RESUMO
Lipoic acid is a sulfur-containing cofactor indispensable for the function of several metabolic enzymes. In microorganisms, lipoic acid can be salvaged from the surroundings by lipoate protein ligase A (LplA), an ATP-dependent enzyme. Alternatively, it can be synthesized by the sequential actions of lipoate protein ligase B (LipB) and lipoyl synthase (LipA). LipB takes up the octanoyl chain from C8-acyl carrier protein (C8-ACP), a byproduct of the type II fatty acid synthesis pathway, and transfers it to a conserved lysine of the lipoyl domain of a dehydrogenase. However, the molecular basis of its substrate recognition is still not fully understood. Using Escherichia coli LipB as a model enzyme, we show here that the octanoyl-transferase mainly recognizes the 4'-phosphopantetheine-tethered acyl-chain of its donor substrate and weakly binds the apo-acyl carrier protein. We demonstrate LipB can accept octanoate from its own ACP and noncognate ACPs, as well as C8-CoA. Furthermore, our 1H saturation transfer difference and 31P NMR studies demonstrate the binding of adenosine, as well as the phosphopantetheine arm of CoA to LipB, akin to binding to LplA. Finally, we show a conserved 71RGG73 loop, analogous to the lipoate-binding loop of LplA, is required for full LipB activity. Collectively, our studies highlight commonalities between LipB and LplA in their mechanism of substrate recognition. This knowledge could be of significance in the treatment of mitochondrial fatty acid synthesis related disorders.
Assuntos
Aciltransferases/química , Proteínas de Escherichia coli/química , Escherichia coli/enzimologia , Proteína de Transporte de Acila/metabolismo , Aciltransferases/metabolismo , Coenzima A/metabolismo , Escherichia coli/química , Proteínas de Escherichia coli/metabolismo , Ligases/metabolismo , Panteteína/análogos & derivados , Ácido Tióctico/metabolismoRESUMO
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by ß-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven ß-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.
RESUMO
The only known redox system in the apicoplast, a plastid-like organelle of apicomplexan parasites, is ferredoxin and ferredoxin-associated reductase. Ferredoxin donates electrons to different enzymes, presumably including lipoate synthase (LipA), which is essential for fatty acid biosynthesis. We recombinantly expressed and characterized LipA from the protozoan parasite Toxoplasma gondii, generated LipA-specific antibodies and confirmed the apicoplast localization of LipA. Electron transfer from ferredoxin to LipA would require direct protein-protein interaction. Such a robust interaction between the two proteins was demonstrated in both yeast and bacterial two-hybrid systems. Taken together, our results provide strong evidence for a role of ferredoxin as an electron donor to LipA.