Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 82
Filtrar
1.
J Genet Eng Biotechnol ; 22(3): 100398, 2024 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-39179326

RESUMO

BACKGROUND: Enteric avian rotavirus (ARV) is the etiological agent of several health problems that pose a global threat to commercial chickens. Therefore, to avoid these widespread epidemics and high mortality rates, only vaccine and strict biosecurity are required. METHOD: The present study employs computational techniques to design a unique multi-epitope-based vaccine candidate that successfully activates immune cells against the ARV by combining adjuvant, linker, and B and T-cell epitopes. Starting, homologous sequences in the various ARV serotypes were revealed in the NCBI BLAST database, and then the two surface proteins (VP4 and VP7) of the ARV were retrieved from the UniprotKB database. The Clustal Omega server was then used to identify the conserved regions among the homologous sequences, and the B and T-cell epitopes were predicted using IEDB servers. Then, superior epitopes-2 MHC-1 epitopes, 2 MHC-2 epitopes, and 3B-cell epitopes-were combined with various adjuvants to create a total of four unique vaccine candidates. Afterward, the designed vaccine candidates underwent computational validation to assess their antigenicity, allergenicity, and stability. The vaccine candidate (V2) that demonstrated non-antigenicity, a high VaxiJen score, and non-allergenicity was ultimately chosen for molecular docking and dynamic simulation. RESULTS: Although the V2 and V4 vaccine candidates were highly immunogenic, V2 had a higher solubility rate. The predicted values of the aliphatic index and GRAVY value were 30.4 and 0.417, respectively. In terms of binding energy, V2 outperformed V4. Being successfully docked with TLRs, V2 was praised as the finest. After adaptation, the sequence's 50.73 % GC content outside of the BglII or ApaI restriction sites indicated that it was equivalently safe to clone. The chosen sequence was then inserted into the pET28a(+) vector within the BglII and ApaI restriction sites. This resulted in a final clone that was 4914 base pairs long, with the inserted sequence accounting for 478 bp and the vector accounting for the remainder. CONCLUSIONS: The immune-mediated simulation results for the selected vaccine construct showed significant response; thus, the study confirmed that the selected V2 vaccine candidate could enhance the immune response against ARV.

2.
J Invertebr Pathol ; 204: 108118, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38679369

RESUMO

Portunid crabs are distributed worldwide and highly valued in aquaculture. Viral infections are the main limiting factor for the survival of these animals and, consequently, for the success of commercial-scale cultivation. However, there is still a lack of knowledge about the viruses that infect cultured portunid crabs worldwide. Herein, the genome sequence and phylogeny of Callinectes sapidus reovirus 2 (CsRV2) are described, and the discovery of a new bunyavirus in Callinectes danae cultured in southern Brazil is reported. The CsRV2 genome sequence consists of 12 dsRNA segments (20,909 nt) encode 13 proteins. The predicted RNA-dependent RNA polymerase (RdRp) shows a high level of similarity with that of Eriocheir sinensis reovirus 905, suggesting that CsRV2 belongs to the genus Cardoreovirus. The CsRV2 particles are icosahedral, measuring approximately 65 nm in diameter, and exhibit typical non-turreted reovirus morphology. High throughput sequencing data revealed the presence of an additional putative virus genome similar to bunyavirus, called Callinectes danae Portunibunyavirus 1 (CdPBV1). The CdPBV1 genome is tripartite, consisting of 6,654 nt, 3,120 nt and 1,656 nt single-stranded RNA segments that each encode a single protein. Each segment has a high identity with European shore crab virus 1, suggesting that CdPBV1 is a new representative of the family Cruliviridae. The putative spherical particles of CdPBV1 measure ∼120 nm in diameter and present a typical bunyavirus morphology. The results of the histopathological analysis suggest that these new viruses can affect the health and, consequently, the survival of C. danae in captivity. Therefore, the findings reported here should be used to improve prophylactic and pathogen control practices and contribute to the development and optimization of the production of soft-shell crabs on a commercial scale in Brazil.


