Development of novel species-specific and genus-specific primers for the detection of Babaco Mosaic Virus (BabMV).

Babaco is a hybrid cultivar native to the Andean region of Ecuador and Colombia, commercially attractive for its fruit. Babaco production in Ecuador faces losses from plant pathogens like babaco mosaic virus (BabMV), an RNA virus that causes chlorosis, leaf mottling, and deformation. Phylogenetic studies link BabMV to papaya mosaic virus (PapMV), alternanthera mosaic virus, and senna mosaic virus. To address this threat, we developed novel species-specific primers to detect BabMV targeting a 165 bp region of the coat protein (CP). Genus-specific primers were designed to validate the species-specific primers and attest their ability to discriminate between BabMV and its closest relatives. These primers targeted a 175 bp fragment of the CP region. The most effective sets of primers were chosen for reverse transcription polymerase chain reaction (RT-PCR) and SYBR® Green-based quantitative reverse transcription polymerase chain reaction (RT-qPCR) in symptomatic and asymptomatic babaco plants. Among 28 plants tested, 25 were positive and 3 were negative for BabMV using species-specific and genus-specific primers in RT-PCR and RT-qPCR, while the PapMV positive control was detected with the genus-specific primers and was negative for the species-specific primers. These primers represent a valuable molecular tool for detecting BabMV, potentially enhancing crop management.

bZIP60 and Bax inhibitor 1 contribute IRE1-dependent and independent roles to potexvirus infection.

IRE1, BI-1, and bZIP60 monitor compatible plant-potexvirus interactions though recognition of the viral TGB3 protein. This study was undertaken to elucidate the roles of three IRE1 isoforms, the bZIP60U and bZIP60S, and BI-1 roles in genetic reprogramming of cells during potexvirus infection. Experiments were performed using Arabidopsis thaliana knockout lines and Plantago asiatica mosaic virus infectious clone tagged with the green fluorescent protein gene (PlAMV-GFP). There were more PlAMV-GFP infection foci in ire1a/b, ire1c, bzip60, and bi-1 knockout than wild-type (WT) plants. Cell-to-cell movement and systemic RNA levels were greater bzip60 and bi-1 than in WT plants. Overall, these data indicate an increased susceptibility to virus infection. Transgenic overexpression of AtIRE1b or StbZIP60 in ire1a/b or bzip60 mutant background reduced virus infection foci, while StbZIP60 expression influences virus movement. Transgenic overexpression of StbZIP60 also confers endoplasmic reticulum (ER) stress resistance following tunicamycin treatment. We also show bZIP60U and TGB3 interact at the ER. This is the first demonstration of a potato bZIP transcription factor complementing genetic defects in Arabidopsis. Evidence indicates that the three IRE1 isoforms regulate the initial stages of virus replication and gene expression, while bZIP60 and BI-1 contribute separately to virus cell-to-cell and systemic movement.

Limited potexvirus diversity in eastern Gulf of Mexico seagrass meadows.

Turtlegrass virus X, which infects the seagrass Thalassia testudinum, is the only potexvirus known to infect marine flowering plants. We investigated potexvirus distribution in seagrasses using a degenerate reverse transcription polymerase chain reaction (RT-PCR) assay originally designed to capture potexvirus diversity in terrestrial plants. The assay, which implements Potex-5 and Potex-2RC primers, successfully amplified a 584 nt RNA-dependent RNA polymerase (RdRp) fragment from TVX-infected seagrasses. Following validation, we screened 74 opportunistically collected, apparently healthy seagrass samples for potexviruses using this RT-PCR assay. The survey examined the host species T. testudinum, Halodule wrightii, Halophila stipulacea, Syringodium filiforme, Ruppia maritima, and Zostera marina. Potexvirus PCR products were successfully generated only from T. testudinum samples and phylogenetic analysis of sequenced PCR products revealed five distinct TVX sequence variants. Although the RT-PCR assay revealed limited potexvirus diversity in seagrasses, the expanded geographic distribution of TVX shown here emphasizes the importance of future studies to investigate T. testudinum populations across its native range and understand how the observed fine-scale genetic diversity affects host-virus interactions.

