in winter was examined in this study. The findings indicated that the Kuroshio extension, the North Pacific Subtropical Gyre, the North Equatorial Current and the North Equatorial Countercurrent were the four main ocean currents in the NWP that regulated the latitudinal transition of epipelagic mesozooplankton and split the sample section into four station groups. The key factors influencing zooplankton's geographic distribution were temperature, primary productivity, and current movement. In general, as latitude increased, zooplankton abundance and biomass first decreased and subsequently flourished in the NWP. Diversity indexes and indicator species also revealed the difference across the communities in four station groups. The body length of zooplankton declined gradually from north to south under the combined influence of temperature and primary production, with the minimum in the oligotrophic subtropical zone and a sub-peak in the high primary production area near the equator. Additionally, the abundance of zooplankton was higher in the winter than in the summer due to seasonal fluctuations in the properties of the ocean currents. This study elucidated the control effects of ocean currents on the latitudinal distribution of zooplankton, supplemented records of the geographic distribution and body length characteristics of zooplankton communities in the NWP, and provided the basis for further research on the ecological role of zooplankton communities and the global changes of marine ecosystems.

Eukaryotic plankton community assembly and influencing factors between continental shelf and slope sites in the northern South China Sea.

Eukaryotic plankton are pivotal members of marine ecosystems playing crucial roles in marine food webs and biogeochemical cycles. However, understanding the patterns and drivers of their community assembly remains a grand challenge. A study was conducted in the northern South China Sea (SCS) to address this issue. Here, 49 samples were collected and size-fractionated from discrete depths at continental shelf and continental slope in the northern SCS over a diel cycle. From high throughput sequencing of the 18S rDNA gene V4 region, 2463 operational taxonomic units (OTUs) were retrieved. Alveolata and Opisthokonta overwhelmingly dominated the assemblages in the abundance (44.76%, 31.08%) and species richness (59%, 12%). Biodiversity was higher in the slope than the shelf and increased with depth. Temperature and salinity appeared to be the most important deterministic drivers of taxon composition. Community structure was influenced by multiple factors in the importance order of: environmental factors (temperature + salinity) > spatial factor > water depth > sampling time. Furthermore, the neutral model explained more variations in the smaller-sized (0.22-3 µm) community (24%) than larger-sized (3-200 µm) community (16%) but generally explained less variations than did deterministic processes. Additionally, our data indicated that the larger plankton might be more environmentally filtered and less plastic whereas the smaller plankton had stronger dispersal ability. This study sheds light on the differential contributions of the deterministic process and stochastic process and complexities of assembly mechanisms in shaping the community assembly of micro-nano and pico-eukaryotic biospheres in a subtropical ocean.

Reduced Fitness and Elevated Oxidative Stress in the Marine Copepod Tigriopus japonicus Exposed to the Toxic Dinoflagellate Karenia mikimotoi.

Blooms of the toxic dinoflagellate Karenia mikimotoi cause devastation to marine life, including declines of fitness and population recruitment. However, little is known about the effects of them on benthic copepods. Here, we assessed the acute and chronic effects of K. mikimotoi on the marine benthic copepod Tigriopus japonicus. Results showed that adult females maintained high survival (>85%) throughout 14-d incubation, but time-dependent reduction of survival was detected in the highest K. mikimotoi concentration, and nauplii and copepodites were more vulnerable compared to adults. Ingestion of K. mikimotoi depressed the grazing of copepods but significantly induced the generation of reactive oxygen species (ROS), total antioxidant capacity, activities of antioxidant enzymes (superoxide dismutase, catalase, and glutathione peroxidase), and acetylcholinesterase. Under sublethal concentrations for two generations, K. mikimotoi reduced the fitness of copepods by prolonging development time and decreasing successful development rate, egg production, and the number of clutches. Our findings suggest that the bloom of K. mikimotoi may threaten copepod population recruitment, and its adverse effects are associated with oxidative stress.

Diversity, prevalence, and expression of cyanase genes (cynS) in planktonic marine microorganisms.

