Phenotypic presentation of MEN1 c.758delC (p.Ser253Cysfs *28) pathogenic variant: a case report.

MEN1 is a rare syndrome caused by mutations in the MEN1 gene. We describe a clinical case of MEN1 syndrome associated with a recently discovered pathogenic mutation of MEN1 gene. A 32-year-old man with a history of osteopenia, nephrolithiasis, hypercalcemia and hypophosphatemia, impaired fasting glucose, and asthenia was admitted to our outpatient unit. Primary hyperparathyroidism, sustained by three hyperplastic parathyroid glands, was diagnosed. Prolactin- and GH-secreting adenomas were ruled out. After undergoing subtotal parathyroidectomy, the patient was diagnosed with non-functioning pituitary adenoma, three pancreatic lesions, and Cushing syndrome sustained by left adrenal adenoma. The patient underwent left adrenal surgery; somatostatin analogue lanreotide was started for the pancreatic lesions; the pituitary adenoma, being small and non-secreting, was not treated. A genetic test was performed to confirm the diagnosis of MEN1 syndrome, finding an association with a recently discovered mutation: the (NM_130799.2):c.758delC (p.Ser253Cysfs*28) in exon 4.

Clinical and molecular characterisation of children with monogenic obesity: a case series.

INTRODUCTION: To study the clinical profile and molecular diagnosis of children with severe early-onset non-syndromic monogenic obesity. METHODS: The clinical and molecular data (performed using whole exome sequencing) of 7 children with early-onset (< 5 years) non-syndromic monogenic obesity were extracted from the Obesity Clinic files and analysed retrospectively. RESULTS: The median (IQR) age at presentation was 18 (10.5-27) months. Of the 7 patients, 5 were boys, 3 had a history of parental consanguinity, and 4 had a family history of severe early-onset obesity. All patients exhibited hyperphagia and showed signs of insulin resistance. Dyslipidaemia and fatty liver were observed in 4. The variants identified in 6 patients included 2 in leptin receptor, and one each in melanocortin 4 receptor, pro-opiomelanocortin, leptin, and neurotrophic tyrosine kinase receptor type 2 genes. Notably, 4 of these variants were novel. CONCLUSIONS: This case series provides valuable insights into the spectrum of genetic mutations associated with non-syndromic monogenic obesity in North Indian children. The findings underscore the significance of next-generation sequencing in identifying the aetiology of severe early-onset obesity.

Two Novel Variants of the CAPN3 Gene in Chinese Patients with Limb-Girdle Muscular Dystrophy Recessive 1.

INTRODUCTION: Recessive mutations in the CAPN3 gene can lead to limb-girdle muscular dystrophy recessive 1 (LGMD R1). Targeted next-generation sequencing facilitates the discovery of new mutations linked with disease, owing to its ability to selectively enrich specific genomic regions. METHODS: We performed targeted next-generation sequencing of all exons of the CAPN3 gene in 4 patients with sporadic limb-girdle muscular dystrophy (LGMD) and further analyzed the effects of the novel identified variant using various software tools. RESULTS: We found 5 variants in CAPN3 gene in 4 patients, c.82_83insC (insertion mutation) and c.1115+2T>C (splicing mutation) are reported for the first time in CAPN3 (NM_000070.2). The bioinformatics analysis indicated that these two novel variants affected CAPN3 transcription as well as translation. DISCUSSION: Our findings reveal previously unreported splicing mutation and insertion mutation in CAPN3 gene, further expanding the pathogenic gene profile of LGMD.

Genetic Characterization and Population Structure of Drug-Resistant Mycobacterium tuberculosis Isolated from Brazilian Patients Using Whole-Genome Sequencing.