Meta-Transcriptomic Analysis Uncovers the Presence of Four Novel Viruses and Multiple Known Virus Genera in a Single Hibiscus rosa-sinensis Plant in Colombia.

Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.

First Report of Pitaya Virus X Infecting Lophocereus schottii f. mieckleyanus (Thin-Stemmed Totem Pole Cactus) in the United States.

Lophocereus is a genus of three species of columnar cacti native to Arizona and Mexico (Lodi, 2015). These cacti produce several tall, ascending, columnar stems that branch at the base in a candelabra-like arrangement. The most common species, L. schottii is known as the senita cactus. Several unusual knobby-stemmed spineless forms of senita cactus have been found in nature in Baja California, Mexico, which are collectively known as totem pole cacti. The thin-stemmed totem pole cactus, L. schottii f. mieckleyanus is an important part of landscapes in southern Arizona. Cacti are clonally propagated which makes viral infections of economic importance in the ornamental/nursery industry. In February 2023, virus-like symptoms, such as mosaic and chlorotic spots were observed on the stems of L. schottii f. mieckleyanus grown in a nursery in Phoenix, AZ, USA. Total RNA was extracted from two symptomatic cacti (YPHC-61 A & B) following the protocol by Tzanetakis et al. (2007), and cDNA was synthesized using the Superscript IV Reverse Transcriptase (Invitrogen, Vilnius, Lithuania). Reverse transcription polymerase chain reaction (RT-PCR) performed with cactus virus X specific primers (Kim et al. 2016) targeting the coat protein (CP) gene failed to generate any amplicon, while potexvirus-replicase primers, Potex 2RC and Potex 5 (van der Vlugt and Berendsen 2002) targeting RNA-dependent RNA polymerase (RdRp) gene amplified an expected amplicon of ~580 bp from both the samples. One of the amplicons was Sanger sequenced and showed 90.7% nucleotide (nt) identity with pitaya virus X (PiVX) in the GenBank (MN982522). Sequence was submitted in the GenBank under the accession number OR425049. PiVX is a new species of the genus Potexvirus and is named after its origin from pitaya (Hylocereus spp.). Further, RT-PCR was conducted with PiVX-specific primers, CP 110F/CP 604R targeting CP gene (Bae and Park 2022) and RdRp gene (RdRp F 5' GCGTGGGCCCTGGAAAA-3'/RdRp R 5' CTAAGATTCATCAATTCACCTCTCC-3') (this study). Amplicons of ~500 and 1100 bp were obtained using primers, CP 110F/CP 604R and RdRp F/RdRp R, respectively. A BLAST search revealed 90.5% nt identity to PiVX CP sequences (OM802135 and OM802134) and 87.3% nt identity to RdRp sequences (MN982523 and LC654699) in the GenBank. Sequences of isolates YPHC-61A and YPHC-61B were submitted in the GenBank under accession numbers, OQ915350 and PP182358 (CP gene) and OQ915351 and PP209539 (RdRp gene). Phylogenetic analysis based on the combined sequence datasets of CP and RdRp genes also grouped YPHC-61A and YPHC-61B with PiVX isolates and separated from other potexviruses species. For a bioassay of the virus, sap extract from symptomatic cactus was mechanically inoculated onto indicator plant species, i.e., beans, alfalfa, and melon. Ten days post- inoculation, chlorotic lesions were observed on beans and alfalfa plants, while melon and mock-inoculated plants did not show any symptoms. Similarly, L. schottii f. mieckleyanus plants grafted with infected cactus showed chlorotic spots after 30 days post grafting. Mechanically inoculated beans, alfalfa, and cactus plants were found to be positive for PiVX based on RT-PCR and Sanger sequencing. PiVX has earlier been detected on Notocactus leninghausii f. cristatus (Park et al. 2018) and dragon fruit (Selenicereus undatus) plants in South Korea (Bae and Park 2022). To our knowledge, this is the first report of PiVX on L. schottii f. mieckleyanus in the United States and worldwide.

