Clinical and mutational characteristics of oculocutaneous albinism type 7.

The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.

Case series: Fundus autofluorescence abnormalities in a family of ocular albinism carriers.

SIGNIFICANCE: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence. PURPOSE: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases. CASE REPORTS: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism. CONCLUSIONS: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations.

Novel Variants of HPS6 Cause Suspected Ocular Albinism: A Report of 2 Cases and the Profile of HPS6 Variants.

INTRODUCTION: Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations. METHODS: Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed. RESULTS: We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease. CONCLUSION: Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis.

Ocular findings and a comparative study of hair, skin and iris color in Chinese patients with albinism.

BACKGROUND: Oculocutaneous albinism (OCA) could be either non-syndromic or syndromic. There are significant challenges in clinically recognizing and differentiating Hermansky-Pudlak syndrome (HPS) from non-syndromic OCA. MATERIALS AND METHODS: In a prospective consecutive case series, 63 patients (less than 18 years old) with a molecular genetic diagnosis of albinism (except OCA1A), Ocular albinism (OA) and Hermansky-Pudlak syndrome seen over a 3-year period were evaluated and analyzed. Hair colour, iris colour was graded, compared and correlated with the degree of fundus pigmentation and foveal development. RESULTS: A total of 63 patients were evaluated. Forty-five patients had non-syndromic OCA (11 OCA1B, 24 OCA2, 9 OCA4, and 1 OCA6), 5 patients had OA and 13 patients had HPS. All 3 BLOC-related HPS categories were seen (1 with BLOC1, 7 with BLOC-2 and 5 with BLOC-3 related HPS). All patients with OA were hyperopic, had darker fundus pigmentation, but had poor foveal development. All HPS patients had lighter fundus pigmentation. The degree of fundus pigmentation correlated positively with the iris pigmentation and also with the foveal development only in OCA2. CONCLUSIONS: Careful observation of the phenotype by comparison of the skin, hair, iris colour, with the degree of fundus pigmentation and foveal development may help clinically differentiate HPS from OCA patients of Chinese ethnicity even in the absence of any bleeding tendency.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Foveal hypoplasia in parents of patients with albinism.

BACKGROUND: Albinism is a group of genetic disorders characterized by general skin and retinal hypopigmentation. It is in most cases an autosomal recessive condition. Foveal hypoplasia (FH) is one of the main criteria for the diagnosis of albinism. The aim of this study was to analyze the macular profile of the parents of patients with albinism. METHODS: This study included a case series of 27 patients with albinism seen in Rothschild Foundation between April 2017 and February 2020. Spectral-domain optical coherence tomography (SD-OCT) and OCT angiography (OCT-A) were performed in every patient when possible and in every available parents. FH was graded according to Thomas' classification based on OCT. Next generation sequencing-based gene panel testing was performed in parents and children when a FH was detected on OCT in a parent. RESULTS: Twenty-seven patients with albinism were examined. Nine parents had FH based on the OCT B-scan (33%). In parents without FH based on the SD-OCT B-scan (67%), OCT-A showed a reduced avascular zone in the deep vascular plexus in 4 parents. Six parents carried variants that could explain their phenotype, including TYR R402Q hypomorphic alleles. CONCLUSION: This study showed the presence of FH in parents of patients with albinism, and aimed to genetically explain this phenotype.

Macular Findings in Carriers of Ocular Albinism With a Novel GPR143 Mutation.

This case series details macular findings in three female siblings who were found to be carriers of a previously unreported splice mutation in GPR143 (X-linked ocular albinism [OA1]). Presumed lyonization is responsible for both the subtle and varied findings in OA1 carriers, even among siblings, and especially in patients with darker skin pigmentation. In this series, we used green-light autofluorescence to reveal subtle subfoveal involvement and used optical coherence tomography angiography to uncover previously unreported narrowing of the foveal avascular zone, consistent with foveal hypoplasia. [Ophthalmic Surg Lasers Imaging Retina 2022;53:460-463.].

Choroidal and retinal thickness variations in ocular albinism.