The present study aimed to determine the genetic diversity of isolates of Mycobacterium tuberculosis (Mtb) from presumed drug-resistant tuberculosis patients from several states of Brazil. The isolates had been submitted to conventional drug susceptibility testing for first- and second-line drugs. Multidrug-resistant (MDR-TB) (54.8%) was the most frequent phenotypic resistance profile, in addition to an important high frequency of pre-extensive resistance (p-XDR-TB) (9.2%). Using whole-genome sequencing (WGS), we characterized 298 Mtb isolates from Brazil. Besides the analysis of genotype distribution and possible correlations between molecular and clinical data, we determined the performance of an in-house WGS pipeline with other online pipelines for Mtb lineages and drug resistance profile definitions. Sub-lineage 4.3 (52%) was the most frequent genotype, and the genomic approach revealed a p-XDR-TB level of 22.5%. We detected twenty novel mutations in three resistance genes, and six of these were observed in eight phenotypically resistant isolates. A cluster analysis of 170 isolates showed that 43.5% of the TB patients belonged to 24 genomic clusters, suggesting considerable ongoing transmission of DR-TB, including two interstate transmissions. The in-house WGS pipeline showed the best overall performance in drug resistance prediction, presenting the best accuracy values for five of the nine drugs tested. Significant associations were observed between suffering from fatal disease and genotypic p-XDR-TB (p = 0.03) and either phenotypic (p = 0.006) or genotypic (p = 0.0007) ethambutol resistance. The use of WGS analysis improved our understanding of the population structure of MTBC in Brazil and the genetic and clinical data correlations and demonstrated its utility for surveillance efforts regarding the spread of DR-TB, hopefully helping to avoid the emergence of even more resistant strains and to reduce TB incidence and mortality rates.

Genotypic and phenotypic features of 39 Chinese patients with glycogen storage diseases type I, VI, and IX.

Glycogen storage diseases (GSDs) are abnormally inherited glycogen metabolism mainly affecting the liver, muscles, and heart. Deficiency of proteins involved in glycogen metabolism caused by genetic mutations are responsible for different subtype of GSDs. However, there are still some challenges in diagnosing GSD. This study includes 39 suspected GSDs patients from unrelated families in China. Next-generation sequencing (NGS) was used to investigate the reason for their diseases at the genetic level. Finally, all 39 patients were diagnosed with GSDs, including 20 GSD-Ia, 4 GSD-VI, and 15 GSD IX (12 GSD-IXa patients and 3 GSD-IXb patients). Thirty-two mutations in G6PC1, PYGL, PHKA2, and PHKB genes were identified, with 14 of them being novel variants. The pathogenicity of novel variants was classified according to ACMG guildlines and predicted by in slico algorithms. Mutations p.L216L and p.R83H in G6PC1 gene may be the hot spot mutation in Chinese. Hearing impairment is a rare clinical feature of GSD Ia, which has also been observed in our cohort. The severity of GSD VI and IX was indicated by our patients. Close follow-up should be applied to GSD VI and IX patients. Our findings provided evidence for building the phenotype-genotype of GSDs and expanded the mutation spectrum of related genes.

New Genetic Variants of RUNX2 in Mexican Families Cause Cleidocranial Dysplasia.

Cleidocranial dysplasia (CCD) is an autosomal dominant skeletal dysplasia characterized by persistent open skull sutures with bulging calvaria, hypoplasia, or aplasia of clavicles permitting abnormal opposition of the shoulders; wide public symphysis; short middle phalanx of the fifth fingers; and vertebral, craniofacial, and dental anomalies. It is a rare disease, with a prevalence of 1-9/1,000,000, high penetrance, and variable expression. The gene responsible for CCD is the Runt-related transcription factor 2 (RUNX2) gene. We characterize the clinical, genetic, and bioinformatic results of four CCD cases: two cases within Mexican families with six affected members, nine asymptomatic individuals, and two sporadic cases with CCD, with one hundred healthy controls. Genomic DNA analyses of the RUNX2 gene were performed for Sanger sequencing. Bioinformatics tools were used to predict the function, stability, and structural changes of the mutated RUNX2 proteins. Three novel heterozygous mutations (c.651_652delTA; c.538_539delinsCA; c.662T>A) and a previously reported mutation (c.674G>A) were detected. In silico analysis showed that all mutations had functional, stability-related, and structural alterations in the RUNX2 protein. Our results show novel mutations that enrich the pool of RUNX2 gene mutations with CCD. Moreover, the proband 1 presented clinical data not previously reported that could represent an expanded phenotype of severe expression.