The phosphorylation of the movement protein TGBp1 regulates the accumulation of the Bamboo mosaic virus.

Phosphorylation and dephosphorylation of viral movement proteins plays a crucial role in regulating virus movement. Our study focused on investigating the movement protein TGBp1 of Bamboo mosaic virus (BaMV), which is a single-stranded positive-sense RNA virus. Specifically, we examined four potential phosphorylation sites (S15, S18, T58, and S247) within the TGBp1 protein. To study the impact of phosphorylation, we introduced amino acid substitutions at the selected sites. Alanine substitutions were used to prevent phosphorylation, while aspartate substitutions were employed to mimic phosphorylation. Our findings suggest that mimicking phosphorylation at S15, S18 and T58 of TGBp1 might be linked to silencing suppressor activities. The phosphorylated form at these sites exhibits a loss of silencing suppressor activity, leading to reduced viral accumulation in the inoculated leaves. Furthermore, mimicking phosphorylation at residues S15 and S18 could diminish viral accumulation at the single-cell level, while doing so at residue T58 could influence virus movement. However, mimicking phosphorylation at residue S247 does not appear to be relevant to both functions of TGBp1. Overall, our study provides insights into the functional significance of specific phosphorylation sites in BaMV TGBp1, illuminating the regulatory mechanisms involved in virus movement and silencing suppression.

Occurrence, Distribution, and Population Structure of Schlumbergera Virus X in Dragon Fruit in Ecuador.

The occurrence of Schlumbergera virus X (SchVX) in commercial dragon fruit fields in three provinces of Ecuador has been identified in this study. The virus was found in symptomatic and asymptomatic cladodes of the two major species (Hylocereus undatus and H. megalanthus) cultivated in the country. Symptoms in H. undatus included irregular and ring-shaped chlorotic spots that coalesce into large chlorotic patches along the cladodes, whereas small chlorotic spot symptoms on the cladodes were observed in H. megalanthus. Phylogenetic inferences based on 27 partial nucleotide sequences of the RNA-dependent RNA polymerase (RdRp) and three whole genome comparisons showed that Ecuadorean isolates from H. undatus and H. megalanthus share a most recent ancestor with isolates from Spain and Portugal. In addition, an SchVX isolate with a distinct genomic lineage was found in symptomatic H. polyrhizus plants from a single location, suggesting two independent virus introductions into the country.

Interaction of EXA1 and eIF4E Family Members Facilitates Potexvirus Infection in Arabidopsis thaliana.

Plant viruses depend on a number of host factors for successful infection. Deficiency of critical host factors confers recessively inherited viral resistance in plants. For example, loss of Essential for poteXvirus Accumulation 1 (EXA1) in Arabidopsis thaliana confers resistance to potexviruses. However, the molecular mechanism of how EXA1 assists potexvirus infection remains largely unknown. Previous studies reported that the salicylic acid (SA) pathway is upregulated in exa1 mutants, and EXA1 modulates hypersensitive response-related cell death during EDS1-dependent effector-triggered immunity. Here, we show that exa1-mediated viral resistance is mostly independent of SA and EDS1 pathways. We demonstrate that Arabidopsis EXA1 interacts with three members of the eukaryotic translation initiation factor 4E (eIF4E) family, eIF4E1, eIFiso4E, and novel cap-binding protein (nCBP), through the eIF4E-binding motif (4EBM). Expression of EXA1 in exa1 mutants restored infection by the potexvirus Plantago asiatica mosaic virus (PlAMV), but EXA1 with mutations in 4EBM only partially restored infection. In virus inoculation experiments using Arabidopsis knockout mutants, EXA1 promoted PlAMV infection in concert with nCBP, but the functions of eIFiso4E and nCBP in promoting PlAMV infection were redundant. By contrast, the promotion of PlAMV infection by eIF4E1 was, at least partially, EXA1 independent. Taken together, our results imply that the interaction of EXA1-eIF4E family members is essential for efficient PlAMV multiplication, although specific roles of three eIF4E family members in PlAMV infection differ. IMPORTANCE The genus Potexvirus comprises a group of plant RNA viruses, including viruses that cause serious damage to agricultural crops. We previously showed that loss of Essential for poteXvirus Accumulation 1 (EXA1) in Arabidopsis thaliana confers resistance to potexviruses. EXA1 may thus play a critical role in the success of potexvirus infection; hence, elucidation of its mechanism of action is crucial for understanding the infection process of potexviruses and for effective viral control. Previous studies reported that loss of EXA1 enhances plant immune responses, but our results indicate that this is not the primary mechanism of exa1-mediated viral resistance. Here, we show that Arabidopsis EXA1 assists infection by the potexvirus Plantago asiatica mosaic virus (PlAMV) by interacting with the eukaryotic translation initiation factor 4E family. Our results imply that EXA1 contributes to PlAMV multiplication by regulating translation.

