Your browser doesn't support javascript.
loading
Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.
Zhu, Ji-Ting; Lin, Han; Wu, Xuan; Li, Zhi-Wen; Lin, Ai-Yu.
Afiliação
  • Zhu JT; Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005, China.
  • Lin H; School of Postgraduate Education, Fujian Medical University, Fuzhou, Fujian 350122, China.
  • Wu X; Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005, China.
  • Li ZW; Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005, China.
  • Lin AY; Department of Neurology and Institute of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005, China.
Chin Med J (Engl) ; 132(23): 2827-2834, 2019 Dec 05.
Article em En | MEDLINE | ID: mdl-31856054
BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
Assuntos

Texto completo: 1 Base de dados: MEDLINE Assunto principal: Meningite Criptocócica Idioma: En Ano de publicação: 2019 Tipo de documento: Article

Texto completo: 1 Base de dados: MEDLINE Assunto principal: Meningite Criptocócica Idioma: En Ano de publicação: 2019 Tipo de documento: Article