Your browser doesn't support javascript.
loading
[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.
Li, Zhuo; Yu, Dehai; Li, Haijun; Lv, You; Li, Sijie.
Afiliação
  • Li Z; Endocrinology and Metabolism Department, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China.
  • Yu D; Cancer Center, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China.
  • Li H; Institute of Translational Medicine, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China.
  • Lv Y; Endocrinology and Metabolism Department, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China.
  • Li S; Department of Breast Surgery, The First Hospital of Jilin University, Changchun, Jilin 130021, P.R. China.
Int J Oncol ; 64(3)2024 Mar.
Article em En | MEDLINE | ID: mdl-38214398
ABSTRACT
Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to "The primer sequences of the p21 promoter were as follows Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54 1033­1042, 2019; DOI 10.3892/ijo.2019.4679].
Palavras-chave

Texto completo: 1 Base de dados: MEDLINE Idioma: En Ano de publicação: 2024 Tipo de documento: Article

Texto completo: 1 Base de dados: MEDLINE Idioma: En Ano de publicação: 2024 Tipo de documento: Article