In silico occupational exposure banding framework for data poor compounds in biotechnology.

Occupational exposure limits (OELs) and occupational exposure bands (OEBs) provide quantitative benchmarks for worker health protection. If empirical toxicology data are insufficient to derive an OEL, an OEB is often assigned using partial toxicology data along with other relevant hazard information. There is no consensus methodology to assign OEBs for chemicals lacking any empirical toxicology data. Thus, this study developed an in silico framework for OEB assignment of data poor compounds. It relies upon computational tools to evaluate standard toxicological end points and to assign reliability ratings, which are then used to assign Global Harmonization System (GHS) hazard categories. Subsequently, the hazard categories are entered into the National Institute for Occupational Safety and Health (NIOSH) occupational exposure banding tool to assign bands for individual end points as well as an overall OEB. As a proof-of-concept, five compounds with established OELs (i.e., "knowns") were evaluated. The knowns were assigned to overall OEBs C, D, or E, four of which were equal to or lower than the OEBs based on actual harmonized GHS categories as well as established OELs, indicating that the OEBs assigned using this framework are likely to be protective. Subsequently, five compounds with little to no experimental data and no established OELs from any U.S. agency or consensus OEL-setting organizations were evaluated (i.e., "unknowns"). The unknowns were assigned to overall OEBs D or E. It was concluded that the proposed framework can be used to assign protective OEBs to compounds with little to no toxicology testing data. As additional data become available, the compound may be de-risked, and a precautionary OEB (or an OEL) can be assigned. The proposed framework provides an example of a practical methodology to evaluate data poor compounds and shows that the output of this framework is expected to be protective of worker health.

Catheter Displacement and Penetration of a Vaginal Cuff Following Laparoscopic Adjustable Gastric Banding: A Case Report.

This case report describes a rare complication following laparoscopic adjustable gastric banding (LAGB) in a 47-year-old woman. The patient, who had a history of obesity and a previous hysterectomy, presented with dyspareunia. Upon examination, a catheter was visualized in the upper vaginal canal, which penetrated the right vaginal cuff and caused significant pain. Imaging revealed that a catheter from the LAGB device had penetrated the vaginal cuff. This unexpected migration of the catheter necessitated surgical intervention for removal. The case underscores the importance of monitoring for unusual symptoms in patients with a history of LAGB, as this procedure, while minimally invasive and generally safe, can have serious long-term complications. These complications may include gastric erosion, perforation, band migration, and, in this rare instance, vaginal cuff penetration. The report emphasizes the need for healthcare providers to maintain a high level of suspicion for such complications, particularly in patients presenting with atypical symptoms post LAGB. It also highlights the interdisciplinary approach required to manage these complex cases, involving both general surgery and radiology teams. To the best of our knowledge, this is one of the first cases with a history of LAGB, which was associated with the complication of penetration of the vaginal cuff.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Pulmonary Overcirculation Requiring Surgical and Pulmonary Flow Restrictor Device Intervention in Critical Coarctation of the Aorta-A Case Series.

The use of prostaglandin infusion to maintain patency of the ductus arteriosus in patients with critical coarctation of the aorta (CoA) to support systemic circulation is the standard of care. However, pulmonary overcirculation resulting from a patent ductus arteriosus in patients with critical CoA is not well described in the literature. We report two cases of critical CoA that required invasive measures to control pulmonary blood flow before surgical repair of the CoA. Both patients had signs of decreased oxygen delivery, hyperlactatemia, and systemic to pulmonary flow via the ductus arteriosus. One patient required surgical pulmonary artery banding and the second patient underwent pulmonary flow restrictor device placement for the control of pulmonary blood flow. A rapid improvement in oxygen delivery and normalization of lactate levels were observed after control of pulmonary overcirculation. Both patients underwent successful surgical repair of the coarctation A and were discharged home.

The Silent Band: Laparoscopic Adjustable Gastric Band Erosion as an Incidental Finding During Endoscopy.