Engineering aphid transmission of foxtail mosaic virus in the presence of potyvirus helper component proteinase through coat protein modifications.

Biotechnologies that use plant viruses as plant enhancement tools have shown great potential to flexibly engineer crop traits, but field applications of these technologies are still limited by efficient dissemination methods. Potyviruses can be rapidly inoculated into plants by aphid vectors due to the presence of the potyviral helper component proteinase (HC-Pro), which binds to the DAG motif of the coat protein (CP) of the virion. Previously it was determined that a naturally occurring DAG motif in the non-aphid-transmissible potexvirus, potato aucuba mosaic virus (PAMV), is functional when a potyviral HC-Pro is provided to aphids in plants. The DAG motif of PAMV was successfully transferred to the CP of another non-aphid-transmissible potexvirus, potato virus X, to convey aphid transmission capabilities in the presence of HC-Pro. Here, we demonstrate that DAG-containing segments of the CP from two different potyviruses (sugarcane mosaic virus and turnip mosaic virus), and from the previously used potexvirus, PAMV, can make the potexvirus, foxtail mosaic virus (FoMV), aphid-transmissible when fused with the FoMV CP. We show that DAG-containing FoMVs are transmissible by aphids that have prior access to HC-Pro through potyvirus-infected plants or ectopic expression of HC-Pro. The transmission efficiency of the DAG-containing FoMVs varied from less than 10 % to over 70 % depending on the length and composition of the surrounding amino acid sequences of the DAG-containing segment, as well as due to the recipient plant species. Finally, we show that the engineered aphid-transmissible FoMV is still functional as a plant enhancement resource, as endogenous host target genes were silenced in FoMV-infected plants after aphid transmission. These results suggest that aphid transmission could be engineered into non-aphid-transmissible plant enhancement viral resources to facilitate their field applications.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Tomato SlGSTU38 interacts with the PepMV coat protein and promotes viral infection.

Pepino mosaic virus (PepMV) is pandemic in tomato crops, causing important economic losses world-wide. No PepMV-resistant varieties have been developed yet. Identification of host factors interacting with PepMV proteins is a promising source of genetic targets to develop PepMV-resistant varieties. The interaction between the PepMV coat protein (CP) and the tomato glutathione S-transferase (GST) SlGSTU38 was identified in a yeast two-hybrid (Y2H) screening and validated by directed Y2H and co-immunoprecipitation assays. SlGSTU38-knocked-out Micro-Tom plants (gstu38) generated by the CRISPR/Cas9 technology together with live-cell imaging were used to understand the role of SlGSTU38 during infection. The transcriptomes of healthy and PepMV-infected wild-type (WT) and gstu38 plants were profiled by RNA-seq analysis. SlGSTU38 functions as a PepMV-specific susceptibility factor in a cell-autonomous manner and relocalizes to the virus replication complexes during infection. Besides, knocking out SlGSTU38 triggers reactive oxygen species accumulation in leaves and the deregulation of stress-responsive genes. SlGSTU38 may play a dual role: On the one hand, SlGSTU38 may exert a proviral function depending on its specific interaction with the PepMV CP; and on the other hand, SlGSTU38 may delay PepMV-infection sensing by participating in the redox intracellular homeostasis in a nonspecific manner.