Cyanate is utilized by many microbes as an organic nitrogen source. The key enzyme for cyanate metabolism is cyanase, converting cyanate to ammonium and carbon dioxide. Although the cyanase gene cynS has been identified in many species, the diversity, prevalence, and expression of cynS in marine microbial communities remains poorly understood. Here, based on the full-length cDNA sequence of a dinoflagellate cynS and 260 homologs across the tree of life, we extend the conserved nature of cyanases by the identification of additional ultra-conserved residues as part of the modeled holoenzyme structure. Our phylogenetic analysis showed that horizontal gene transfer of cynS appears to be more prominent than previously reported for bacteria, archaea, chlorophytes, and metazoans. Quantitative analyses of marine planktonic metagenomes revealed that cynS is as prevalent as ureC (urease subunit alpha), suggesting that cyanate plays an important role in nitrogen metabolism of marine microbes. Highly abundant cynS transcripts from phytoplankton and nitrite-oxidizing bacteria identified in global ocean metatranscriptomes indicate that cyanases potentially occupy a key position in the marine nitrogen cycle by facilitating photosynthetic assimilation of organic N and its remineralisation to NO3 by the activity of nitrifying bacteria.

Effects of Prorocentrum donghaiense bloom on zooplankton functional groups in the coastal waters of the East China Sea.

Blooms of the non-toxic dinoflagellate Prorocentrum donghaiense are common in the East China Sea; however, the in situ impacts of these blooms on zooplankton community functions have not yet been conducted in this area. Using functional trait-based methods, we found that P. donghaiense bloom significantly changed the zooplankton community structure and functions in the coastal water of the East China Sea. Zooplankton species richness and biodiversity increased after the bloom. Based on body length, feeding type, trophic group and reproductive mode, we categorized zooplankton into four functional groups and characterized their dynamics. Before and after the bloom, the zooplankton community was dominated by herbivorous- and free-spawner- lineages represented by copepods and tunicates, while during the bloom, the zooplankton community was dominated by carnivorous- and egg-brooding- lineages represented by small jellyfish, chaetognaths and copepods.

Spatial distribution and source of biotoxins in phytoplankton from the South China Sea, China.

Marine phycotoxins severely threaten ecosystem health and mariculture. This study investigates the spatial distribution and source of diverse phycotoxins in the South China Sea (SCS), during four 2019/2020 cruises. Saxitoxin (STX) and okadaic acid (OA) -groups, azaspiracids, cyclic imines, pectenotoxins (PTX), yessotoxins, and domoic acid (DA) toxins were analyzed in microalgal samples. PTX2 occurred with the highest (93.5%) detection rate (DR) during all cruises, especially in the Pearl River Estuary (PRE) in June 2019. Homo-yessotoxin (hYTX) and DA were found during three cruises in August 2020, and high DR of hYTX (67.7%, 29.3%) and DA (29.0%, 29.3%) in the PRE and Guangdong coast, respectively, in June 2019 and 2020, peaking at concentrations of 777 pg hYTX L-1 and 38514 pg DA L-1. The phycotoxin distribution demonstrated that DA-producing microalgae gathered close to the PRE and Guangdong coast, while hYTX-producing microalgae distributed relatively far offshore. Microalgae producing PTX2- and STX-group toxins were more widely living in the SCS. High-throughput sequencing results suggested that Alexandrium pacificum and Gonyaulax spinifera were responsible for STX-group toxins and hYTX, respectively, while Pseudo-nitzschia cuspidata was the main source of DA. Widely distributed PTX2, hYTX, and DA were reported for the first time in the SCS.

Pyropia yezoensis genome reveals diverse mechanisms of carbon acquisition in the intertidal environment.

Changes in atmospheric CO2 concentration have played a central role in algal and plant adaptation and evolution. The commercially important red algal genus, Pyropia (Bangiales) appears to have responded to inorganic carbon (Ci) availability by evolving alternating heteromorphic generations that occupy distinct habitats. The leafy gametophyte inhabits the intertidal zone that undergoes frequent emersion, whereas the sporophyte conchocelis bores into mollusk shells. Here, we analyze a high-quality genome assembly of Pyropia yezoensis to elucidate the interplay between Ci availability and life cycle evolution. We find horizontal gene transfers from bacteria and expansion of gene families (e.g. carbonic anhydrase, anti-oxidative related genes), many of which show gametophyte-specific expression or significant up-regulation in gametophyte in response to dehydration. In conchocelis, the release of HCO3- from shell promoted by carbonic anhydrase provides a source of Ci. This hypothesis is supported by the incorporation of 13C isotope by conchocelis when co-cultured with 13C-labeled CaCO3.