Assuntos
Braquiúros , Genoma Viral , Filogenia , Reoviridae , Animais , Braquiúros/virologia , Reoviridae/genética , Reoviridae/classificação , Orthobunyavirus/genética , Aquicultura
3.
Front Cell Infect Microbiol ; 14: 1327780, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38505291

RESUMO

Tibet orbivirus (TIBOV) was first isolated from Anopheles maculatus mosquitoes in Xizang, China, in 2009. In recent years, more TIBOV strains have been isolated in several provinces across China, Japan, East Asia, and Nepal, South Asia. Furthermore, TIBOVs have also been isolated from Culex mosquitoes, and several midge species. Additionally, TIBOV neutralizing antibodies have been detected in serum specimens from several mammals, including cattle, sheep, and pigs. All of the evidence suggests that the geographical distribution of TIBOVs has significantly expanded in recent years, with an increased number of vector species involved in its transmission. Moreover, the virus demonstrated infectivity towards a variety of animals. Although TIBOV is considered an emerging orbivirus, detailed reports on its genome and molecular evolution are currently lacking. Thus, this study performed the whole-genome nucleotide sequencing of three TIBOV isolates from mosquitoes and midges collected in China in 2009, 2011, and 2019. Furthermore, the genome and molecular genetic evolution of TIBOVs isolated from different countries, periods, and hosts (mosquitoes, midges, and cattle) was systematically analyzed. The results revealed no molecular specificity among TIBOVs isolated from different countries, periods, and vectors. Meanwhile, the time-scaled phylogenetic analysis demonstrated that the most recent common ancestor (TMRCA) of TIBOV appeared approximately 797 years ago (95% HPD: 16-2347) and subsequently differentiated at least three times, resulting in three distinct genotypes. The evolutionary rate of TIBOVs was about 2.12 × 10-3 nucleotide substitutions per site per year (s/s/y) (95% HPD: 3.07 × 10-5, 9.63 × 10-3), which is similar to that of the bluetongue virus (BTV), also in the Orbivirus genus. Structural analyses of the viral proteins revealed that the three-dimensional structures of the outer capsid proteins of TIBOV and BTV were similar. These results suggest that TIBOV is a newly discovered and rapidly evolving virus transmitted by various blood-sucking insects. Given the potential public health burden of this virus and its high infectious rate in a wide range of animals, it is significant to strengthen research on the genetic variation of TIBOVs in blood-feeding insects and mammals in the natural environment and the infection status in animals.


Assuntos
Anopheles , Orbivirus , Infecções por Reoviridae , Bovinos , Animais , Ovinos/genética , Suínos , Orbivirus/genética , Tibet , Filogenia , Mosquitos Vetores , Mamíferos/genética , Nucleotídeos , Genoma Viral , Infecções por Reoviridae/veterinária , Infecções por Reoviridae/genética
4.
Epidemiologia (Basel) ; 5(1): 90-105, 2024 Feb 20.
Artigo em Inglês | MEDLINE | ID: mdl-38390919

RESUMO

Epizootic hemorrhagic disease (EHD) is an infectious, non-contagious viral disease seriously affecting cattle and some wild ruminants and has a worldwide distribution. All viruses can be subdivided into "Eastern" and "Western" topotypes according to geographic distribution via the phylogenetic analysis of internal genes. In Israel, during the last decade, three outbreaks were registered: caused by EHDV-6 in 2015, by EHDV-1 in 2016, and by EHDV-7 in 2020. Additionally, RNA of EHDV-8 was found in imported calves from Portugal in 2023. During the same period in other countries of the region, non-Israeli-like EHDV-6 and EHDV-8 were identified. Full genome sequencing, BLAST, and phylogenetic analyses of the locally and globally known EHDV genomes allowed us to presume the probable route and origin of these viruses detected in Israel. Thus, EHDV-6 has probably been circulating in the region for a long period when EHDV-1 and -8 appeared here for the last years, while their route of introduction into the new areas was probably natural; all of them belonged to the "Western" topotype. In contrast, EHDV-7 probably had the "Eastern", anthropogenic origin. Data from the study can facilitate the evaluation of the appearance or reappearance of EHDVs in the Mediterranean area and enhance the planning of prevention measures.

