Detection of SARS-CoV-2 RNA by multiplex RT-qPCR.

The current quantitative reverse transcription PCR (RT-qPCR) assay recommended for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) testing in the United States requires analysis of 3 genomic targets per sample: 2 viral and 1 host. To simplify testing and reduce the volume of required reagents, we devised a multiplex RT-qPCR assay to detect SARS-CoV-2 in a single reaction. We used existing N1, N2, and RP primer and probe sets by the Centers for Disease Control and Prevention, but substituted fluorophores to allow multiplexing of the assay. The cycle threshold (Ct) values of our multiplex RT-qPCR were comparable to those obtained by the single assay adapted for research purposes. Low copy numbers (≥500 copies/reaction) of SARS-CoV-2 RNA were consistently detected by the multiplex RT-qPCR. Our novel multiplex RT-qPCR improves upon current single diagnostics by saving reagents, costs, time, and labor.

Evaluation of the Genmark ePlex® and QIAstat-Dx® respiratory pathogen panels in detecting bacterial targets in lower respiratory tract specimens.

BACKGROUND: The ePlex® and QIAstat-Dx® respiratory pathogen panels detect multiple respiratory pathogens, mainly viruses but also Legionella pneumophila, Mycoplasma pneumoniae and Bordetella pertussis. The assays have been marketed for use in nasopharyngeal swab specimens. For diagnosing bacterial pneumonia, lower respiratory tract (LRT) specimens are indicated. Aim of this study was to evaluate the performance of these syndromic panels for these three bacterial targets in samples from the LRT. Fifty-six specimens were collected from our repositories, five negative samples and fifty-one samples which had been previously tested positive with the routine diagnostic real-time PCR assays for Legionella spp. (N = 20), Bordetella spp. (N = 16) or M. pneumoniae (N = 15). RESULTS: The QIAstat-Dx Respiratory Panel V2 (RP) assay detected all of the L. pneumophila and B. pertussis positive samples but only 11/15 (73.3 %) of the M. pneumoniae targets. The ePlex Respiratory Pathogen Panel (RPP) assay detected 10/14 (71.4 %) of the L. pneumophila targets, 8/12 (66.7 %) of the B. pertussis positive samples and 13/15 (86.7 %) of the M. pneumoniae targets. CONCLUSIONS: No false-positive results were reported for all three bacterial pathogens by both assays. The clinical performance of both assays depended highly on the bacterial load in the sample and the type of specimen under investigation.

Validation of multiplex PCR sequencing assay of SIV.

BACKGROUND: The generation of accurate and reproducible viral sequence data is necessary to understand the diversity present in populations of RNA viruses isolated from clinical samples. While various sequencing methods are available, they often require high quality templates and high viral titer to ensure reliable data. METHODS: We modified a multiplex PCR and sequencing approach to characterize populations of simian immunodeficiency virus (SIV) isolated from nonhuman primates. We chose this approach with the aim of reducing the number of required input templates while maintaining fidelity and sensitivity. We conducted replicate sequencing experiments using different numbers of quantified viral RNA (vRNA) or viral cDNA as input material. We performed assays with clonal SIVmac239 to detect false positives, and we mixed SIVmac239 and a variant with 24 point mutations (SIVmac239-24X) to measure variant detection sensitivity. RESULTS: We found that utilizing a starting material of quantified viral cDNA templates had a lower rate of false positives and increased reproducibility when compared to that of quantified vRNA templates. This study identifies the importance of rigorously validating deep sequencing methods and including replicate samples when using a new method to characterize low frequency variants in a population with a small number of templates. CONCLUSIONS: Because the need to generate reproducible and accurate sequencing data from diverse viruses from low titer samples, we modified a multiplex PCR and sequencing approach to characterize SIV from populations from non-human primates. We found that increasing starting template numbers increased the reproducibility and decreased the number of false positives identified, and this was further seen when cDNA was used as a starting material. Ultimately, we highlight the importance of vigorously validating methods to prevent overinterpretation of low frequency variants in a sample.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

MFEprimer-3.0: quality control for PCR primers.