Laparoscopic adjustable gastric banding (LAGB) is a bariatric procedure that was introduced in the early 1990s and offers a minimally invasive and reversible option for weight loss. Initially popular due to its simplicity and effectiveness, LAGB's long-term success has been limited by complications such as port-site infection, pouch dilatation, and gastric band erosion. Herein, we describe a rare case of gastric band erosion found incidentally during endoscopy a decade after placement. The eroded band was successfully removed using a combined endoscopic and laparoscopic approach.

Foregut Erosion Related to Biomedical Implants: A Scoping Review.

Introduction: Biomedical devices implanted transabdominally have gained popularity over the past 50 years in the treatment of gastroesophageal reflux disease, paraesophageal hiatal hernia, and morbid obesity. Device-related foregut erosions (FEs) represent a challenging event that demands special attention owing to the potential of severe postoperative complications and death. Purpose: The aim was to provide an overview of full-thickness foregut injury leading to erosion associated with four types of biomedical devices. Methods: The study was conducted using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses extension for Scoping Reviews (PRISMA-ScR). PubMed, EMBASE, and Web of Science databases were queried until December 31, 2023. Eligible studies included all articles reporting data, management, and outcomes on device-related FE. Results: Overall, 132 articless were included for a total of 1292 patients suffering from device-related FE. Four different devices were included: the Angelchik antireflux prosthesis (AAP) (n = 25), nonabsorbable mesh for crural repair (n = 60), adjustable gastric banding (n = 1156), and magnetic sphincter augmentation device (n = 51). The elapsed time from device implant to erosion ranged from 1 to 480 months. Most commonly reported symptoms were dysphagia and epigastric pain, while acute presentation was reported rarely and mainly for gastric banding. The technique for device removal evolved from more invasive open approaches toward minimally invasive and endoscopic techniques. Esophagectomy and gastrectomy were mostly reported for nonabsorbable mesh FE. Overall mortality was .17%. Conclusions: Device-related FE is rare but may occur many years after AAP, nonabsorbable mesh, adjustable gastric banding, and magnetic sphincter augmentation implant. FE-related mortality is infrequent, however, increased postoperative morbidity and the need for esophagogastric resection were observed for nonabsorbable mesh-reinforced cruroplasty.

A Comprehensive Insight into the Economic Profile of People Receiving Metabolic and Bariatric Surgery Use in France.

BACKGROUND: The use of metabolic and bariatric surgery (MBS) is not uniformly distributed within the population, even if it is governed by established guidelines. This disparity seems to be associated, among other factors, with the economic profile of people receiving this surgery. OBJECTIVES: We investigated the disparities in the use of MBS with respect to the socio-economic level in France based on socio-economic status (SES). MATERIALS AND METHODS: A descriptive observational study was conducted to compare the population of individuals with obesity who underwent MBS (MBS group) with individuals with obesity with no history of MBS (obese group). Data were extracted from the French National Hospital discharge database ("Programme De Médicalisation des Systèmes d'Information," PMSI). Socio-economic status (SES) was assessed through the French Deprivation Index (FDep). RESULTS: The use of MBS was significantly lower in patients having a higher SES compared to those having a lower one. There was no statistically significant difference in the use of MBS between individuals within the 4th and 5th SES quintiles compared to those in the 2nd and 3rd quintiles. No difference was found in the specific MBS procedures used depending on the SES. The obesity level was significantly lower in patients from the 1st and 3rd SES quintiles compared to the patients having a lower SES. CONCLUSION: Our study provides valuable insights into the complex interrelationships between the use of MBS, patients' SES, and obesity levels according to the FDep. These findings underscore the importance of developing targeted interventions to address disparities in the use of bariatric care.

Impact of Pulmonary Artery Banding in Patients with Congenital Heart Disease and Pulmonary Hypertension.