Discovery of Novel Potential Insecticide-Resistance Mutations in Spodoptera frugiperda.

The fall armyworm (FAW), Spodoptera frugiperda, is a worldwide agricultural pest that invaded China in 2018, and has developed resistance to multiple insecticides. The evolution of insecticide resistance is facilitated by mutations of target genes responsible for conferring resistance. In this study, amplicon sequencing analyzed 21 sites in six resistance genes. In addition to known mutations, unknown variants were also found, including novel variants: F290C (ace-1 gene, 0.1% frequency), I1040T/V (CHSA gene, 0.1% frequency), A309T (GluCl gene, 0.1% frequency), and I4790T/V (RyR gene, 0.1% frequency). Additionally, molecular docking was employed to investigate the impact of the aforementioned new mutations on insecticide binding to proteins. The analyses indicated that the binding abilities were reduced, similar to the resistance mutations that were reported, implying these novel mutations may confer transitional resistance. This study may provide a foundation for understanding the functions of these novel mutations in the evolutionary processes that drive the emergence of insecticide resistance in this invasive species.

Identification of novel mutations in TPK1 and SLC19A3 genes in families exhibiting thiamine metabolism dysfunction syndrome.

Background and aims: The occurrence of thiamine metabolism dysfunction syndrome (THMD), a rare autosomal recessive condition, may be linked to various mutations found in the TPK1 and SLC19A3 genes. The disease chiefly manifests through ataxia, muscle hypotonia, abrupt or subacute onset encephalopathy, and a decline in developmental milestones achieved during the early stages of infancy. We present findings from an investigation that involved two individuals from Iran, both of whom experienced seizures along with ataxia and hypotonia. The underlying genetic causes were found with the use of next-generation sequencing (NGS) technology, which has facilitated the detection of causal changes in a variety of genetic disorders. Material and methods: The selection of cases for this study was based on the phenotypic and genetic information that was obtainable from the Center for Comprehensive Genetic Services. The genetic basis for the problems observed among the participants was determined through the application of whole-exome sequencing (WES). Subsequently, sanger sequencing was employed as a means of validating any identified variations suspected to be causative. Results: The first patient exhibited a homozygous mutation in the TPK1 gene, NM_022445.4:c.224 T > A:p.I75 N, resulting in the substitution of isoleucine for asparagine at position 75 (p.I75 N). In our investigation, patient 2 exhibited a homozygous variant, NM_025243.4:c.1385dupA:pY462X, within the SLC19A3 gene. Conclusions: Collectively, when presented with patients showcasing ataxia, encephalopathy, and basal ganglia necrosis, it is essential to account for thiamine deficiency in light of the potential advantages of prompt intervention. At times, it may be feasible to rectify this deficiency through the timely administration of thiamine dosages. Accordingly, based on the results of the current investigation, these variations may be useful for the diagnosis and management of patients with THMD.

Broadening the phenotype and genotype spectrum of novel mutations in pontocerebellar hypoplasia with a comprehensive molecular literature review.

BACKGROUND: Pontocerebellar hypoplasia is an umbrella term describing a heterogeneous group of prenatal neurodegenerative disorders mostly affecting the pons and cerebellum, with 17 types associated with 25 genes. However, some types of PCH lack sufficient information, which highlights the importance of investigating and introducing more cases to further elucidate the clinical, radiological, and biochemical features of these disorders. The aim of this study is to provide an in-depth review of PCH and to identify disease genes and their inheritance patterns in 12 distinct Iranian families with clinically confirmed PCH. METHODS: Cases included in this study were selected based on their phenotypic and genetic information available at the Center for Comprehensive Genetic Services. Whole-exome sequencing (WES) was used to discover the underlying genetic etiology of participants' problems, and Sanger sequencing was utilized to confirm any suspected alterations. We also conducted a comprehensive molecular literature review to outline the genetic features of the various subtypes of PCH. RESULTS: This study classified and described the underlying etiology of PCH into three categories based on the genes involved. Twelve patients also were included, eleven of whom were from consanguineous parents. Ten different variations in 8 genes were found, all of which related to different types of PCH. Six novel variations were reported, including SEPSECS, TSEN2, TSEN54, AMPD2, TOE1, and CLP1. Almost all patients presented with developmental delay, hypotonia, seizure, and microcephaly being common features. Strabismus and elevation in lactate levels in MR spectroscopy were novel phenotypes for the first time in PCH types 7 and 9. CONCLUSIONS: This study merges previously documented phenotypes and genotypes with unique novel ones. Due to the diversity in PCH, we provided guidance for detecting and diagnosing these heterogeneous groups of disorders. Moreover, since certain critical conditions, such as spinal muscular atrophy, can be a differential diagnosis, providing cases with novel variations and clinical findings could further expand the genetic and clinical spectrum of these diseases and help in better diagnosis. Therefore, six novel genetic variants and novel clinical and paraclinical findings have been reported for the first time. Further studies are needed to elucidate the underlying mechanisms and potential therapeutic targets for PCH.