5.
Microbiol Spectr ; 11(3): e0385522, 2023 06 15.
Artigo em Inglês | MEDLINE | ID: mdl-37154690

RESUMO

Now more than ever researchers provide more and more evidence that it is necessary to develop an ecologically friendly approach to pest control. This is reflected in a sharp increase in the value of the biological insecticide market in recent decades. In our study, we found a virus strain belonging to the genus Cypovirus (Reoviridae); the strain was isolated from Dendrolimus sibiricus, possessing attractive features as a candidate for mass production of biological agents for lepidopteran-pest control. We describe the morphological, molecular, and ecological features of the new Cypovirus strain. This strain was found to be highly virulent to D. sibiricus (the half-lethal dose is 25 occlusion bodies per second-instar larva) and to have a relatively wide host range (infecting representatives of five families of Lepidoptera: Erebidae, Sphingidae, Pieridae, Noctuidae, and Lasiocampidae). The virus strain showed a strong interaction with a nontoxic adjuvant (optical brightener), which decreased the lethal dose for both main and alternative hosts, decreased lethal time, and may expand the host range. Moreover, we demonstrated that the insecticidal features were preserved after passaging through the most economically suitable host. By providing strong arguments for the possible use of this strain in pest control, we call on virologists, pest control specialists, and molecular biologists to give more attention to the Cypovirus genus, which may lead to new insights in the field of pest control research and may provide significant advantages to compare with baculoviruses and Bacillus thuringiensis products which are nowadays main source of bioinsecticides. IMPORTANCE In this article, we describe a newly discovered cypovirus strain that displays features ideally suited for the development of a modern biological insecticide: high potency, relatively broad host range, true regulating effect, flexible production (possibility to choose host species for production), interaction with enhancing adjuvants, and ecologically friendly. Based on an alignment of CPV genomes, we suggest that the enhanced host range of this new strain is the sequence of evolutionary events that occurred after coinfections involving different CPV species within the same host. These findings suggest that we need to positively reconsider CPVs as prospective agents as biocontrol products.


Assuntos
Inseticidas , Mariposas , Reoviridae , Animais , Inseticidas/farmacologia , Estudos Prospectivos , Controle de Pragas
6.
Plant Dis ; 2023 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-36856654

RESUMO

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

7.
Cell Host Microbe ; 31(4): 604-615.e4, 2023 04 12.
Artigo em Inglês | MEDLINE | ID: mdl-36996819

RESUMO

Rotavirus assembly is a complex process that involves the stepwise acquisition of protein layers in distinct intracellular locations to form the fully assembled particle. Understanding and visualization of the assembly process has been hampered by the inaccessibility of unstable intermediates. We characterize the assembly pathway of group A rotaviruses observed in situ within cryo-preserved infected cells through the use of cryoelectron tomography of cellular lamellae. Our findings demonstrate that the viral polymerase VP1 recruits viral genomes during particle assembly, as revealed by infecting with a conditionally lethal mutant. Additionally, pharmacological inhibition to arrest the transiently enveloped stage uncovered a unique conformation of the VP4 spike. Subtomogram averaging provided atomic models of four intermediate states, including a pre-packaging single-layered intermediate, the double-layered particle, the transiently enveloped double-layered particle, and the fully assembled triple-layered virus particle. In summary, these complementary approaches enable us to elucidate the discrete steps involved in forming an intracellular rotavirus particle.


Assuntos
Rotavirus , Rotavirus/fisiologia , Tomografia , Montagem de Vírus
8.
Microorganisms ; 11(2)2023 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-36838331

RESUMO

Israel is endemic to bluetongue virus (BTV). The introduction of novel-for-the-region arboviruses have been recorded annually in recent years. In 2019, previously non-reported in-the-country BTV-1 and BTV-9 were identified. BTV-1 caused a single-season outbreak, probably linked to mild infection in ruminants. BTV-9 was retrospectively detected in the field samples collected from August 2018 until 2020. It was the dominant serotype in 2019, out of the six serotypes recorded during that calendar year. Clinical manifestation of the disease in cases diagnosed with BTV-9 were compared to those in cases determined to have BTV-1. BLAST and phylogenetic analyses of BTV-1 showed that the nucleotide (nt) sequence coding the viral outer protein 1 (VP2) determining the serotype is closely related to BTV-1 isolated in Sudan in 1987, and the coding sequence of the outer protein 2 (VP5) is related to South African BTV-1 from 2017. A probable common ancestor with Libyan BTV-9 strains isolated in 2008 was seen in an analysis of Israeli BTV-9 nt sequences. Notably, the outbreak-caused BTV-9 strains collected in 2019 exhibited a distinct level of genetic reassortment with local Israeli strains compared to BTV-9 strains registered in 2018 and 2020.