Insights into the red algae and eukaryotic evolution from the genome of Porphyra umbilicalis (Bangiophyceae, Rhodophyta).

Porphyra umbilicalis (laver) belongs to an ancient group of red algae (Bangiophyceae), is harvested for human food, and thrives in the harsh conditions of the upper intertidal zone. Here we present the 87.7-Mbp haploid Porphyra genome (65.8% G + C content, 13,125 gene loci) and elucidate traits that inform our understanding of the biology of red algae as one of the few multicellular eukaryotic lineages. Novel features of the Porphyra genome shared by other red algae relate to the cytoskeleton, calcium signaling, the cell cycle, and stress-tolerance mechanisms including photoprotection. Cytoskeletal motor proteins in Porphyra are restricted to a small set of kinesins that appear to be the only universal cytoskeletal motors within the red algae. Dynein motors are absent, and most red algae, including Porphyra, lack myosin. This surprisingly minimal cytoskeleton offers a potential explanation for why red algal cells and multicellular structures are more limited in size than in most multicellular lineages. Additional discoveries further relating to the stress tolerance of bangiophytes include ancestral enzymes for sulfation of the hydrophilic galactan-rich cell wall, evidence for mannan synthesis that originated before the divergence of green and red algae, and a high capacity for nutrient uptake. Our analyses provide a comprehensive understanding of the red algae, which are both commercially important and have played a major role in the evolution of other algal groups through secondary endosymbioses.

Spliced leader-based analyses reveal the effects of polycyclic aromatic hydrocarbons on gene expression in the copepod Pseudodiaptomus poplesia.

Polycyclic aromatic hydrocarbons (PAHs) are a group of toxic and carcinogenic pollutants that can adversely affect the development, growth and reproduction of marine organisms including copepods. However, knowledge on the molecular mechanisms regulating the response to PAH exposure in marine planktonic copepods is limited. In this study, we investigated the survival and gene expression of the calanoid copepod Pseudodiaptomus poplesia upon exposure to two PAHs, 1, 2-dimethylnaphthalene (1, 2-NAPH) and pyrene. Acute toxicity responses resulted in 96-h LC50 of 788.98µgL-1 and 54.68µgL-1 for 1, 2-NAPH and pyrene, respectively. Using the recently discovered copepod spliced leader as a primer, we constructed full-length cDNA libraries from copepods exposed to sublethal concentrations and revealed 289 unique genes of diverse functions, including stress response genes and novel genes previously undocumented for this species. Eighty-three gene families were specifically expressed in PAH exposure libraries. We further analyzed the expression of seven target genes by reverse transcription-quantitative PCR in a time-course test with three sublethal concentrations. These target genes have primary roles in detoxification, oxidative defense, and signal transduction, and include different forms of glutathione S-transferase (GST), glutathione peroxidases (GPX), peroxiredoxin (PRDX), methylmalonate-semialdehyde dehydrogenase (MSDH) and ras-related C3 botulinum toxin substrate (RAC1). Expression stability of seven candidate reference genes were evaluated and the two most stable ones (RPL15 and RPS20 for 1, 2-NAPH exposure, RPL15 and EF1D for pyrene exposure) were used to normalize the expression levels of the target genes. Significant upregulation was detected in GST-T, GST-DE, GPX4, PRDX6 and RAC1 upon 1, 2-NAPH exposure, and GST-DE and MSDH upon pyrene exposure. These results indicated that the oxidative stress was induced and that signal transduction might be affected by PAH exposure in P. poplesia. However, gene upregulation was followed by a reduction in expression level towards 96h, indicating a threshold value of exposure time that leads to depressed gene expression. Prolonged exposure may cause dysfunction of detoxification and antioxidant machinery in P. poplesia. The transcriptional responses of GST-T, GPX2 and GPX4 upon pyrene exposure were minimal. Our results reveal the different sensitivity of P. poplesia to two PAHs at both the individual and transcriptional levels. As the first attempt, this study proved that copepod spliced leader is useful for obtaining full-length cDNA in P. poplesia exposed to PAHs and provided a valuable gene resource for this non-model species. This approach can be applied to other calanoid copepods exposed to various stressors, particularly under field conditions.