Purpose: To study the retinal and choroidal thickness variations on enhanced depth imaging optical coherence tomography scans in ocular albinism (OA) and compare with age-matched healthy subjects. Methods: This retrospective observational study had 48 eyes of 24 patients diagnosed clinically as OA and age, sex, and axial length-matched control healthy subjects. All patients underwent detailed ophthalmic examination and a single-line horizontal-raster enhanced depth imaging - optical coherence tomography scan (Spectralis, Heidelberg Engineering). Retinal and choroidal thickness was measured, compared, and analyzed between the two groups. Mann-Whitney U test was used for analysis between the two groups. P < 0.05 was considered significant. Results: The mean age was 28.3 ± 11.6 and 29.9 ± 10.6 years in the OA group and control group, respectively. Spherical equivalents ranged from -8.5D to +10.5D in the OA group and from -8.0D to +10.0D in the control group. The mean axial length between the two groups (P = 0.652) were comparable. The average retinal thickness (272 ± 34.3 vs. 213 ± 13.8 µm; P < 0.001) was greater in the OA group as compared to controls. The mean choroidal thickness (184 ± 78.4 vs. 287 ± 46.4 µm; P < 0.001) was significantly thinner in the OA group. Conclusion: Acquisition of OCT scans in OA can be challenging. This study showed that the subfoveal retinal thickness and choroidal thickness measured across the scans were significantly different in the OA group compared to controls. In the future, more studies are required to evaluate the role of the choroid and its relationship to emmetropization in albinism.

Genotypic and Phenotypic Spectrum of Foveal Hypoplasia: A Multicenter Study.

PURPOSE: To characterize the genotypic and phenotypic spectrum of foveal hypoplasia (FH). DESIGN: Multicenter, observational study. PARTICIPANTS: A total of 907 patients with a confirmed molecular diagnosis of albinism, PAX6, SLC38A8, FRMD7, AHR, or achromatopsia from 12 centers in 9 countries (n = 523) or extracted from publicly available datasets from previously reported literature (n = 384). METHODS: Individuals with a confirmed molecular diagnosis and availability of foveal OCT scans were identified from 12 centers or from the literature between January 2011 and March 2021. A genetic diagnosis was confirmed by sequence analysis. Grading of FH was derived from OCT scans. MAIN OUTCOME MEASURES: Grade of FH, presence or absence of photoreceptor specialization (PRS+ vs. PRS-), molecular diagnosis, and visual acuity (VA). RESULTS: The most common genetic etiology for typical FH in our cohort was albinism (67.5%), followed by PAX6 (21.8%), SLC38A8 (6.8%), and FRMD7 (3.5%) variants. AHR variants were rare (0.4%). Atypical FH was seen in 67.4% of achromatopsia cases. Atypical FH in achromatopsia had significantly worse VA than typical FH (P < 0.0001). There was a significant difference in the spectrum of FH grades based on the molecular diagnosis (chi-square = 60.4, P < 0.0001). All SLC38A8 cases were PRS- (P = 0.003), whereas all FRMD7 cases were PRS+ (P < 0.0001). Analysis of albinism subtypes revealed a significant difference in the grade of FH (chi-square = 31.4, P < 0.0001) and VA (P = 0.0003) between oculocutaneous albinism (OCA) compared with ocular albinism (OA) and Hermansky-Pudlak syndrome (HPS). Ocular albinism and HPS demonstrated higher grades of FH and worse VA than OCA. There was a significant difference (P < 0.0001) in VA between FRMD7 variants compared with other diagnoses associated with FH. CONCLUSIONS: We characterized the phenotypic and genotypic spectrum of FH. Atypical FH is associated with a worse prognosis than all other forms of FH. In typical FH, our data suggest that arrested retinal development occurs earlier in SLC38A8, OA, HPS, and AHR variants and later in FRMD7 variants. The defined time period of foveal developmental arrest for OCA and PAX6 variants seems to demonstrate more variability. Our findings provide mechanistic insight into disorders associated with FH and have significant prognostic and diagnostic value.

GPR143 genotypic and ocular phenotypic characterisation in a Chinese cohort with ocular albinism.

PURPOSE: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene. METHODS: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants. RESULTS: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%. CONCLUSIONS: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.

Prospective Study of the Phenotypic and Mutational Spectrum of Ocular Albinism and Oculocutaneous Albinism.

Albinism encompasses a group of hereditary disorders characterized by reduced or absent ocular pigment and variable skin and/or hair involvement, with syndromic forms such as Hermansky-Pudlak syndrome and Chédiak-Higashi syndrome. Autosomal recessive oculocutaneous albinism (OCA) is phenotypically and genetically heterogenous (associated with seven genes). X-linked ocular albinism (OA) is associated with only one gene, GPR143. We report the clinical and genetic outcomes of 44 patients, from 40 unrelated families of diverse ethnicities, with query albinism presenting to the ocular genetics service at Moorfields Eye Hospital NHS Foundation Trust between November 2017 and October 2019. Thirty-six were children (≤ 16 years) with a median age of 31 months (range 2-186), and eight adults with a median age of 33 years (range 17-39); 52.3% (n = 23) were male. Genetic testing using whole genome sequencing (WGS, n = 9) or a targeted gene panel (n = 31) gave an overall diagnostic rate of 42.5% (44.4% (4/9) with WGS and 41.9% (13/31) with panel testing). Seventeen families had confirmed mutations in TYR (n = 9), OCA2, (n = 4), HPS1 (n = 1), HPS3 (n = 1), HPS6 (n = 1), and GPR143 (n = 1). Molecular diagnosis of albinism remains challenging due to factors such as missing heritability. Differential diagnoses must include SLC38A8-associated foveal hypoplasia and syndromic forms of albinism.