Background: To evaluate the effectiveness of the surgical approach in patients with congenital heart disease and pulmonary hypertension (PH). Methods: This was a retrospective clinical review of patients with congenital heart disease and PH who underwent pulmonary artery banding (PAB) at our institution between January 2013 and January 2023. Results: We identified 219 patients (53.4% males) with a median age of 7 (4.0-15.0) months and a median weight of 6.8 (5.2-9.0) kg at the time of PAB. The median hospital stay was 7.0 (5.0-10.0) days. The in-hospital mortality rate was 4.6%. The median follow-up was 33.0 (17.0-61.0) months. Survival rates were 96.9 ± 2.5% at 60 months and 92.1 ± 6.9% at 120 months post-PAB. 43.8% of patients had a de-banding procedure, and 147 (79.0%) patients received a second-stage procedure (34.7% univentricular, 65.3% biventricular). The mortality rate between stages was 4.3%. 21 (9.6%) patients reached a third-stage procedure. The overall mortality rate was 9.1%. Conclusions: PAB is an acceptable strategy for patients with congenital heart disease complicated with PH. The results and outcomes of subsequent univentricular or biventricular procedures are generally good.

Prenatal diagnosis of dicentric chromosome X mosaicism: a case report and review.

A dicentric chromosome is an abnormal chromosome with two centromeres on the same chromosome. It has been reported that dicentric chromosomes are specific biomarkers of radiation exposure, but dicentric chromosomes are rarely identified in newborns with multiple congenital anomalies. At 16 weeks of gestation, a 39-year-old pregnant woman (gravida 2, para 1) was referred to the prenatal diagnosis center for genetic counseling. The fetal ultrasonography indicated multiple anomalies. Subsequently, amniocentesis was performed, and the G-banding karyotype analysis showed a rare type of mosaicism. The C-banding karyotype analysis indicated a pseudo-dicentric chromosome X [psu dic (X; 18) (p11.2; p11.2)]. A single-nucleotide polymorphism array (SNP array) revealed three pathogenic copy number variations (CNVs). After genetic counseling, the parents chose to terminate this pregnancy. This study provides new evidence for a better understanding of the diagnosis of dicentric chromosomes and emphasizes on the importance of genetic counseling.

A Hospital-Based Longitudinal Study of Rubber Band Ligation and Sclerotherapy Treatment for Internal Hemorrhoids From South India.

Background Hemorrhoids are an extremely common surgical condition affecting millions of individuals worldwide. Treatment options for hemorrhoids vary depending on the severity of symptoms and the type of hemorrhoids. The common non-surgical procedures for grade one and two hemorrhoids include rubber band ligation and sclerotherapy. The present study aims to compare the efficiency of rubber band ligation and sclerotherapy for the treatment of symptomatic grade one and two internal hemorrhoids in a tertiary care hospital. Methodology We conducted a one-year longitudinal survey among 200 patients with internal hemorrhoids in a tertiary care center in Madurai. We gathered data on demographic profiles, symptoms, postoperative complications, intraoperative pain, and treatment outcomes. Data analysis was done using the Pearson chi-square test to assess the difference between rubber band ligation and sclerotherapy treatment groups. A p-value <0.05 was considered statistically significant. Results A total of 200 patients were studied, of whom 100 belonged to the rubber band ligation treatment group and 100 belonged to the sclerotherapy treatment group. The preoperative symptoms were similarly distributed between both treatment groups. Intraoperative and immediate postoperative pain was higher in the rubber band ligation group than in the sclerotherapy group. Post-procedure complications were more commonly seen in the rubber band ligation group than in the sclerotherapy group at various weeks of the procedures. Conclusions Postoperative complications such as bleeding, prolapse, and infection/discharge were significantly different between the two treatment groups. The treatment outcome was significantly different between the two treatment groups after three, six, and nine weeks postoperatively. Overall, the sclerotherapy group was associated with fewer postoperative complications, more excellent patient response, and a more complete response to treatment than the rubber band ligation group.

Persistent species relationships characterize migrating bird communities across stopover sites and seasons.