Spliced leader RNA trans-splicing discovered in copepods.

Copepods are one of the most abundant metazoans in the marine ecosystem, constituting a critical link in aquatic food webs and contributing significantly to the global carbon budget, yet molecular mechanisms of their gene expression are not well understood. Here we report the detection of spliced leader (SL) trans-splicing in calanoid copepods. We have examined nine species of wild-caught copepods from Jiaozhou Bay, China that represent the major families of the calanoids. All these species contained a common 46-nt SL (CopepodSL). We further determined the size of CopepodSL precursor RNA (slRNA; 108-158 nt) through genomic analysis and 3'-RACE technique, which was confirmed by RNA blot analysis. Structure modeling showed that the copepod slRNA folded into typical slRNA secondary structures. Using a CopepodSL-based primer set, we selectively enriched and sequenced copepod full-length cDNAs, which led to the characterization of copepod transcripts and the cataloging of the complete set of 79 eukaryotic cytoplasmic ribosomal proteins (cRPs) for a single copepod species. We uncovered the SL trans-splicing in copepod natural populations, and demonstrated that CopepodSL was a sensitive and specific tool for copepod transcriptomic studies at both the individual and population levels and that it would be useful for metatranscriptomic analysis of copepods.

The Symbiodinium kawagutii genome illuminates dinoflagellate gene expression and coral symbiosis.

Dinoflagellates are important components of marine ecosystems and essential coral symbionts, yet little is known about their genomes. We report here on the analysis of a high-quality assembly from the 1180-megabase genome of Symbiodinium kawagutii. We annotated protein-coding genes and identified Symbiodinium-specific gene families. No whole-genome duplication was observed, but instead we found active (retro)transposition and gene family expansion, especially in processes important for successful symbiosis with corals. We also documented genes potentially governing sexual reproduction and cyst formation, novel promoter elements, and a microRNA system potentially regulating gene expression in both symbiont and coral. We found biochemical complementarity between genomes of S. kawagutii and the anthozoan Acropora, indicative of host-symbiont coevolution, providing a resource for studying the molecular basis and evolution of coral symbiosis.

DNA barcoding species in Alexandrium tamarense complex using ITS and proposing designation of five species.

Alexandrium species can be very difficult to identify, with A. catenella, A. tamarense, and A. fundyense that compose "Alexandrium tamarense species complex" (Atama complex) as a distinct example. DNA barcoding is promising to offer a solution but remains to be established. In this study, we examined the utility of ITS in resolving the Atama species complex, by analyzing previously studied strains plus unstudied Chinese strains within the LSU- and SSU-rDNA based group/clade frameworks recently established. We further investigated the presence of intragenomic polymorphism and its implications in species delimitation. Similar to the previous SSU and LSU results, our ITS-based phylogenies divided the complex to five clusters, but with longer and evener branch lengths between the clusters. Based on the ITS region, the inter-cluster genetic distances (p=0.134-0.216) were consistently and substantially greater than intra-cluster genetic distances (p=0.000-0.066), with an average inter-cluster (species) distance (p=0.167) 7.6-fold of the average intraspecific difference (p=0.022), qualifying the approximately 510-520bp ITS as a DNA barcode for Atama complex. We detected varying levels of intragenomic polymorphism in ITS but found that this did not impact the taxon-resolving power of this gene. With this DNA barcode, the new East and South China Sea strains and one Antarctic strain were placed in Clade IIC/Group IV, even though there were 7-10 polymorphic sites in their ITS, in contrast to none in SSU. Furthermore, our results suggest that the five clusters are recognizable as distinct species according to the phylogenetic species concept. Based on the phylogenetic placements of the type-locality strains of the existing three morphospecies and the dominant localities of other strains, we propose that Group I/Clade I be designated as A. fundyense, Group III/Clade IIB as A. tamarense, Group IV/Clade IIC as A. catenella, Group II/Clade IIA as A. mediterranis, and Group V/Clade IID as A. australis.