An Unwanted Association: The Threat to Papaya Crops by a Novel Potexvirus in Northwest Argentina.

An emerging virus isolated from papaya (Carica papaya) crops in northwestern (NW) Argentina was sequenced and characterized using next-generation sequencing. The resulting genome is 6667-nt long and encodes five open reading frames in an arrangement typical of other potexviruses. This virus appears to be a novel member within the genus Potexvirus. Blast analysis of RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes showed the highest amino acid sequence identity (67% and 71%, respectively) with pitaya virus X. Based on nucleotide sequence similarity and phylogenetic analysis, the name papaya virus X is proposed for this newly characterized potexvirus that was mechanically transmitted to papaya plants causing chlorotic patches and severe mosaic symptoms. Papaya virus X (PapVX) was found only in the NW region of Argentina. This prevalence could be associated with a recent emergence or adaptation of this virus to papaya in NW Argentina.

First Report of the Association of Zygocactus virus X with Dragon Fruit (Hylocereus spp.) plants from Telangana, India.

Dragon fruit (Hylocereus spp.) a member of the family Cactaceae, is widely cultivated throughout the world, includingspan style="font-family:'Times New Roman'; letter-spacing:0.05pt; color:#333333"> India. During 2020-2021 crop growing season, mosaic symptoms were observed on the cladodes of dragon fruit plants (Purple Pink cultivar: 1-2% disease incidence) grown at a farmer's field of Telangana, India (Fig. S1 a). The symptomatic cladodes (n= 4), observed under leaf-dip electron microscopy (Zuchmaan and Zellnig, 2009) at Indian Agricultural Research Institute, New Delhi, revealed the presence of flexuous rod- shaped virus-like particles (Fig S1 b). Virus particles were of 580 x 13 nm size, corresponding to the genus Potexvirus. For further confirmation, the total RNA isolated from symptomatic cladodes using a NucleoSpin RNA Plant Mini kit (Macherey-Nagel). Subsequently, a reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). The cDNA was further amplified with the primers specific to coat protein (CP) gene of four different species of the genus Potexvirus known to infect members of Cactaceae family. Four sets of primers were used for detection, viz., Cactus virus X (CVX) (F, 5'-ATGTCTACTACTGGAGTCCA-3'; R, 5'-CTACTCAGGGCCTGGGAGAA-3'); Pitaya virus X (PiVX) (F, 5'-ATGGCTACTCAAACAGCACAA-3'; R, 5'-CTACTCTGGGGAGGGAAG-3'); Schlumbergera virus X (SchVX) (F, 5'-ATGTCGACCACTCCATCTTC-3'; R, 5'-TTATTCAGGGGATGGTAGTA-3') and Zygocactus virus X (ZyVX) (F, 5'-ATGTCTAACACTGCAGGAGT-3'; R, TCATTC GGGACCCGGTAGGA-3') (Duarte et al., 2008; Janssen et al., 2021; Parameswari et al., 2021), by following the PCR profile (Park et al., 2018). The species-specific primers of CVX, PiVX and SchVX did not amplify any amplicon, whereas the primers specific to ZyVX at nucleotide position 5841-6521 from complete CP gene have resulted in amplification of expected size (~680 base pairs) from all the samples. The gel-purified RT-PCR products were cloned into a pDrive cloning vector (Qiagen, Germany) and sequenced bi-directionally using Sanger sequencing. The resultant sequences (681 nt) of the CP gene showed 98% (nucleotide) and 100% (amino acid) sequence similarity with the CP gene sequence (Accession No: KY581590) of ZyVX. Hence, one representative sequence was deposited to the NCBI GenBank database as ZyVX-DPC isolate (Accession number- OK415019). The Neighbour Joining Phylogenetic Tree constructed using MEGA6 software (Tamura et al. 2013) showed grouping of Indian ZyVX-DPC isolate with the previously reported ZyVX isolates from Korea, Taiwan, China and Germany (Fig. S1c). These results confirmed the association of ZyVX with the symptomatic cladodes of dragon fruit plants collected from Telangana, India. Earlier studies revealed that ZyVX is a member of the genus Potexvirus known to infect dragon fruit plants from Brazil and China (Duarte et al., 2008). In India until now, anthracnose disease (Colletotrichum siamense) and CVX from Hylocereus spp. were reported (Abirami et al., 2019; Parameswari et al., 2021). To the best of our knowledge, this is the first report of ZyVX infection on dragon fruit in India. The draon fruit, being vegetatively propagated and with increasing cultivable area in India (Abirami et al, 2019), the present study gains significance. Further studies on mode of virus transmission, estimation of crop yield losses, host range studies and finding out source of resistance are essential.