9.
Subcell Biochem ; 99: 525-552, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36151388

RESUMO

The members of the family Reoviridae (reoviruses) consist of 9-12 discrete double-stranded RNA (dsRNA) segments enclosed by single, double, or triple capsid layers. The outer capsid proteins of reoviruses exhibit the highest diversity in both sequence and structural organization. By contrast, the conserved RNA-dependent RNA polymerase (RdRp) structure in the conserved innermost shell in all reoviruses suggests that they share common transcriptional regulatory mechanisms. After reoviruses are delivered into the cytoplasm of a host cell, their inner capsid particles (ICPs) remain intact and serve as a stable nanoscale machine for RNA transcription and capping performed using enzymes in ICPs. Advances in cryo-electron microscopy have enabled the reconstruction at near-atomic resolution of not only the icosahedral capsid, including capping enzymes, but also the nonicosahedrally distributed complexes of RdRps within the capsid at different transcriptional stages. These near-atomic resolution structures allow us to visualize highly coordinated structural changes in the related enzymes, genomic RNA, and capsid protein during reovirus transcription. In addition, reoviruses encode their own enzymes for nascent RNA capping before RNA releasing from their ICPs.


Assuntos
Reoviridae , Capsídeo/metabolismo , Proteínas do Capsídeo/química , Microscopia Crioeletrônica , RNA de Cadeia Dupla/metabolismo , RNA Viral/genética , RNA Viral/metabolismo , RNA Polimerase Dependente de RNA/genética , Reoviridae/genética , Reoviridae/metabolismo
10.
Viruses ; 13(12)2021 11 26.
Artigo em Inglês | MEDLINE | ID: mdl-34960644

RESUMO

Members of the Lipopteninae subfamily are blood-sucking ectoparasites of mammals. The sheep ked (Melophagus ovinus) is a widely distributed ectoparasite of sheep. It can be found in most sheep-rearing areas and can cause skin irritation, restlessness, anemia, weight loss and skin injuries. Various bacteria and some viruses have been detected in M. ovinus; however, the virome of this ked has never been studied using modern approaches. Here, we study the virome of M. ovinus collected in the Republic of Tuva, Russia. In our research, we were able to assemble full genomes for five novel viruses, related to the Rhabdoviridae (Sigmavirus), Iflaviridae, Reoviridae and Solemoviridae families. Four viruses were found in all five of the studied pools, while one virus was found in two pools. Phylogenetically, all of the novel viruses clustered together with various recently described arthropod viruses. All the discovered viruses were tested on their ability to replicate in the mammalian porcine embryo kidney (PEK) cell line. Aksy-Durug Melophagus sigmavirus RNA was detected in the PEK cell line cultural supernate after the first, second and third passages. Such data imply that this virus might be able to replicate in mammalian cells, and thus, can be considered as a possible arbovirus.


Assuntos
Arbovírus/genética , Dípteros/virologia , Ectoparasitoses/virologia , Doenças dos Ovinos/parasitologia , Viroma , Animais , Arbovírus/isolamento & purificação , Linhagem Celular , Filogenia , Reoviridae , Rhabdoviridae , Federação Russa , Ovinos
11.
Proc Natl Acad Sci U S A ; 118(42)2021 10 19.
Artigo em Inglês | MEDLINE | ID: mdl-34635593

RESUMO

The family Reoviridae is a nonenveloped virus group with a double-stranded (ds) RNA genome comprising 9 to 12 segments. In the family Reoviridae, the genera Cardoreovirus, Phytoreovirus, Seadornavirus, Mycoreovirus, and Coltivirus contain virus species having 12-segmented dsRNA genomes. Reverse genetics systems used to generate recombinant infectious viruses are powerful tools for investigating viral gene function and for developing vaccines and therapeutic interventions. Generally, this methodology has been utilized for Reoviridae viruses such as Orthoreovirus, Orbivirus, Cypovirus, and Rotavirus, which have genomes with 10 or 11 segments, respectively. However, no reverse genetics system has been developed for Reoviridae viruses with a genome harboring 12 segments. Herein, we describe development of an entire plasmid-based reverse genetics system for Tarumizu tick virus (TarTV) (genus Coltivirus, family Reoviridae), which has a genome of 12 segments. Recombinant TarTVs were generated by transfection of 12 cloned complementary DNAs encoding the TarTV genome into baby hamster kidney cells expressing T7 RNA polymerase. Using this technology, we generated VP12 mutant viruses and demonstrated that VP12 is an N-glycosylated protein. We also generated a reporter virus expressing the HiBiT-tagged VP8 protein. This reverse genetics system will increase our understanding of not only the biology of the genus Coltivirus but also the replication machinery of the family Reoviridae.