Exome sequencing-aided precise diagnosis of four families with type I Stickler syndrome.

BACKGROUND: Stickler syndrome is a multisystemic disorder characterized by ophthalmological and non-ophthalmological abnormalities, frequently misdiagnosed due to high clinical heterogeneity. Stickler syndrome type I (STL1) is predominantly caused by mutations in the COL2A1 gene. METHODS: Exome sequencing and co-segregation analysis were utilized to scrutinize 35 families with high myopia, and pathogenic mutations were identified. Mutant COL2A1 was overexpressed in cells for mechanistic study. A retrospective genotype-phenotype correlation analysis was further conducted. RESULTS: Two novel pathogenic mutations (c.2895+1G>C and c.3505G>A (p.Val1169Ile)) and two reported mutations (c.1597C>T (p.Arg533*) and c.1693C>T (p.Arg565Cys)) in COL2A1 were identified causing STL1. These mutations are all in the G-X-Y triplet, and c.2895+1G>C contributed to aberrant RNA splicing. COL2A1 mutants tended to form large aggregates in the endoplasmic reticulum (ER) and elevated ER stress. Additionally, mutations c.550G>A (p.Ala184Thr) and c.2806G>A (p.Gly936Ser) in COL2A1 were found in high myopia families, but were likely benign, although c.2806G>A (p.Gly936Ser) is on G-X-Y triplet. Moreover, genotype-phenotype correlation analysis revealed that mutations in exon 2 mainly contribute to retinal detachment, whereas mutations in the collagen alpha-1 chain region of COL2A1 tend to cause non-ophthalmologic symptoms. CONCLUSION: This study broadens the COL2A1 gene mutation spectrum, provides evidence for ER stress caused by pathogenic COL2A1 mutations and highlights the importance of non-ophthalmological examination in clinical diagnosis of high myopia.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Erratum: Novel mutations in ATP7B in Chinese patients with Wilson's disease and identification of kidney disorder of thinning of the glomerular basement membrane.

[This corrects the article DOI: 10.3389/fneur.2023.1231605.].

Novel mutations in ATP7B in Chinese patients with Wilson's disease and identification of kidney disorder of thinning of the glomerular basement membrane.

Introduction: Wilson's disease is an autosomal recessive disorder caused by ATP7B pathogenic mutations. The hallmark of this disorder mainly consists of liver involvement, neurologic dysfunction and psychiatric features. In addition, the kidneys can also be affected by excessive copper deposition. Methods: A total of 34 patients clinically diagnosed with WD were recruited. They underwent ATP7B gene sequencing and clinical data of symptoms, examination, and treatment were collected. Moreover, renal pathology information was also investigated. Results: We identified 25 potentially pathogenic ATP7B variants (16 missense, 5 frameshift, 3 splicing variants and 1 large deletion mutation) in these 34 WD patients, 5 of which were novel. In our cases, the most frequent variant was c.2333G>T (R778L, 39.06%, exon 8), followed by c.2621C>T (A874V, 10.94%, exon 11) and c.3316G>A (V1106I, 7.81%, exon 11). Furthermore, we described the thinning of the glomerular basement membrane as a rare pathologically damaging feature of Wilson's disease for the first time. Additionally, two patients who received liver transplant were observed with good prognosis in present study. Discussion: Our work expanded the spectrum of ATP7B variants and presented rare renal pathological feature in WD patients, which may facilitate the development of early diagnosis, counseling, treatment regimens of WD.