Quality control (QC) for lab-designed primers is crucial for the success of a polymerase chain reaction (PCR). Here, we present MFEprimer-3.0, a functional primer quality control program for checking non-specific amplicons, dimers, hairpins and other parameters. The new features of the current version include: (i) more sensitive binding site search using the updated k-mer algorithm that allows mismatches within the k-mer, except for the first base at the 3' end. The binding sites of each primer with a stable 3' end are listed in the output; (ii) new algorithms for rapidly identifying self-dimers, cross-dimers and hairpins; (iii) the command-line version, which has an added option of JSON output to enhance the versatility of MFEprimer by acting as a QC step in the 'primer design → quality control → redesign' pipeline; (iv) a function for checking whether the binding sites contain single nucleotide polymorphisms (SNPs), which will affect the consistency of binding efficiency among different samples. In summary, MFEprimer-3.0 is updated with the well-tested PCR primer QC program and it can be integrated into various PCR primer design applications as a QC module. The MFEprimer-3.0 server is freely accessible without any login requirement at: https://mfeprimer3.igenetech.com/ and https://www.mfeprimer.com/. The source code for the command-line version is available upon request.

Comparative Clinical Evaluation of NeoPlex RB-8 with Seeplex PneumoBacter ACE for Simultaneous Detection of Eight Respiratory Bacterial Pathogens.

There are several convenient and accurate molecular assays to detect respiratory bacterial infection. The NeoPlex RB-8 detection kit (NeoPlex RB-8) is a new multiplex real-time PCR assay that simultaneously detects Streptococcus pneumoniae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, Legionella pneumophila, Haemophilus influenzae, Bordetella pertussis, Bordetella parapertussis, and Moraxella catarrhalis in a single test. This study compared the clinical concordance of NeoPlex RB-8 with another method, Seeplex PneumoBacter ACE detection assay (Seeplex PB ACE), which simultaneously detects S. pneumoniae, M. pneumoniae, C. pneumoniae, L. pneumophila, H. influenzae, and B. pertussis We tested 2,137 nasopharyngeal swab and sputum specimens using both assays. For discordant Bordetella parapertussis and M. catarrhalis specimens, we also performed bidirectional sequencing. For S. pneumoniae, M. pneumoniae, C. pneumoniae, L. pneumophila, H. influenzae, and B. pertussis, which are detected by both NeoPlex RB-8 and Seeplex PB ACE, the positive and negative agreement between the two assays ranged from 91.7 to 100% (κ = 0.918 to 1). S. pneumoniae and H. influenzae were the most discordant targets and measured with higher sensitivity and specificity by NeoPlex RB-8 than Seeplex PB ACE. For Bordetella parapertussis and M. catarrhalis, which are not detected by Seeplex PB ACE, NeoPlex RB-8 sensitivity and specificity were >99%. Overall, NeoPlex RB-8 was highly comparable to Seeplex PB ACE, but NeoPlex RB-8 was more clinically accurate, with higher throughput and more convenience.

A novel ultra-sensitive method for the detection of FGFR3 mutations in urine of bladder cancer patients - Design of the Urodiag® PCR kit for surveillance of patients with non-muscle-invasive bladder cancer (NMIBC).

BACKGROUND: We have recently developed a highly accurate urine-based test, named Urodiag®, associating FGFR3 mutation and DNA methylation assays for recurrence surveillance in patients with low-, intermediate-, and high-risk NMIBC. Previously, the detection of four FGFR3 mutations (G372C, R248C, S249C and Y375C) required amplification steps and PCR products were analyzed by capillary electrophoresis (Allele Specific-PCR, AS-PCR), which was expensive and time-consuming. Here, we present the development a novel ultra-sensitive multiplex PCR assay as called "Mutated Allele Specific Oligonucleotide-PCR (MASO-PCR)", generating a cost-effective, simple, fast and clinically applicable assay for the detection of FGFR3 mutations in voided urine. METHODS: Comparative clinical performances of MASO-PCR and AS-PCR technologies were performed from 263 urine DNA samples (87 FGFR3 mutated and 176 FGFR3 wild-type). In the development of Urodiag® PCR Kit, we studied the stability and reproducibility of each all-in-one PCR master mix (single reaction mixture including all the necessary PCR components) for MASO-PCR and QM-MSPCR (Quantitative Multiplex Methylation-Specific PCR to co-amplify SEPTIN9, HS3ST2 and SLIT2 methylated genes) assays. RESULTS: Complete concordance (100%) was observed between the MASO-PCR and AS-PCR results. Each PCR master mix displayed excellent reproducibility and stability after 12 months of storage at - 20 °C, with intra-assay standard deviations lower than 0.3 Ct and coefficient of variations (CV) lower than 1%. The limit of detection (LoD) of MASO-PCR was 5% mutant detection in a 95% of wild-type background. The limit of quantification (LoQ) of QM-MSPCR was 10 pg of bisulfite-converted DNA. CONCLUSIONS: We developed and clinically validated the MASO-PCR assay, generating cost-effective, simple, fast and clinically applicable assay for the detection of FGFR3 mutations in urine. We also designed the Urodiag® PCR Kit, which includes the MASO-PCR and QM-MSPCR assays. Adapted to routine clinical laboratory (simplicity, accuracy), the kit will be a great help to urologists for recurrence surveillance in patients at low-, intermediate- and high-risk NMIBC. Reducing the number of unnecessary cystoscopies, it will have extremely beneficial effects for patients (painless) and for the healthcare systems (low cost).