Assuntos
Plasmídeos , Reoviridae/genética , Animais , Cricetinae , Genoma Viral , Glicosilação , Mutação , Vírus Reordenados/genética
12.
Virus Evol ; 7(2): veab085, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34703624

RESUMO

Proactive approaches in preventing future epidemics include pathogen discovery prior to their emergence in human and/or animal populations. Playing an important role in pathogen discovery, high-throughput sequencing (HTS) enables the characterization of microbial and viral genetic diversity within a given sample. In particular, metagenomic HTS allows the unbiased taxonomic profiling of sequences; hence, it can identify novel and highly divergent pathogens such as viruses. Newly discovered viral sequences must be further investigated using genomic characterization, molecular and serological screening, and/or in vitro and in vivo characterization. Several outbreak and surveillance studies apply unbiased generic HTS to characterize the whole genome sequences of suspected pathogens. In contrast, this study aimed to screen for novel and unexpected pathogens in previously generated HTS datasets and use this information as a starting point for the establishment of an early warning system (EWS). As a proof of concept, the EWS was applied to HTS datasets and archived samples from the 2018-9 West Nile virus (WNV) epidemic in Germany. A metagenomics read classifier detected sequences related to genome sequences of various members of Riboviria. We focused the further EWS investigation on viruses belonging to the families Peribunyaviridae and Reoviridae, under suspicion of causing co-infections in WNV-infected birds. Phylogenetic analyses revealed that the reovirus genome sequences clustered with sequences assigned to the species Umatilla virus (UMAV), whereas a new peribunyavirid, tentatively named 'Hedwig virus' (HEDV), belonged to a putative novel genus of the family Peribunyaviridae. In follow-up studies, newly developed molecular diagnostic assays detected fourteen UMAV-positive wild birds from different German cities and eight HEDV-positive captive birds from two zoological gardens. UMAV was successfully cultivated in mosquito C6/36 cells inoculated with a blackbird liver. In conclusion, this study demonstrates the power of the applied EWS for the discovery and characterization of unexpected viruses in repurposed sequence datasets, followed by virus screening and cultivation using archived sample material. The EWS enhances the strategies for pathogen recognition before causing sporadic cases and massive outbreaks and proves to be a reliable tool for modern outbreak preparedness.

13.
Microorganisms ; 9(9)2021 Sep 14.
Artigo em Inglês | MEDLINE | ID: mdl-34576850

RESUMO

Outbreaks of the European Bluetongue virus (BTV) serotype 8 (BTV-8), which are characterized by activity cycles separated by years of inactivity, may be influenced by genetic changes of the virus or by herd immunity. BTV activity in Israel is characterized by similar dynamics, but differs from European countries in its vector population, environmental conditions, and lack of cattle vaccination against this serotype. Comparison of these two geographical systems and characterization of their epidemiological connection is therefore of high interest in-order to better understand the factors influencing BTV-8 evolution. BTV-8, closely related to the European strain, was introduced to Israel in 2008. It was at the center of BT outbreaks in 2010 and 2015-2016 and thereafter was lastly isolated in Israel in 2019. We performed genetic analyses of twelve BTV-8 Israeli strains isolated between 2008 and 2019 and compared them with published sequences of BTV-8 isolated in other countries. The analysis revealed a single introduction of BTV-8 into Israel and thereafter extensive occurrence of genomic drifts and multiple reassortments with local BTV strains. Comparison of the Israeli and Cypriot BTV-8 from 2015 to 2016 suggests transmission of the virus between the two countries and a separate and parallel development from European or other Israeli BTV-8 strains. The parallel development of other BTV-8 strains was demonstrated by the identification of the Israeli BTV-8 ISR-1194/1/19 strain, which exhibited common origin with reassorted Israeli BTV-8 strains from 2010 and additional reassortment of seven segments. In order to reveal the source of BTV-8 introduction into Israel we performed BEAST analysis which showed that a probable common ancestor for both European and Israeli BTV-8 presumably existed in 2003-2004. In 2019, a possible new introduction occurred in Israel, where a novel BTV-8 strain was detected, sharing ~95% identity by segments 2 and 6 with Nigerian BTV-8NIG1982/07 and European-Middle Eastern strains. The results of the study indicate that Israel and neighboring countries consist a separate environmental and evolutionary system, distinct from European ones.