Novel Variant IMPDH1 c.134A>G, p.(Tyr45Cys): Phenotype-Genotype Correlation Revealed Likely Benign Clinical Significance.

Pathogenic variants in IMPDH1 are associated with autosomal dominant retinitis pigmentosa 10 (RP10), and Leber congenital amaurosis 11. This case report of a 13-year-old girl with Down's syndrome and keratoglobus is aimed at linking the novel variant IMPDH1 c.134A>G, p.(Tyr45Cys), a variant of uncertain significance, to a clinical phenotype and to provide grounds for the objective assignment of its benign features. RP10 is characterized by the early onset and rapid progression of ocular symptoms, beginning with nyctalopia in childhood, accompanied by typical RP fundus changes. As evidenced via thorough clinical examination and testing, none of the RP10 characteristics were present in our patient. On the contrary, our patient who was heterozygous for IMPDH1 c.134A>G, p.(Tyr45Cys) showed no signs of peripheral retinal dystrophy, and did not manifest any disease characteristics typical of the IMPDH1 gene mutation. Consequently, we conclude that the variant did not contribute to the phenotype. According to standards and guidelines for the interpretation of sequence variants, IMPDH1 c.134A>G, p.(Tyr45Cys) revealed likely benign features.

Clinical and genetic characteristics of retinoblastoma patients in a single center with four novel RB1 variants.

AIM: To assess the clinical and genetic characteristics of children diagnosed with retinoblastoma (RB) at Gazi University Faculty of Medicine's Department of Pediatric Oncology. METHODS: All cases diagnosed with RB and received treatment and follow-up in the Ophthalmology and Pediatric Oncology Department, October 2016 to May 2021 were evaluated retrospectively. The RB1 gene was analyzed by next-generation sequencing (NGS) technique in DNAs obtained from peripheral blood samples of the patients. RESULTS: This study included 53 cases with 67 RB-affected eyes during the study period. The mean age was 24.6 (median: 18.5, range: 3-151)mo. There were 15 (22.3%) Group D eyes and 39 (58.2%) Group E eyes. The RB1 gene was sequenced by the NGS method in 19 patients. Heterozygous RB1:NM_000321.3: c.54_76del (p.Glu19AlafsTer4) variant was detected in a 15-month-old female with bilateral RB. Heterozygous RB1:NM_000321.3: c.1814+3A>T variant was detected in a 5.5-month-old male with bilateral RB. The intronic RB1:NM_000321.3: c.1332+4A>G variant was detected in patient 14, a 13-month-old male with unilateral RB. The RB1:NM_000321.3: c.575_576del (p.Lys192SerfsTer10) variant was found in an 18-month-old female with an allele frequency of 37%. These variants have not been reported in the literature and mutation databases. CONCLUSION: Four novel variants are described and one of them is found in two different patients. This data is crucial for assessing prognosis. It serves as a guide for estimating the long-term risk of secondary malignancy as well as the short-term risk of developing additional malignancies in the same eye and the other eye.

Neurological comorbidities and novel mutations in Turkish cases with neurofibromatosis type 1.

Background and purpose:

Neuro­fibromatosis type 1 (NF1) is a rare, auto­somal dominant multisystemic disease. The NF1 gene is localized on chromosome 17q11.2. Patients with NF1 have different clinical presentations and comorbidities. The aim of the present study is to determine the novel mutations and neurological comorbidities of NF1.

Patients who were diagnosed with NF1 by clinical criteria of the National Institutes of Health were included in the study. After a detailed examination, the NF1 gene was analysed with the help of next generation sequencing technology from pe­ripheral blood samples via MiSeq (Illu­mina, USA). Bioinformatic analyzes were per­for­med to evaluate the clinical sig­ni­fi­cance of the detected variants via the in­ternational databanks in accordance with the ACMG (American College of Medical Ge­netics) guide­line. In addition, cerebral-spinal MRI, cerebral angiography, and ENMG exa­mi­na­tions were performed if deemed necessary.