NbNAC42 and NbZFP3 Transcription Factors Regulate the Virus Inducible NbAGO5 Promoter in Nicotiana benthamiana.

Plant argonautes (AGOs) play important roles in the defense responses against viruses. The expression of Nicotiana benthamiana AGO5 gene (NbAGO5) is highly induced by Bamboo mosaic virus (BaMV) infection; however, the underlying mechanisms remain elusive. In this study, we have analyzed the potential promoter activities of NbAGO5 and its interactions with viral proteins by using a 2,000 bp fragment, designated as PN1, upstream to the translation initiation of NbAGO5. PN1 and seven serial 5'-deletion mutants (PN2-PN8) were fused with a ß-glucuronidase (GUS) reporter and introduced into the N. benthamiana genome by Agrobacterium-mediated transformation for further characterization. It was found that PN4-GUS transgenic plants were able to drive strong GUS expression in the whole plant. In the virus infection tests, the GUS activity was strongly induced in PN4-GUS transgenic plants after being challenged with potexviruses. Infiltration of the transgenic plants individually with BaMV coat protein (CP) or triple gene block protein 1 (TGBp1) revealed that only TGBp1 was crucial for inducing the NbAGO5 promoter. To identify the factors responsible for controlling the activity of the NbAGO5 promoter, we employed yeast one-hybrid screening on a transcription factor cDNA library. The result showed that NbNAC42 and NbZFP3 could directly bind the 704 bp promoter regions of NbAGO5. By using overexpressing and virus-induced gene silencing techniques, we found that NbNAC42 and NbZFP3 regulated and downregulated, respectively, the expression of the NbAGO5 gene. Upon virus infection, NbNAC42 played an important role in regulating the expression of NbAGO5. Together, these results provide new insights into the modulation of the defense mechanism of N. benthamiana against viruses. This virus inducible promoter could be an ideal candidate to drive the target gene expression that could improve the anti-virus abilities of crops in the future.

Transcriptome analyses unveiled differential regulation of AGO and DCL genes by pepino mosaic virus strains.

Pepino mosaic virus (PepMV) is a single-stranded (ss), positive-sense (+) RNA potexvirus that affects tomato crops worldwide. We have described an in planta antagonistic interaction between PepMV isolates of two strains in which the EU isolate represses the accumulation of the CH2 isolate during mixed infections. Reports describing transcriptomic responses to mixed infections are scant. We carried out transcriptomic analyses of tomato plants singly and mixed-infected with two PepMV isolates of both strains. Comparison of the transcriptomes of singly infected plants showed that deeper transcriptomic alterations occurred at early infection times, and also that each of the viral strains modulated the host transcriptome differentially. Mixed infections caused transcriptomic alterations similar to those for the sum of single infections at early infection times, but clearly differing at later times postinfection. We next tested the hypothesis that PepMV-EU, in either single or mixed infections, deregulates host gene expression differentially so that virus accumulation of both strains gets repressed. That seemed to be the case for the genes AGO1a, DCL2d, AGO2a, and DCL2b, which are involved in the antiviral silencing pathway and were upregulated by PepMV-EU but not by PepMV-CH2 at early times postinfection. The pattern of AGO2a expression was validated by reverse transcription-quantitative PCR in tomato and Nicotiana benthamiana plants. Using an N. benthamiana ago2 mutant line, we showed that AGO2 indeed plays an important role in the antiviral defence against PepMV, but it is not the primary determinant of the outcome of the antagonistic interaction between the two PepMV strains.