14.
Annu Rev Virol ; 8(1): 515-536, 2021 09 29.
Artigo em Inglês | MEDLINE | ID: mdl-34586868

RESUMO

Reverse genetics systems for viruses, the technology used to generate gene-engineered recombinant viruses from artificial genes, enable the study of the roles of the individual nucleotides and amino acids of viral genes and proteins in infectivity, replication, and pathogenicity. The successful development of a reverse genetics system for poliovirus in 1981 accelerated the establishment of protocols for other RNA viruses important for human health. Despite multiple efforts, rotavirus (RV), which causes severe gastroenteritis in infants, was refractory to reverse genetics analysis, and the first complete reverse genetics system for RV was established in 2017. This novel technique involves use of the fusogenic protein FAST (fusion-associated small transmembrane) derived from the bat-borne Nelson Bay orthoreovirus, which induces massive syncytium formation. Co-transfection of a FAST-expressing plasmid with complementary DNAs encoding RV genes enables rescue of recombinant RV. This review focuses on methodological insights into the reverse genetics system for RV and discusses applications and potential improvements to this system.


Assuntos
Reoviridae , Infecções por Rotavirus , Rotavirus , Genes Virais , Humanos , Reoviridae/genética , Genética Reversa/métodos , Replicação Viral/genética
15.
Infect Genet Evol ; 95: 105076, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34500093

RESUMO

Recently, RNA viruses have gained a mammoth concern for causing various outbreaks, and due to pandemics, they are acquiring additional attention throughout the world. An emerging RNA as well as vector-borne Banna Virus (BAV) is a human pathogen resulting in encephalitis, fever, headache, muscle aches, and severe coma. Besides human, pathogenic BAV was also detected from pigs, cattle, ticks, midges, and mosquitoes in Indonesia, China, and Vietnam. Due to high mutation tendency and dearth of a species barrier, this virus will consider as a significant threat in the near future throughout the planet, particularly in Africa. Despite of severe human case fatalities in several countries, there are no specific therapeutics, available vaccines, and other preventive measures against BAV. Thus, to find out the effective therapeutics and preventive strategies are crying exigency. In the present study, a unique multi-epitope-based peptide vaccine candidate is constructed using bioinformatics' tools that efficiently instigate immune cells for generating BAV antibodies. The potential vaccine candidates were developed using both T and B -cell epitopes. UniprotKB database was used to retrieve of two outer proteins (VP9 and VP4), and homologous sequences of BAV taxid: 7763, 649,604, 77,763, and 8453 were searched by NCBI BLAST. These serotypes are the most closely associated with the disease. Then combining the best-selected epitopes in various combinations with different adjuvants, three distinct vaccine candidates were formed. The validity tests were performed for the screened vaccine candidate regarding stability, allergenicity, and antigenicity parameters. Moreover, molecular dynamic simulations of the selected vaccine with TLR-8 immune receptor confirmed the stability of the binding pose and showed a significant response to immune cells. Thus, the results established that the designed chimeric peptide vaccine could enhance the immune response against BAV.