Twenty patients (12 female, 8 male) were included in the study. The mean age was 25.8±10 (10-56) years. Previously defined 13 different pathogenic mutations according to the ACMG criteria were identified in 18 patients. Also, two novel mutations were detected in 2 cases. Moreover, neurological comorbidities (moyamoya disease, multiple sclerosis, Charcot Marie Tooth Type 1A) were found in 3 patients with NF1.

In the present study two novel mutations and three different neurological comorbidities were identified in NF1.

Extending and outlining the genotypic and phenotypic spectrum of novel mutations of NALCN gene in IHPRF1 syndrome: identifying recurrent urinary tract infection.

Infantile hypotonia with psychomotor retardation and characteristic facies 1 (IHPRF1) is caused by biallelic mutations in the NALCN gene, the major ion channel responsible for the background Na + conduction in neurons. Through whole-exome sequencing (WES), we report three novel homozygous variants in three families, including c.1434 + 1G > A, c.3269G > A, and c.2648G > T, which are confirmed and segregated by Sanger sequencing. Consequently, intron 12's highly conserved splice donor location is disrupted by the pathogenic c.1434 + 1G > A variation, most likely causing the protein to degrade through nonsense-mediated decay (NMD). Subsequently, a premature stop codon is thus generated at amino acid 1090 of the protein as a result of the pathogenic c.3269G > A; p.W1090* variation, resulting in NMD or truncated protein production. Lastly, the missense mutation c.2648G > T; p.G883V can play a critical role in the interplay of functional domains. This study introduces recurrent urinary tract infections for the first time, broadening the phenotypic range of IHPRF1 syndrome in addition to the genotypic spectrum. This trait may result from insufficient bladder emptying, which may be related to the NALCN channelosome's function in background Na + conduction. This work advances knowledge about the molecular genetic underpinnings of IHPRF1 and introduces a novel phenotype through the widespread use of whole exome sequencing.

Genetic and clinical features of patients with intrahepatic cholestasis caused by citrin deficiency.

OBJECTIVES: Citrin deficiency (CD) is an autosomal recessive disease caused by mutations of the SLC25A13 gene, plasma bile acid profiles detected by liquid chromatography-tandem mass spectrometry (LC-MS/MS) could be an efficient approach for early diagnosis of intrahepatic cholestasis. The aim of this study was to investigate the genetic testing and clinical characteristics of a series of patients with CD, and to analyse plasma bile acid profiles in CD patients. METHODS: We retrospectively analysed data from 14 patients (12 males and 2 females, age 1-18 months, mean 3.6 months) with CD between 2015 and 2021, including demographics, biochemical parameters, genetic test results, treatment, and clinical outcomes. In addition, 30 cases (15 males and 15 females, age 1-20 months, mean 3.8 months) with idiopathic cholestasis (IC) served as a control group. Plasma 15 bile acid profiles were compared between the CD and IC groups. RESULTS: Eight different mutations of the SLC25A13 gene were detected in the 14 patients diagnosed with CD, of which three novel variants of the SLC25A13 gene were investigated, the c.1043C>T (p.P348L) in exon11, the c.1216dupG (p.A406 Gfs*13) in exon12 and the c.135G>C (p.L45F) in exon3. More than half of the patients with CD had prolonged neonatal jaundice, which was associated with significantly higher alpha-fetoprotein (AFP) levels, hyperlactatemia and hypoglycemia. The majority of patients were ultimately self-limited. Only one patient developed liver failure and died at the age of 1 year due to abnormal coagulation function. In addition, the levels of glycochenodeoxycholic acid (GCDCA), taurocholate (TCA), and taurochenodeoxycholic acid (TCDCA) were significantly increased in the CD group compared with those in the IC group. CONCLUSIONS: Three novel variants of the SLC25A13 gene were identified for the first time, providing a reliable molecular reference and expanding the SLC25A13 gene spectrum in patients with CD. Plasma bile acid profiles could be a potential biomarker for non-invasive early diagnosis of patients with intrahepatic cholestasis caused by CD.

Atypical Case of Highly Mutated h-TERT Promoter in Germline Genome from Buccal Mucosa Cancer.