Genotype-phenotype associations in Danish patients with ocular and oculocutaneous albinism.

BACKGROUND: The study aimed to describe genotype-phenotype associations in patients with oculocutaneous and ocular-only albinism and to evaluate a set of diagnostic criteria proposed recently by Kruijt et al. MATERIALS AND METHODS: Genotype-phenotype associations in patients with a clinical diagnosis of albinism were studied based on imaging of hair and ocular features (nystagmus, iris color and translucency, fundus pigmentation and foveal development) and self-evaluated skin type. Patients were sub-grouped based on genetic findings. RESULTS: Patients with biallelic variants in TYR (n = 29), OCA2 (n = 22), other albinism genes (n = 13) or monoallelic variants in GPR143 (n = 13) were included as were 15 patients with a pure clinical diagnosis but no genetic findings. In descending order the most common findings were: foveal hypoplasia (any hypoplasia 95.2%, severe 88.0%), nystagmus (93.5%), iris translucency (any translucency 80.2%, moderate to severe 31.5%), misrouting on VEP (80.0%): fundus hypopigmentation (any hypopigmentation: 75.8%, severe 30.1%), fair skin type (73.8%), blue irides (62.0%), blonde hair (57.5%), and unpigmented eye lashes (39.1%). There were no phenotypic differences between the different genetic subgroups of albinism but patients with a pathogenic haplotype in TYR in combination with a classic variant had less iris translucency than patients with two classic variants in TYR. CONCLUSIONS: Ocular developmental features were the most common findings whereas phenotypic features related to pigmentation were less common findings but there were no genotype-phenotype correlations. All patients with a genetically confirmed diagnosis of albinism fulfilled the diagnostic criteria by Kruijt irrespective of genetic subtype.

A Novel Splice-Site Variant in CACNA1F Causes a Phenotype Synonymous with Åland Island Eye Disease and Incomplete Congenital Stationary Night Blindness.

BACKGROUND: CACNA1F-related disorders encompass progressive and non-progressive disorders, including Åland island eye disease and incomplete congenital stationary night blindness. These two X-linked disorders are characterized by nystagmus, color vision defect, myopia, and electroretinography (ERG) abnormalities. Ocular hypopigmentation and iris transillumination are reported only in patients with Åland island eye disease. Around 260 variants were reported to be associated with these two non-progressive disorders, with 19 specific to Åland island eye disease and 14 associated with both Åland island eye disease and incomplete congenital stationary night blindness. CACNA1F variants spread on the gene and further analysis are needed to reveal phenotype-genotype correlation. CASE REPORT: A complete ocular exam and genetic testing were performed on a 13-year-old boy. A novel splice-site variant, c.4294-11C>G in intron 36 in CACNA1F, was identified at hemizygous state in the patient and at heterozygous state in his asymptomatic mother and explained the phenotype synonymous with Åland island eye disease and incomplete congenital stationary night blindness observed in the patient. CONCLUSION: We present a novel variant in the CACNA1F gene causing phenotypic and electrophysiologic findings indistinguishable from those of AIED/CSNB2A disease. This finding further expands the mutational spectrum and our knowledge of CACNA1F-related disease.

Pseudo-Gaze Deviation Resulting From Positive Angle Kappa and Esotropia.

ABSTRACT: A 6-year-old boy was referred for constant right gaze deviation. Rather than a gaze deviation, he constantly seemed to look on the left side of any displayed target. Examination revealed the association of a highly positive angle Kappa and an esotropia of equal values. He also exhibited signs of ocular albinism with no associated infantile nystagmus syndrome. The X-linked ocular albinism was confirmed genetically, explaining the presence of a positive angle Kappa. A highly positive angle Kappa can be associated with a convergent strabismus; in case both values offset each other, this can result in a constant "sidelooking," which should not be confused with a gaze deviation.

Retinal Vasoproliferative Tumor in Ocular Albinism.

BACKGROUND Retinal vasoproliferative tumor (VPT) is a type of ocular vascular tumor that commonly occurs idiopathically and can be associated with secondary ocular diseases. Ocular albinism is an X-linked inherited disease and distinguished from oculocutaneous albinism by less hair and skin involvement. CASE REPORT A 42-year-old man with ocular albinism and moderate myopia presented with a history of insidious decrease in vision in both eyes over a period of months. On examination, the horizontal pendular nystagmus was present and diffuse iris transillumination defects were observed bilaterally. A fundus examination revealed a depigmented fundus with visible choroidal vessels, foveal hypoplasia, and a unilateral, elevated, vascular lesion in the superotemporal aspect of the retinal periphery. Optical coherence tomography of the lesion confirmed the retinal location and fluorescein fundus angiography indicated its vascular nature. B-scan ultrasonography was performed to measure the dimensions of the lesion. CONCLUSIONS Rare retinal VPT has been reported with systemic and ocular associations, but it has never been reported in the literature in association with ocular albinism. Multiple treatment modalities have been described for the tumor, but observation can be considered in the absence of secondary consequences of the VPT. Retinal VPT should be included in the differential diagnosis of any retinal vascular abnormalities in patients with ocular albinism.

Nistagmo secundario a albinismo con compromiso ocular en paciente femenina: un desafío diagnóstico / Nystagmus secondary to albinism with ocular involvement in a female: a diagnostic challenge

INTRODUCCIÓN: El nistagmo infantil es infrecuente y representa un desafío diagnóstico para el pediatra. El albinismo es una de sus principales causas, siendo difícil de sospechar en ausencia de compromiso cutáneo evidente, especialmente en pacientes femeninas, debido a que tipo de herencia del albinismo ocular. OBJETIVO: Describir un caso de nistagmo secundario a albinismo con compromiso ocular aislado en paciente femenina, para discutir el enfoque diagnóstico pediátrico. CASO CLÍNICO: Paciente fe menino de 3 semanas de vida, sin antecedentes mórbidos, derivada a neuropediatra y oftalmólogo por movimientos oculares paroxísticos desde las 2 semanas, con estudio con electroencefalograma e imágenes cerebrales normales. A los 3 meses se confirmó translucencia iridiana, nistagmo y astigmatismo hipermetrópico. La valuación dermatológica descartó compromiso cutáneo. Evolucionó con inclinación cefálica hacia abajo y retraso del desarrollo de la coordinación, fue manejada con lentes de corrección y kinesioterapia. A los 3 años, destacaba mejoría de la agudeza visual, disminución del nistagmo y neurodesarrollo normal. La evaluación oftalmológica de ambos padres fue normal y no había antecedentes de nistagmo o albinismo en la familia. Por decisión de los padres no se realizó estudio genético. CONCLUSIÓN: El diagnóstico de nistagmo secundario a compromiso ocular del albinismo, aún en ausencia de afección cutánea, es clínico; el estudio genético permite confirmar la etiología, sin ser un examen imprescindible, a menos que se considere la planificación familiar. La pesquisa oportuna e intervención multidisciplinaria determinan un mejor pronóstico.

INTRODUCTION: Infantile nystagmus is an infrequent condition that represents a diagnostic challenge for the pediatri cian. Albinism is one of its main causes, being difficult to suspect in the absence of evident cutaneous involvement, especially in female patients, due to the inheritance type of ocular albinism. OBJECTIVE: To describe a case of nystagmus secondary to albinism with isolated ocular involvement in a female patient, in order to provide tools for pediatric approach and diagnosis. CLINICAL CASE: Three- weeks-old female patient, without morbid history, referred to a pediatric neurosurgeon and ophthal mologist due to paroxysmal eye movements since 2 weeks of age. The electroencephalogram and brain images were normal. In follow-up monitoring at 3 months, iris translucency, nystagmus, and hypermetropic astigmatism were confirmed. Dermatologic evaluation ruled out cutaneous invol vement. The patient developed cephalic downward inclination and coordination development de lay was confirmed, the patient was handled with corrective lenses and kinesiotherapy. In follow-up monitoring at 3 years, there was an improvement in visual acuity, decreased nystagmus and normal neurodevelopment. The ophthalmological evaluation of both parents was normal and there was no history of nystagmus or albinism in the family. Upon her parents' decision, no genetic study was ca rried out. CONCLUSION: The diagnosis of nystagmus secondary to ocular albinism, even in the absence of cutaneous involvement, is clinical. The genetic study allows confirming the etiology, without being an essential examination, unless family planning is considered. Timely research and multidisciplinary intervention determine a better prognosis.