Global migrations of diverse animal species often converge along the same routes, bringing together seasonal assemblages of animals that may compete, prey on each other, and share information or pathogens. These interspecific interactions, when energetic demands are high and the time to complete journeys is short, may influence survival, migratory success, stopover ecology, and migratory routes. Numerous accounts suggest that interspecific co-migrations are globally distributed in aerial, aquatic, and terrestrial systems, although the study of migration to date has rarely investigated species interactions among migrating animals. Here, we test the hypothesis that migrating animals are communities engaged in networks of ecological interactions. We leverage over half a million records of 50 bird species from five bird banding sites collected over 8 to 23 y to test for species associations using social network analyses. We find strong support for persistent species relationships across sites and between spring and fall migration. These relationships may be ecologically meaningful: They are often stronger among phylogenetically related species with similar foraging behaviors and nonbreeding ranges even after accounting for the nonsocial contributions to associations, including overlap in migration timing and habitat use. While interspecific interactions could result in costly competition or beneficial information exchange, we find that relationships are largely positive, suggesting limited competitive exclusion at the scale of a banding station during migratory stopovers. Our findings support an understanding of animal migrations that consist of networked communities rather than random assemblages of independently migrating species, encouraging future studies of the nature and consequences of co-migrant interactions.

Karyotype analysis of Quasipaaspinosa David, 1875 (Anura, Dicroglossidae) with conventional cytogenetic techniques.

The current study analyzed the chromosomal karyotype of Quasipaaspinosa David, 1875 from Hunan Province, China. The karyotype, C-banding, BrdU-banding pattern were characterized using direct preparation of bone-marrow cells and hemocyte cultures. The findings indicated that Q.spinosa was a diploid species (2n = 26) that lacked heteromorphic chromosomes and secondary constrictions. C-banding analysis revealed an abundance of positive signals in the centromere regions, while the BrdU-banding pattern showed three phases in both male and female, occurring consistently and in chronological sequence during S-phase. Notably, there was no asynchronous replication in the late phase. This study enhanced our understanding of the karyotypic structure of Q.spinosa by conventional cytogenetic techniques, thus providing essential scientific insights into the cytogenetics of Q.spinosa.

Hybrid palliation to promote growth of left ventricle and left ventricular outflow tract.

OBJECTIVES: In patients with borderline left hearts or a severe left ventricular outflow tract obstruction, hybrid palliation can be used to stabilize the patient and postpone biventricular repair (BVR). In this study, we analysed growth of left-sided structures and outcomes of these patients. METHODS: We conducted a retrospective cohort study including patients who received hybrid palliation between January 2010 and September 2023. Echo measurements were collected at hybrid palliation, BVR and last follow-up. Growth of left ventricular structures were analysed. RESULTS: In 38 patients, hybrid palliation was used to promote growth of left ventricular structures. In total, 15 patients received a Ross-Konno/Yasui procedure, while 23 patients received conventional BVR. In patients with a conventional BVR, a significant increase was found in left ventricular volume indexed by body surface area, Z-score of aortic valve and left ventricular outflow tract between hybrid palliation and BVR. Mitral valve Z-score did not increase significantly. After BVR until follow-up, only increase of the aortic valve Z-scores and left ventricular volume indexed by body surface area was found significant. Of all included patients (n = 38), additional surgical procedures were necessary in 8 patients during the interstage period and 15 patients after BVR. Additional catheter interventions were needed in 14 patients in the interstage period and 15 after BVR. Six patients died, with no mortality in the conventional BVR group. CONCLUSIONS: Hybrid palliation as part of a staged BVR is a safe and effective initial step and promotes the growth of left ventricular structures in patients with small left-sided heart structures. Close follow-up is mandatory because extra catheter or surgical interventions are frequently needed.

Comparison of Morbidity and Mortality Outcomes between Hybrid Palliation and Norwood Palliation Procedures for Hypoplastic Left Heart Syndrome: Meta-Analysis and Systematic Review.