Buccal mucosa cancer has an aggressive nature as it rapidly grows and penetrates with high recurrence rate. Strikingly, carcinoma of buccal mucosa is the most common cancer of oral cavity in India. Recently, telomerase and telomere biology have been implicated in the pathogenesis and progression in various cancers via regulation of telomere maintenance by telomerase expression which is controlled by telomerase reverse transcriptase (TERT) promoter. Strikingly, h-TERT promoter mutations have been incriminated in regulation of telomerase gene expression. Here, we present a 35 years old male with intense coughing, short breathlessness and fever since 15 days, was admitted to the pulmonary unit. He was a chronic smoker and gutka user. The cytopathological analysis of gastric aspirate revealed buccal mucosa carcinoma of IV stage. We identified h-TERT promoter mutations in isolated genomic DNA from whole blood using DNA sequencer. Genetic analysis disclosed that h-TERT promoter region was highly mutated in this patient. Identified mutations include C.-248 del G, C.-272 del G, C.-279 del G, C.-331 del G, C.-349 del G, C.-351 del C, C.-360 G > A, C.-362 T > A, C.-371 del T and C.-372 del T. Further, all identified mutations were subjected to predict the pathologic functional consequences using bioinformatics tools viz TFsitescan and CiiiDER which showed either loss or gain of transcription factors binding sites in h-TERT promoter. This is a unique case in which total 9 mutations were observed in h-TERT promoter in a single case. In conclusion, all together these mutations in h-TERT promoter may alter the epigenetics and subsequently the tenacity of binding transcription factors which are of functional significance.

A novel homozygous CYP17A1 mutation causes partial 17 α-hydroxylase/17,20-lyase deficiency in 46,XX: a case report and literature review.

Aim: 17 α-hydroxylase/17,20-lyase deficiency (17-OHD) is an extremely rare autosomal recessive disorder that typically causes hypertension, hypokalaemia, primary amenorrhoea, and the absence of secondary sex characteristics in 46,XX individuals. Partial 17-OHD is even rarer than complete 17-OHD and is prone to missed diagnosis due to its subtler symptoms. The aim of this study was to help early detection and diagnosis of partial 17-OHD.Methods: We present a case of a 41-year-old female (46,XX) patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P). This patient experienced hypertension, hypokalaemia and adrenal hyperplasia, but did not present with primary amenorrhoea or absence of secondary sex characteristics. Initially, she was misdiagnosed and underwent right and left adrenalectomy, but the procedures were ineffective. Afterward, she received a one-month treatment of 0.5 mg dexamethasone, which greatly relieved her symptoms. Additionally, we reviewed reports of thirteen other patients with partial 17-OHD in 46,XX individuals from the literature, totalling fourteen probands.Results: We found that primary amenorrhoea, hypertension, hypokalaemia, and ovarian cysts accounted for 15.4%, 42.9%, 38.5%, and 72.7% of these patients, respectively. In contrast, elevated serum progesterone was present in all patients.Conclusion: Based on our literature review, the absence of primary amenorrhoea, hypertension or hypokalaemia cannot rule out suspicion for 17-OHD in 46,XX individuals. However, an elevation in serum progesterone levels is a highly sensitive indicator for diagnosing 17-OHD.

What is the context?17-OHD is a rare cause of secondary hypertension, often with hypokalaemia, primary amenorrhoea and absence of secondary sex characteristics.Partial 17-OHD is an even rarer subtype of 17-OHD, with subtler symptoms.There are few reports concerning partial 17-OHD, especially in 46,XX patients.What is new?We reported a case of a 46,XX patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P).We also conducted a literature review to summarise the clinical, hormonal and genetic characteristics of fourteen 46,XX probands with partial 17-OHD.From the literature review, we found that:Most 46,XX patients with partial 17-OHD presented with partial pubic hair, breast development, oligomenorrhea or secondary amenorrhoea, normotension, and/or normokalemia.All 46,XX patients with partial 17-OHD presented with elevated serum progesterone.However, the relationship between in vitro enzyme activities of the 17-hydroxylase and/or17,20-lyase and clinical severity is still unclear.What is the impact?The current study can help early detection and diagnosis of partial 17-OHD.