Detection of sexually transmitted disease-causing pathogens from direct clinical specimens with the multiplex PCR-based STD Direct Flow Chip Kit.

Pathogens causing sexually transmitted diseases (STDs) include viruses, bacteria, and parasites. The ability to rapidly and efficiently detect these pathogens in a single reaction still remains a health challenge. The aim of this study was to evaluate the clinical reliability and accuracy of the STD Direct Flow Chip Kit (Vitro, IVD-EC approved), which can simultaneously detect up to 9 different species of STD pathogens at once. This kit enables direct analysis-direct-PCR-of clinical specimens (urine, semen, endocervical, urethral, nasopharyngeal, and perianal swabs) without DNA purification for the following pathogens: Chlamydia trachomatis (serovars A-K and L1-L3), Haemophilus ducreyi, Herpes Simplex Virus (Types I and II), Mycoplasma genitalium, Mycoplasma hominis, Neisseria gonorrhoeae, Treponema pallidum, Trichomonas vaginalis, and Ureaplasma. The Anyplex™ II STI-7 Detection Kit (Seegene, IVD-EC) was used as the reference's method. Existing discordances were resolved using either a third molecular assay or DNA sequencing. Clinical performance was evaluated at two different stages: (i) from purified DNA of three hundred and fifty-eight clinical specimens with a diagnostic sensitivity (SE) and specificity (SP) of 99.4% and 100%, respectively, and an agreement of 99% (kappa index, κ = 0.97) with the reference's method and; (ii) by direct-PCR from six hundred and thirty-three specimens rendering SE, SP, and agreement values of 98.4%, 99.9%, and 98.0% (κ = 0.95), respectively. The STD Direct Flow Chip Kit constitutes a promising alternative to routine procedures in diagnostic, allowing direct analysis of specimens and enabling the detection of a broad panel of pathogens.

Multiplex qPCR assay for assessment of reference gene expression stability in rat tissues/samples.

RT-qPCR requires an adequate choice of stably expressed reference genes for accurate normalization of mRNA expression. However, testing a panel of reference genes is often time-consuming and expensive. In this work, we aimed to develop a set of multiplex real-time PCR assays for RT-qPCR analysis of commonly used housekeeping genes in laboratory rats. Using Hydrolysis probe (TaqMan®) technology, we have designed and optimized three triplex qPCR assays (Actb + Gapdh + B2m; Rpl13a + Sdha + Ppia; Hprt1+Pgk1+Ywhaz) demonstrating optimal PCR amplification efficiencies (from 94.7 to 100.5%) and repeatability. Novel assays allow expression analysis of 9 reference genes in 3 reactions making possible a more time-efficient choice of reference genes in RT-qPCR experiments in Wistar rats in comparison with widespread singleplex assays.

Failure of multiplex meningitis/encephalitis (ME) NAT during cryptococcal meningitis in solid organ recipients.

Cryptococcal meningitis is a severe cause of central nervous system infections among immunocompromised solid organ transplant (SOT) patients. While new diagnostic methods as multiplex meningitis/encephalitis (ME) NAT (nucleic acid test) are increasingly used as a first-line tool in hospital practice, data in HIV-negative patients including SOT remain scarce. We report here false-negative results of multiplex NAT among SOT patients with proven cryptococcal meningitis.

Performance and impact of a multiplex PCR in ICU patients with ventilator-associated pneumonia or ventilated hospital-acquired pneumonia.

BACKGROUND: Early appropriate antibiotic therapy reduces morbidity and mortality of severe pneumonia. However, the emergence of bacterial resistance requires the earliest use of antibiotics with the narrowest possible spectrum. The Unyvero Hospitalized Pneumonia (HPN, Curetis) test is a multiplex PCR (M-PCR) system detecting 21 bacteria and 19 resistance genes on respiratory samples within 5 h. We assessed the performance and the potential impact of the M-PCR on the antibiotic therapy of ICU patients. METHODS: In this prospective study, we performed a M-PCR on bronchoalveolar lavage (BAL) or plugged telescoping catheter (PTC) samples of patients with ventilated HAP or VAP with Gram-negative bacilli or clustered Gram-positive cocci. This study was conducted in 3 ICUs in a French academic hospital: the medical and infectious diseases ICU, the surgical ICU, and the cardio-surgical ICU. A multidisciplinary expert panel simulated the antibiotic changes they would have made if the M-PCR results had been available. RESULTS: We analyzed 95 clinical samples of ventilated HAP or VAP (72 BAL and 23 PTC) from 85 patients (62 males, median age 64 years). The median turnaround time of the M-PCR was 4.6 h (IQR 4.4-5). A total of 90/112 bacteria were detected by the M-PCR system with a global sensitivity of 80% (95% CI, 73-88%) and specificity of 99% (95% CI 99-100). The sensitivity was better for Gram-negative bacteria (90%) than for Gram-positive cocci (62%) (p = 0.005). Moreover, 5/8 extended-spectrum beta-lactamases (CTX-M gene) and 4/4 carbapenemases genes (3 NDM, one oxa-48) were detected. The M-PCR could have led to the earlier initiation of an effective antibiotic in 20/95 patients (21%) and to early de-escalation in 37 patients (39%) but could also have led to one (1%) inadequate antimicrobial therapy. Among 17 empiric antibiotic treatments with carbapenems, 10 could have been de-escalated in the following hours according to the M-PCR results. The M-PCR also led to 2 unexpected diagnosis of severe legionellosis confirmed by culture methods. CONCLUSIONS: Our results suggest that the use of a M-PCR system for respiratory samples of patients with VAP and ventilated HAP could improve empirical antimicrobial therapy and reduce the use of broad-spectrum antibiotics.

Usefulness of point-of-care multiplex PCR to rapidly identify pathogens responsible for ventilator-associated pneumonia and their resistance to antibiotics: an observational study.

BACKGROUND: The use of multiplex PCR to shorten time to identification of pathogens and their resistance mechanisms for patients with ventilator-associated pneumonia (VAP) is attractive, but poorly studied. The multiplex PCR-based Unyvero pneumonia cartridge assay can directly identify 20 bacteria and one fungus, amongst the most frequently causing VAP, and 19 of their resistance markers in clinical specimens (bronchoalveolar lavage or tracheal aspirate), with a turnaround time of 4-5 h. We performed this study to evaluate the concordance between the multiplex PCR-based Unyvero pneumonia cartridge assay and conventional microbiological techniques to identify pathogens and their resistance mechanisms in patients with VAP. METHODS: All patients suspected of having VAP (January 2016 to January 2019), who underwent fiberoptic bronchoscopy with bronchoalveolar lavage fluid (BALF) and whose BALF microscopy examination revealed intracellular bacteria, were included. BALF conventional cultures (gold standard), antimicrobial susceptibility testing and processing for the Unyvero pneumonia cartridge were done. Culture and Unyvero results were compared. RESULTS: Compared to cultures of the 93 samples processed for both techniques, Unyvero correctly identified pathogens in 68 (73%) proven VAP episodes, was discordant for 25 (27%), detected no pathogen in 11 and overdetected a not otherwise found pathogen in six. For the eight remaining discordant results, the pathogen responsible for VAP was not included in the Unyvero cartridge panel or it grew at a non-significant level in culture. Amongst the 31 (33%) resistance mechanism discordances observed, 22 were resistance detection failures and 24 concerned Pseudomonas aeruginosa. CONCLUSIONS: Compared to conventional microbiological cultures, the Unyvero pneumonia cartridge had poor diagnostic performance: it correctly identified pathogens and their resistance mechanisms in 73% and 67% of VAP cases, respectively. The lack of performance on the resistance mechanism was more pronounced when the pathogen detected was a Pseudomonas aeruginosa.