Proof that dinoflagellate spliced leader (DinoSL) is a useful hook for fishing dinoflagellate transcripts from mixed microbial samples: Symbiodinium kawagutii as a case study.

The ability to analyze dinoflagellate lineage-specific transcriptomes in the natural environment would be powerful for gaining understanding on how these organisms thrive in diverse environments and how they form harmful algal blooms and produce biotoxins. This can be made possible by lineage-specific mRNA markers such as the dinoflagellate-specific trans-spliced leader (DinoSL). By constructing and sequencing a 5'-cap selective full-length cDNA library for a monoculture of the coral reef endosymbiotic dinoflagellate Symbiodinium kawagutii and a DinoSL-based cDNA library for a mixture of S. kawagutii and other phytoplankton, we found DinoSL in essentially all full-length cDNAs in the 5'-cap selective library. We also discovered that the DinoSL-based library contained functionally diverse transcripts all belonging to dinoflagellates with no evidence of biases toward certain groups of functional genes. The results verified that DinoSL is specific to dinoflagellate mRNAs and is ubiquitous in the dinoflagellate transcriptomes. Annotation of the unigene dataset generated from the two libraries combined indicated high functional diversity of the transcriptome and revealed some biochemical pathways previously undocumented in Symbiodinium such as an mRNA splicing machinery potentially serving both cis- and trans-splicing. The protocol will be useful for transcriptomic studies of Symbiodinium in hospite and other dinoflagellates in natural environments.

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Polyadenylation of 18S rRNA in algae(1).

Polyadenylation is best known for occurring to mRNA of eukaryotes transcribed by RNA polymerase II to stabilize mRNA molecules and promote their translation. rRNAs transcribed by RNA polymerase I or III are typically believed not to be polyadenylated. However, there is increasing evidence that polyadenylation occurs to nucleus-encoded rRNAs as part of the RNA degradation pathway. To examine whether the same polyadenylation-assisted degradation pathway occurs in algae, we surveyed representative species of algae including diatoms, chlorophytes, dinoflagellates and pelagophytes using oligo (dT)-primed reversed transcription PCR (RT-PCR). In all the algal species examined, truncated 18S rRNA or its precursor molecules with homo- or hetero-polymeric poly(A) tails were detected. Mining existing algal expressed sequence tag (EST) data revealed polyadenylated truncated 18S rRNA in four additional phyla of algae. rRNA polyadenylation occurred at various internal positions along the 18S rRNA and its precursor sequences. Moreover, putative homologs of noncanonical poly(A) polymerase (ncPAP) Trf4p, which is responsible for polyadenylating nuclear-encoded RNA and targeting it for degradation, were detected from the genomes and transcriptomes of five phyla of algae. Our results suggest that polyadenylation-assisted RNA degradation mechanism widely exists in algae, particularly for the nucleus-encoded rRNA and its precursors.

Analysis of Porphyra membrane transporters demonstrates gene transfer among photosynthetic eukaryotes and numerous sodium-coupled transport systems.

Membrane transporters play a central role in many cellular processes that rely on the movement of ions and organic molecules between the environment and the cell, and between cellular compartments. Transporters have been well characterized in plants and green algae, but little is known about transporters or their evolutionary histories in the red algae. Here we examined 482 expressed sequence tag contigs that encode putative membrane transporters in the economically important red seaweed Porphyra (Bangiophyceae, Rhodophyta). These contigs are part of a comprehensive transcriptome dataset from Porphyra umbilicalis and Porphyra purpurea. Using phylogenomics, we identified 30 trees that support the expected monophyly of red and green algae/plants (i.e. the Plantae hypothesis) and 19 expressed sequence tag contigs that show evidence of endosymbiotic/horizontal gene transfer involving stramenopiles. The majority (77%) of analyzed contigs encode transporters with unresolved phylogenies, demonstrating the difficulty in resolving the evolutionary history of genes. We observed molecular features of many sodium-coupled transport systems in marine algae, and the potential for coregulation of Porphyra transporter genes that are associated with fatty acid biosynthesis and intracellular lipid trafficking. Although both the tissue-specific and subcellular locations of the encoded proteins require further investigation, our study provides red algal gene candidates associated with transport functions and novel insights into the biology and evolution of these transporters.