Assuntos
Proteínas do Capsídeo/genética , Coltivirus/imunologia , Epitopos de Linfócito B/imunologia , Epitopos de Linfócito T/imunologia , Vacinas Virais/imunologia , Biologia Computacional , Vacinas de Subunidades Antigênicas/imunologia
16.
Viruses ; 13(6)2021 06 08.
Artigo em Inglês | MEDLINE | ID: mdl-34201386

RESUMO

Packaging of segmented, double-stranded RNA viral genomes requires coordination of viral proteins and RNA segments. For mammalian orthoreovirus (reovirus), evidence suggests either all ten or zero viral RNA segments are simultaneously packaged in a highly coordinated process hypothesized to exclude host RNA. Accordingly, reovirus generates genome-containing virions and "genomeless" top component particles. Whether reovirus virions or top component particles package host RNA is unknown. To gain insight into reovirus packaging potential and mechanisms, we employed next-generation RNA-sequencing to define the RNA content of enriched reovirus particles. Reovirus virions exclusively packaged viral double-stranded RNA. In contrast, reovirus top component particles contained similar proportions but reduced amounts of viral double-stranded RNA and were selectively enriched for numerous host RNA species, especially short, non-polyadenylated transcripts. Host RNA selection was not dependent on RNA abundance in the cell, and specifically enriched host RNAs varied for two reovirus strains and were not selected solely by the viral RNA polymerase. Collectively, these findings indicate that genome packaging into reovirus virions is exquisitely selective, while incorporation of host RNAs into top component particles is differentially selective and may contribute to or result from inefficient viral RNA packaging.


Assuntos
Interações entre Hospedeiro e Microrganismos/genética , RNA de Cadeia Dupla/metabolismo , Reoviridae/genética , Empacotamento do Genoma Viral/genética , Vírion/genética , Vírion/fisiologia , Animais , Linhagem Celular , Genoma Viral , Camundongos , RNA-Seq , Reoviridae/fisiologia , Empacotamento do Genoma Viral/fisiologia , Proteínas Virais/genética , Proteínas Virais/metabolismo
17.
Viruses ; 13(5)2021 05 08.
Artigo em Inglês | MEDLINE | ID: mdl-34066683

RESUMO

Bat flies (Hippoboscoidea: Nycteribiidae and Streblidae) are obligate hematophagous ectoparasites of bats. We collected streblid bat flies from the New World (México) and the Old World (Uganda), and used metagenomics to identify their viruses. In México, we found méjal virus (Rhabdoviridae; Vesiculovirus), Amate virus (Reoviridae: Orbivirus), and two unclassified viruses of invertebrates. Méjal virus is related to emerging zoonotic encephalitis viruses and to the agriculturally important vesicular stomatitis viruses (VSV). Amate virus and its sister taxon from a bat are most closely related to mosquito- and tick-borne orbiviruses, suggesting a previously unrecognized orbivirus transmission cycle involving bats and bat flies. In Uganda, we found mamucuso virus (Peribunyaviridae: Orthobunyavirus) and two unclassified viruses (a rhabdovirus and an invertebrate virus). Mamucuso virus is related to encephalitic viruses of mammals and to viruses from nycteribiid bat flies and louse flies, suggesting a previously unrecognized orthobunyavirus transmission cycle involving hippoboscoid insects. Bat fly virus transmission may be neither strictly vector-borne nor strictly vertical, with opportunistic feeding by bat flies occasionally leading to zoonotic transmission. Many "bat-associated" viruses, which are ecologically and epidemiologically associated with bats but rarely or never found in bats themselves, may actually be viruses of bat flies or other bat ectoparasites.


Assuntos
Dípteros/virologia , Tropismo Viral , Animais , Código de Barras de DNA Taxonômico , Dípteros/classificação , Dípteros/genética , Geografia , Especificidade de Hospedeiro , Metagenômica/métodos , México , Filogenia , Uganda
18.
Vaccines (Basel) ; 9(5)2021 May 03.
Artigo em Inglês | MEDLINE | ID: mdl-34063562