First Report of Distinct Bamboo mosaic virus (BaMV) Isolates Infecting Bambusa funghomii in Vietnam and the Identification of a Highly Variable Region in the BaMV Genome.

New isolates of the Bamboo mosaic virus (BaMV) were identified in Bambusa funghomii bamboo in Vietnam. Sequence analyses revealed that the Vietnam isolates are distinct from all known BaMV strains, sharing the highest sequence identities (about 77%) with the Yoshi isolates reported in California, USA. Unique satellite RNAs were also found to be associated with the BaMV Vietnam isolates. A possible recombination event was detected in the genome of BaMV-VN2. A highly variable region was identified in the ORF1 gene, in between the methyl transferase domain and helicase domain. These results revealed the presence of unique BaMV isolates in an additional bamboo species in one more country, Vietnam, and provided evidence in support of the possible involvement of environmental or host factors in the diversification and evolution of BaMV.

Short 5' Untranslated Region Enables Optimal Translation of Plant Virus Tricistronic RNA via Leaky Scanning.

Regardless of the general model of translation in eukaryotic cells, a number of studies suggested that many mRNAs encode multiple proteins. Leaky scanning, which supplies ribosomes to downstream open reading frames (ORFs) by readthrough of upstream ORFs, has great potential to translate polycistronic mRNAs. However, the mRNA elements controlling leaky scanning and their biological relevance have rarely been elucidated, with exceptions such as the Kozak sequence. Here, we have analyzed the strategy of a plant RNA virus to translate three movement proteins from a single RNA molecule through leaky scanning. The in planta and in vitro results indicate thatthe significantly shorter 5' untranslated region (UTR) of the most upstream ORF promotes leaky scanning, potentially fine-tuning the translation efficiency of the three proteins in a single RNA molecule to optimize viral propagation. Our results suggest that the remarkably short length of the leader sequence, like the Kozak sequence, is a translational regulatory element with a biologically important role, as previous studies have shown biochemically. IMPORTANCEPotexvirus, a group of plant viruses, infect a variety of crops, including cultivated crops. It has been thought that the three transition proteins that are essential for the cell-to-cell transfer of potexviruses are translated from two subgenomic RNAs, sgRNA1 and sgRNA2. However, sgRNA2 has not been clearly detected. In this study, we have shown that sgRNA1, but not sgRNA2, is the major translation template for the three movement proteins. In addition, we determined the transcription start site of sgRNA1 in flexiviruses and found that the efficiency of leaky scanning caused by the short 5' UTR of sgRNA1, a widely conserved feature, regulates the translation of the three movement proteins. When we tested the infection of viruses with mutations introduced into the length of the 5' UTR, we found that the movement efficiency of the virus was affected. Our results provide important additional information on the protein translation strategy of flexiviruses, including Potexvirus, and provide a basis for research on their control as well as the need to reevaluate the short 5' UTR as a translational regulatory element with an important role in vivo.

One-Enzyme RTX-PCR for the Detection of RNA Viruses from Multiple Virus Genera and Crop Plants.

Reverse transcription PCR (RT-PCR) is a popular method for detecting RNA viruses in plants. RT-PCR is usually performed in a classical two-step procedure: in the first step, cDNA is synthesized by reverse transcriptase (RT), followed by PCR amplification by a thermostable polymerase in a separate tube in the second step. However, one-step kits containing multiple enzymes optimized for RT and PCR amplification in a single tube can also be used. Here, we describe an RT-PCR single-enzyme assay based on an RTX DNA polymerase that has both RT and polymerase activities. The expression plasmid pET_RTX_(exo-) was transferred to various E. coli genotypes that either compensated for codon bias (Rosetta-gami 2) or contained additional chaperones to promote solubility (BL21 (DE3) with plasmids pKJE8 or pTf2). The RTX enzyme was then purified and used for the RT-PCR assay. Several purified plant viruses (TMV, PVX, and PVY) were used to determine the efficiency of the assay compared to a commercial one-step RT-PCR kit. The RT-PCR assay with the RTX enzyme was validated for the detection of viruses from different genera using both total RNA and crude sap from infected plants. The detection endpoint of RTX-PCR for purified TMV was estimated to be approximately 0.01 pg of the whole virus per 25 µL reaction, corresponding to 6 virus particles/µL. Interestingly, the endpoint for detection of TMV from crude sap was also 0.01 pg per reaction in simulated crude plant extracts. The longest RNA fragment that could be amplified in a one-tube arrangement was 2379 bp long. The longest DNA fragment that could be amplified during a 10s extension was 6899 bp long. In total, we were able to detect 13 viruses from 11 genera using RTX-PCR. For each virus, two to three specific fragments were amplified. The RT-PCR assay using the RTX enzyme described here is a very robust, inexpensive, rapid, easy to perform, and sensitive single-enzyme assay for the detection of plant viruses.

Potato virus X: A global potato-infecting virus and type member of the Potexvirus genus.

TAXONOMY: Potato virus X is the type-member of the plant-infecting Potexvirus genus in the family Alphaflexiviridae. PHYSICAL PROPERTIES: Potato virus X (PVX) virions are flexuous filaments 460-480 nm in length. Virions are 13 nm in diameter and have a helical pitch of 3.4 nm. The genome is approximately 6.4 kb with a 5' cap and 3' poly(A) terminus. PVX contains five open reading frames, four of which are essential for cell-to-cell and systemic movement. One protein encodes the viral replicase. Cellular inclusions, known as X-bodies, occur near the nucleus of virus-infected cells. HOSTS: The primary host is potato, but it infects a wide range of dicots. Diagnostic hosts include Datura stramonium and Nicotiana tabacum. PVX is transmitted in nature by mechanical contact. USEFUL WEBSITE: https://talk.ictvonline.org/ictv-reports/ictv_online_report/positive-sense-rna-viruses/w/alphaflexiviridae/1330/genus-potexvirus.

Effects of Poty-Potexvirus Synergism on Growth, Photosynthesis and Metabolite Status of Nicotiana benthamiana.

Mixed virus infections threaten crop production because interactions between the host and the pathogen mix may lead to viral synergism. While individual infections by potato virus A (PVA), a potyvirus, and potato virus X (PVX), a potexvirus, can be mild, co-infection leads to synergistic enhancement of PVX and severe symptoms. We combined image-based phenotyping with metabolite analysis of single and mixed PVA and PVX infections and compared their effects on growth, photosynthesis, and metabolites in Nicotiana benthamiana. Viral synergism was evident in symptom severity and impaired growth in the plants. Indicative of stress, the co-infection increased leaf temperature and decreased photosynthetic parameters. In contrast, singly infected plants sustained photosynthetic activity. The host's metabolic response differed significantly between single and mixed infections. Over 200 metabolites were differentially regulated in the mixed infection: especially defense-related metabolites and aromatic and branched-chain amino acids increased compared to the control. Changes in the levels of methionine cycle intermediates and a low S-adenosylmethionine/S-adenosylhomocysteine ratio suggested a decline in the methylation potential in co-infected plants. The decreased ratio between reduced glutathione, an important scavenger of reactive oxygen species, and its oxidized form, indicated that severe oxidative stress developed during co-infection. Based on the results, infection-associated oxidative stress is successfully controlled in the single infections but not in the synergistic infection, where activated defense pathways are not sufficient to counter the impact of the infections on plant growth.