Background/Objectives: Hybrid palliation (HP) procedures for hypoplastic left heart syndrome (HLHS) are increasing. Our objective was to compare mortality and morbidity following HP and NP (Norwood palliation) procedures. Methods: Systematic review and meta-analysis of HLHS patients of peer-reviewed literature between 2000 and 2023. Mortality and/or heart transplantation in HP versus NP in the neonatal period, interstage period, and at 1, 3 and 5 years of age, and morbidity including completion of Stage II and Stage III palliation, unexpected interventions, pulmonary artery pressures, right ventricle function, neurodevelopmental outcomes and length of hospital stay were evaluated. Results: Twenty-one (meta-analysis: 16; qualitative synthesis: 5) studies evaluating 1182 HLHS patients included. HP patients had higher interstage mortality (RR = 1.61; 95% CI: 1.10-2.33; p = 0.01) and 1-year mortality (RR = 1.22; 95% CI: 1.03-1.43; p = 0.02) compared to NP patients without differences in 3- and 5-years mortality. HP procedure in high-risk HLHS patients had lower mortality (RR = 0.48; 95% CI: 0.27-0.87; p = 0.01) only in the neonatal period. HP patients underwent fewer Stage II (RR = 0.90; 95% CI: 0.81-1.00; p = 0.05) and Stage III palliation (RR = 0.78; 95% CI: 0.69-0.90; p < 0.01), had more unplanned interventions (RR = 3.38; 95% CI: 2.04-5.59; p < 0.01), and longer hospital stay after Stage I palliation (weighted mean difference = 12.88; 95% CI: 1.15-24.62; p = 0.03) compared to NP patients. Conclusions: Our study reveals that HP, compared to NP for HLHS, is associated with increased morbidity risk without an improved survival rate.

Right ventricular diastolic adaptation to pressure overload in different rat strains.

Different rat strains are used in various animal models of pulmonary hypertension and right ventricular (RV) failure. No systematic assessment has been made to test differences in RV response to pressure overload between rat strains. We compared RV adaptation to pulmonary trunk banding (PTB) in Wistar (W), Sprague Dawley (SD), and Fischer344 (F) rats by hemodynamic profiling focusing on diastolic function. Age-matched male rat weanlings were randomized to sham surgery (W-sham, n = 5; SD-sham, n = 4; F-sham, n = 4) or PTB (W-PTB, n = 8; SD-PTB, n = 8; F-PTB, n = 8). RV function was evaluated after 5 weeks by echocardiography, cardiac MRI, and invasive pressure-volume measurements. PTB caused RV failure and increased RV systolic pressures four-fold in all three PTB groups compared with sham. W- and SD-PTB had a 2.4-fold increase in RV end-systolic volume index compared with sham, while F-PTB rats were less affected. Diastolic and right atrial impairment were evident by increased RV end-diastolic elastance, filling pressure, and E/e' in PTB rats compared with sham, again F-PTB the least affected. In conclusions, PTB caused RV failure with signs of diastolic dysfunction. Despite a similar increase in RV systolic pressure, F-PTB rats showed less RV dilatation and a more preserved diastolic function compared with W- and SD-PTB.

Pulmonary artery banding for cardiomyopathy in young children: First trial in China.

AIMS: Heritable dilated cardiomyopathy (DCM) or DCM associated with congenital or acquired left ventricular diseases carries a significant mortality risk. Pulmonary artery banding (PAB) has been proposed as an alternative to heart transplantation. This study aimed to delineate the clinical development, ventricular reverse remodelling, and functional regeneration of the dilated left ventricle, presenting as a pioneering approach in China. METHODS AND RESULTS: This prospective study was initiated in November 2021, involving paediatric patients with a significant dilated left ventricle and preserved right ventricle who underwent surgical PAB. The baseline characteristics and clinical information during follow-up were collected. Seven patients (five boys) with a median age of 240 (148, 1028) days have been included thus far. No procedural or follow-up mortality was observed. The modified Ross functional class improved from treatment to follow-up of 348 (200, 629) days, and the median left ventricular ejection fraction increased from 27.0 (15.0, 34.0) % before surgery to 61.0 (52.0, 68.0) % (P < 0.05); the median left ventricular end-diastolic diameter and corresponding Z-scores decreased from 43.0 (40.0, 55.0) mm [+9.4 (+7.7, +11.7)] to 33.0 (29.0, 39.0) mm [+1.8 (+1.3, +3.8)] (P < 0.05). Functional regeneration of the left ventricle was observed in five patients. Three of them underwent balloon dilation of the PAB to relieve excessively elevated right ventricular pressures. CONCLUSIONS: The application of PAB should adhere to strict criteria. Initial results are promising for infants and even toddlers with a dilated left ventricle and limited probability of spontaneous recovery. PAB can be an alternative when there is a shortage of donor transplants and assist devices, especially for low- and middle-income countries.

Integrative Taxonomy Suggests Resurrection of Species of the Astyanax bimaculatus Group (Characiformes, Characidae).

Using integrative tools can be effective for species identification, especially in complex groups like Astyanax. Astyanax bimaculatus group is composed of six valid species, including A. lacustris. "A. altiparanae", "A. asuncionensis", and "A. jacuhiensis" are considered as junior synonyms of A. lacustris. Seeking to test the operational taxonomic unit (OTU) status of the junior synonyms of A. lacustris ("A. altiparanae", "A. asuncionensis", and "A. jacuhiensis"), we used analyses through mitochondrial DNA (COI and Cytb), cytogenetic markers (classical and molecular), and morphometry ("truss network"). Analysis of mitochondrial DNA sequences separated A. lacustris from the other synonymized species. The cytogenetic and morphometric analyses did not corroborate the synonymization and suggest that besides A. lacustris, the OTUs A. altiparanae, A. asuncionensis, and A. jacuhiensis are valid species. The analysis of different characters proposed by the integrative taxonomy used on the same individuals could provide greater reliability and minimize the underestimation of biodiversity.

FISH-Banding for Characterization of Simple and Complex Chromosomal Rearrangements in Cancer.

While interphase and metaphase-directed molecular cytogenetics is a standard technique in routine tumor (cyto)genetics, fluorescence in situ hybridization-based banding (FISH-banding) approaches are less commonly applied. In research FISH-banding showed its excellence in the characterization of simple and complex chromosomal aberrations; however, in routine settings, it is still only little applied. The main argument against FISH-banding is, that it shall be associated with comparatively high costs. However, if applied advisedly FISH-banding can even save costs, as in one or two chromosome-specific FISH experiments; otherwise, cryptic, not resolvable chromosomal rearrangements may be resolved quickly. Here the protocol for the only yet commercially available FISH-banding approach-the multicolor banding (MCB/ mBAND)-is outlined.

Chromosome Bandings and Recognition.

Chromosome banding can be defined as the lengthwise variation in staining properties along a chromosome stained with a dye. Chromosome banding became more practical in the early 1970s and is an essential technique used in karyotyping to identify human chromosomes for both clinical and research purposes. Most importantly, karyotyping is now considered a mandatory investigation of all newly diagnosed leukemias. Some banding methods, such as Giemsa (G)-, reverse (R)-, and centromere (C)-banding, still contribute greatly by being used as a routine procedure in clinical cytogenetic laboratory nowadays. Each chromosome has a unique sequence of bar code-like stripes, allowing the identification of individual homologues and the recognition of structural abnormalities through analyzing the disruption of the normal banding pattern at specific landmarks, regions, and bands as described in the ideogram. Since the quality of metaphases obtained from malignant cells is generally inferior to normal constitutional cells for karyotyping, a practical and accurate chromosome identification training guide is indispensable for a trainee or newly employed cytogenetic technologist in a cancer cytogenetic laboratory. The most common and currently used banding methods and chromosome recognition guide for distinguishable bands of each chromosome are described in detail in this chapter with an aim to facilitate quick and accurate karyotyping in cancer cells.