RESUMO

Among vaccines administered to children are those targeting rotavirus, a segmented double-stranded RNA virus that represents a major cause of severe gastroenteritis. To explore the feasibility of establishing a combined rotavirus-SARS-CoV-2 vaccine, we generated recombinant (r)SA11 rotaviruses with modified segment 7 RNAs that contained coding cassettes for NSP3, a translational 2A stop-restart signal, and a FLAG-tagged portion of the SARS-CoV-2 spike (S) protein: S1 fragment, N-terminal domain (NTD), receptor-binding domain (RBD), extended RBD (ExRBD), or S2 core (CR) domain. Generation of rSA11 containing the S1 coding sequence required a sequence insertion of 2.2 kbp, the largest such insertion yet introduced into the rotavirus genome. Immunoblotting showed that rSA11 viruses containing the smaller NTD, RBD, ExRBD, and CR coding sequences expressed S-protein products of expected size, with ExRBD expressed at highest levels. These rSA11 viruses were genetically stable during serial passage. In contrast, the rSA11 virus containing the full-length S coding sequence (rSA11/NSP3-fS1) failed to express its expected 80 kDa fS1 product, for unexplained reasons. Moreover, rSA11/NSP3-fS1 was genetically unstable, with variants lacking the S1 insertion appearing during serial passage. Nonetheless, these results emphasize the potential usefulness of rotavirus vaccines as expression vectors of immunogenic portions of the SARS-CoV-2 S protein, including NTD, RBD, ExRBD, and CR, that have sizes smaller than the S1 fragment.

19.
Viruses ; 13(4)2021 03 31.
Artigo em Inglês | MEDLINE | ID: mdl-33807136

RESUMO

Rubella virus (RuV) is the causative agent of rubella ("German measles") and remains a global health concern. Until recently, RuV was the only known member of the genus Rubivirus and the only virus species classified within the Matonaviridae family of positive-sense RNA viruses. Recently, two new rubella-like matonaviruses, Rustrela virus and Ruhugu virus, have been identified in several mammalian species, along with more divergent viruses in fish and reptiles. To screen for the presence of additional novel rubella-like viruses, we mined published transcriptome data using genome sequences from Rubella, Rustrela, and Ruhugu viruses as baits. From this, we identified a novel rubella-like virus in a transcriptome of Tetronarce californica-order Torpediniformes (Pacific electric ray)-that is more closely related to mammalian Rustrela virus than to the divergent fish matonavirus and indicative of a complex pattern of cross-species virus transmission. Analysis of host reads confirmed that the sample analysed was indeed from a Pacific electric ray, and two other viruses identified in this animal, from the Arenaviridae and Reoviridae, grouped with other fish viruses. These findings indicate that the evolutionary history of the Matonaviridae is more complex than previously thought and highlights the vast number of viruses that remain undiscovered.


Assuntos
Bases de Dados de Ácidos Nucleicos , Evolução Molecular , Filogenia , Rubivirus/classificação , Rubivirus/genética , Torpedo/virologia , Animais , Arenaviridae/genética , Mineração de Dados , Feminino , Perfilação da Expressão Gênica , Reoviridae/genética , Vírus da Rubéola/genética , Rubivirus/isolamento & purificação
20.
Viruses ; 13(3)2021 03 05.
Artigo em Inglês | MEDLINE | ID: mdl-33807536

RESUMO

Epizootic hemorrhagic disease virus (EHDV; family Reoviridae, genus Orbivirus) is an arthropod-borne virus of ungulates, primarily white-tailed deer in North America. Culicoides sonorensis, the only confirmed North American vector of EHDV, is rarely collected from Florida despite annual virus outbreaks. Culicoides insignis is an abundant species in Florida and is also a confirmed vector of the closely related Bluetongue virus. In this study, oral challenge of C. insignis was performed to determine vector competence for EHDV serotype-2. Field-collected female midges were provided bovine blood spiked with three different titers of EHDV-2 (5.05, 4.00, or 2.94 log10PFUe/mL). After an incubation period of 10 days or after death, bodies and legs were collected. Saliva was collected daily from all females from 3 days post feeding until their death using honey card assays. All samples were tested for EHDV RNA using RT-qPCR. Our results suggest that C. insignis is a weakly competent vector of EHDV-2 that can support a transmissible infection when it ingests a high virus titer (29% of midges had virus positive saliva when infected at 5.05 log10PFUe/mL), but not lower virus titers. Nevertheless, due to the high density of this species, particularly in peninsular Florida, it is likely that C. insignis plays a role in the transmission of EHDV-2.


Assuntos
Ceratopogonidae/virologia , Surtos de Doenças/veterinária , Vírus da Doença Hemorrágica Epizoótica/isolamento & purificação , Mosquitos Vetores/virologia , Infecções por Reoviridae , Animais , Cervos/virologia , Florida/epidemiologia , Infecções por Reoviridae/transmissão , Infecções por Reoviridae/veterinária , Infecções por Reoviridae/virologia , Sorogrupo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA