Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

Loss of soluble N-ethylmaleimide-sensitive factor attachment protein α (αSNAP) induces epithelial cell apoptosis via down-regulation of Bcl-2 expression and disruption of the Golgi.

Intracellular trafficking represents a key mechanism that regulates cell fate by participating in either prodeath or prosurvival signaling. Soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein α (αSNAP) is a well known component of vesicle trafficking machinery that mediates intermembrane fusion. αSNAP increases cell resistance to cytotoxic stimuli, although mechanisms of its prosurvival function are poorly understood. In this study, we found that either siRNA-mediated knockdown of αSNAP or expression of its dominant negative mutant induced epithelial cell apoptosis. Apoptosis was not caused by activation of the major prodeath regulators Bax and p53 and was independent of a key αSNAP binding partner, NSF. Instead, death of αSNAP-depleted cells was accompanied by down-regulation of the antiapoptotic Bcl-2 protein; it was mimicked by inhibition and attenuated by overexpression of Bcl-2. Knockdown of αSNAP resulted in impairment of Golgi to endoplasmic reticulum (ER) trafficking and fragmentation of the Golgi. Moreover, pharmacological disruption of ER-Golgi transport by brefeldin A and eeyarestatin 1 or siRNA-mediated depletion of an ER/Golgi-associated p97 ATPase recapitulated the effects of αSNAP inhibition by decreasing Bcl-2 level and triggering apoptosis. These results reveal a novel role for αSNAP in promoting epithelial cell survival by unique mechanisms involving regulation of Bcl-2 expression and Golgi biogenesis.

p31 deficiency influences endoplasmic reticulum tubular morphology and cell survival.

p31, the mammalian orthologue of yeast Use1p, is an endoplasmic reticulum (ER)-localized soluble N-ethylmaleimide-sensitive factor attachment protein (SNAP) receptor (SNARE) that forms a complex with other SNAREs, particularly syntaxin 18. However, the role of p31 in ER function remains unknown. To determine the role of p31 in vivo, we generated p31 conditional knockout mice. We found that homozygous deletion of the p31 gene led to early embryonic lethality before embryonic day 8.5. Conditional knockout of p31 in brains and mouse embryonic fibroblasts (MEFs) caused massive apoptosis accompanied by upregulation of ER stress-associated genes. Microscopic analysis showed vesiculation and subsequent enlargement of the ER membrane in p31-deficient cells. This type of drastic disorganization in the ER tubules has not been demonstrated to date. This marked change in ER structure preceded nuclear translocation of the ER stress-related transcription factor C/EBP homologous protein (CHOP), suggesting that ER stress-induced apoptosis resulted from disruption of the ER membrane structure. Taken together, these results suggest that p31 is an essential molecule involved in the maintenance of ER morphology and that its deficiency leads to ER stress-induced apoptosis.