Design of a multiplex quantitative reverse transcription-PCR system to simultaneously detect 16 pathogens associated with bovine respiratory and enteric diseases.

AIM: Bovine respiratory disease (BRD) and bovine enteric disease (BED) are two major diseases in cattle, resulting in severe economic losses in the dairy and beef industries. The two major diseases are associated with several factors such as viruses, bacteria, the health condition of the host and environmental factors. We aimed to design a new efficient diagnostic method, which rapidly detect causative pathogens, minimizing economic loss due to BRD and BED. METHODS AND RESULTS: We designed a multiplex quantitative reverse transcription-PCR (qRT-PCR) system for the simultaneous diagnosis of 16 pathogens, including 12 viruses and 4 bacteria related to BRD and BED, based on single qRT-PCR assays in previous studies. The designed multiplex qRT-PCR was highly sensitive and has minimal detection levels which will be no different from those of single qRT-PCR. Moreover, the multiplex qRT-PCR could more efficiently detect the causative pathogens than conventional RT-PCR in test using a part of BRD and BED clinical samples. Furthermore, our data revealed that the multiplex qRT-PCR had high performance in its specificity and reproducibility tests. CONCLUSIONS: Our system can effectively detect multiple BRD or BED related pathogens from each animal while testing several clinical samples via the multiplex qRT-PCR. It is more time-, cost- and labour-efficient than other diagnostic methods. SIGNIFICANCE AND IMPACT OF THE STUDY: Rapid detection of infected animals from the herd using our system will greatly contribute to infection control and prompt treatment in field.

[Comparison of Multiplex Nested PCR, In-house Real-Time PCR and Commercial Real-Time PCR Methods for the Detection of Plasmodium spp. from Blood Samples]. / Plasmodium spp.'nin Saptanmasinda Multipleks Nested PCR, In-house Gerçek Zamanli PCR ve Ticari Gerçek Zamanli PCR Yöntemlerinin Karsilastirilmasi.

Malaria is a life-threatening parasitic disease caused by the parasites belonging to Plasmodium genus. Microscopic examination of Giemsa stained blood smears is accepted as the gold standard diagnostic method. It is recommended to use more than one method in order to strengthen the laboratory diagnosis of malaria which is an important health problem in our country as in the whole world. In this study, it was aimed to compare the results of three different molecular methods and determine which molecular method could be used in the diagnostic algorithm to be applied. DNA was extracted from 280 whole blood sample stored in EDTA tubes using a commercial kit. Three different polymerase chain reaction (PCR) methods were used for the detection of Plasmodium spp. in DNA samples obtained and the results were compared. First, multiplex nested PCR was applied and then in-house real-time PCR (Rt-PCR) which was validated in our laboratory and a commercial Rt-PCR kit were applied. Multiplex nested PCR was accepted as the gold standard and 182 samples that were evaluated as Plasmodium spp. positive and 98 samples that were evaluated as negative were also studied by in-house and commercial Rt-PCR methods. In multiplex nested PCR's first step reaction 1670 base pairs (bp) band was observed in Plasmodium spp. positive samples and 117 bp band was observed in Plasmodium vivax positive samples in the second step reaction. Tm values of P.vivax positive samples were determined as 78-79 in the melting analysis of the in-house Rt-PCR. CT values of the positive samples in in-house Rt-PCR were between 20.03-31.71 and were between 17.26-34.94 in the commercial Rt-PCR. With the in-house Rt-PCR method 180 cases were determined as positive, while with the commercial Rt-PCR method 178 cases were determined as positive. Two samples with the in-house Rt-PCR and 4 samples with the commercial Rt-PCR were considered as false negative. When the sensitivity and specificity of the both methods were calculated, the sensitivity of the in-house Rt-PCR method was 0.98, the specificity was 0.97, the positive predictive value (PPV) was 98%, the negative predictive value (NPV) was 97%, the sensitivity of the commercial Rt-PCR was 0.97, the specificity was 0.95, the PPV was 97%, the NPV was 95%. A high level of agreement (κ: 0.953) was determined between the in-house and the commercial Rt-PCR methods. In order for a test to be accepted as a confirmatory test, its specificity must be high. It was decided that sensitivity and specificity of the in-house Rt-PCR were suitable for using this method in the laboratory diagnosis of Plasmodium species.

Simultaneous Detection and Differentiation between Wild-Type and Vaccine Measles Viruses by a Multiplex Real-Time Reverse Transcription-PCR Assay.

Measles is one of the most contagious viral respiratory infections and was declared to be eliminated from Canada in 1998; however, measles cases and outbreaks still occur every year through reintroduction from other parts of the world. Laboratory confirmation of measles virus (MV) RNA by real-time PCR provides a definitive diagnosis, and molecular analysis to determine the genotype is the only way to distinguish between wild-type and vaccine strains. This distinction is important since live attenuated vaccine strains are able to replicate in the patient and can be associated with rash and fever but are poorly transmissible, if at all. Prompt reporting of measles cases to local authorities, including differentiation between wild-type and vaccine strains, allows for optimal management and contact tracing. The development and validation of a multiplex real-time reverse transcription-PCR (rtRT-PCR) assay for the simultaneous detection and differentiation of the Moraten and Schwarz vaccine strains from presumptive wild-type MV in a format that can be easily implemented for high-throughput testing of patient samples are reported here. This assay is sensitive, specific, reproducible, and 100% accurate in comparison with the gold standard comparator assay.

PCR-Based Method for Shigella flexneri Serotyping: International Multicenter Validation.

Shigella spp. are a leading cause of human diarrheal disease worldwide, with Shigella flexneri being the most frequently isolated species in developing countries. This serogroup is presently classified into 19 serotypes worldwide. We report here a multicenter validation of a multiplex-PCR-based strategy previously developed by Q. Sun, R. Lan, Y. Wang, A. Zhao, et al. (J Clin Microbiol 49:3766-3770, 2011) for molecular serotyping of S. flexneri This study was performed by seven international laboratories, with a panel of 71 strains (researchers were blind to their identity) as well as 279 strains collected from each laboratory's own local culture collections. This collaborative work found a high extent of agreement among laboratories, calculated through interrater reliability (IRR) measures for the PCR test that proved its robustness. Agreement with the traditional method (serology) was also observed in all laboratories for 14 serotypes studied, while specific genetic events could be responsible for the discrepancies among methodologies in the other 5 serotypes, as determined by PCR product sequencing in most of the cases. This work provided an empirical framework that allowed the use of this molecular method to serotype S. flexneri and showed several advantages over the traditional method of serological typing. These advantages included overcoming the problem of availability of suitable antisera in testing laboratories as well as facilitating the analysis of multiple samples at the same time. The method is also less time-consuming for completion and easier to implement in routine laboratories. We recommend that this PCR be adopted, as it is a reliable diagnostic and characterization methodology that can be used globally for laboratory-based shigella surveillance.

Multiplex Real-Time PCR-shortTUB Assay for Detection of the Mycobacterium tuberculosis Complex in Smear-Negative Clinical Samples with Low Mycobacterial Loads.

Tuberculosis (TB) remains a major health problem worldwide. Control of TB requires rapid, accurate diagnosis of active disease. However, extrapulmonary TB is very difficult to diagnose because the clinical specimens have very low bacterial loads. Several molecular methods involving direct detection of the Mycobacterium tuberculosis complex (MTBC) have emerged in recent years. Real-time PCR amplification simultaneously combines the amplification and detection of candidate sequences by using fluorescent probes (mainly TaqMan or Molecular Beacons) in automated systems. The multiplex real-time PCR-short assay is performed using locked nucleic acid (LNA) probes (length, 8 to 9 nucleotides) in combination with CodUNG to detect multiple pathogens in clinical samples. In this study, we evaluated the performance of this novel multiplex assay for detecting the MTBC in comparison with that of the conventional culture-based method. The multiplex real-time PCR-shortTUB assay targets two genes, whiB3 (redox-responsive transcriptional regulator) and pstS1 (phosphate-specific transporter), yielding limits of detection (LOD) of 10 copies and 100 copies, respectively, and amplification efficiencies of 92% and 99.7%, respectively. A total of 94 extrapulmonary samples and pulmonary samples with low mycobacterial loads (all smear negative; 75 MTBC culture positive) were analyzed using the test, yielding an overall sensitivity of 88% and a specificity of 95%. For pleural fluid and tissues/biopsy specimens, the sensitivity was 83% and 85%, respectively. In summary, this technique could be implemented in routine clinical microbiology testing to reduce the overall turnaround time for MTBC detection and may therefore be a useful tool for the diagnosis of extrapulmonary tuberculosis and diagnosis using pulmonary samples with low mycobacterial loads.

Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri.

BACKGROUND: Arcobacter faecis and A. lanthieri are two newly classified species of genus Arcobacter. The prevalence and distribution of virulence, antibiotic resistance and toxin (VAT) genes in these species are required to assess their potential pathogenic health impacts to humans and animals. This study (i) developed species- and gene-specific primer pairs for the detection of six virulence, two antibiotic resistance, and three toxin genes in two target species; (ii) optimized eight single-tube multiplex and three monoplex PCR protocols using the newly developed species- and gene-specific primers; and (iii) conducted specificity and sensitivity evaluations as well as validation of eleven mono- and multiplex PCR assays by testing A. faecis (n= 29) and A. lanthieri (n= 10) strains isolated from various fecal and agricultural water sources to determine the prevalence and distribution of VAT genes and assess the degree of pathogenicity within the two species. RESULTS: Detection of all ten and eleven target VAT genes, and expression of cytolethal distending toxin (cdtA, cdtB and cdtC) genes in A. faecis and A. lanthieri reference strains with high frequency in field isolates suggest that they are potentially pathogenic strains. These findings indicate that these two species can pose a health risk to humans and animals. CONCLUSIONS: The study results show that the developed mono- and multiplex PCR (mPCR) assays are simple, rapid, reliable and sensitive for the simultaneous assessment of the potential pathogenicity and antibiotic resistance profiling of tet(O) and tet(W) genes in these two newly discovered species. Also, these assays can be useful in diagnostic and analytical laboratories to determine the pathotypes and assessment of the virulence and toxin factors associated to human and animal infections.

Multiplex STR panel for assessment of chimerism following hematopoietic stem cell transplantation (HSCT).

Short tandem repeat (STR) analysis is used in chimerism monitoring after allogeneic hematopoietic stem cell transplantation (HSCT) for patients with various hematologic malignancies. Commercial forensic STR kits often contain loci with huge differences in power of discrimination (PD) across populations, causing some loci to be less informative for chimerism analysis in certain populations. This study aimed to construct a new STR multiplex panel with highly informative loci for efficient chimerism analysis. Thirteen STR markers which exhibit high PD (> 0.9) in at least 80% of 50 populations globally were selected to form a new panel and used in STR analysis of 253 Malaysian subjects. Cumulative power of discrimination (CPD) and combined power of exclusion (CPE) were determined from 253 Malaysian individuals. Loci informativity was assessed and compared to the commercial AmpFLSTR Identifiler PCR Amplification kit in 14 donor-recipient pairs. The new panel had detected 202 unique alleles including five novel alleles from the 253 individuals with high CPD and CPE (> 0.99999999999999999 and > 0.999999997 respectively). All loci from the new panel in the donor-recipient pair analysis showed higher than 50% informativity, while five loci from the commercial kit demonstrated lower than 50% informativity. Four loci from the new panel ranked the highest informativity. A sequenced allelic ladder which consists of 202 unique alleles from the 253 subjects was also developed to ensure accurate allele designation. The new 13-loci STR panel, thus, could serve as an additional powerful, accurate, and highly informative panel for chimerism analysis for HSCT patients.

Development and evaluation of a one-step multiplex real-time TaqMan® RT-qPCR assay for the detection and genotyping of equine G3 and G14 rotaviruses in fecal samples.

BACKGROUND: Equine rotavirus A (ERVA) is the leading cause of diarrhea in neonatal foals and has a negative impact on equine breeding enterprises worldwide. Among ERVA strains infecting foals, the genotypes G3P[12] and G14P[12] are the most prevalent, while infections by strains with other genomic arrangements are infrequent. The identification of circulating strains of ERVA is critical for diagnostic and surveillance purposes, as well as to understand their molecular epidemiology. Current genotyping methods available for ERVA and rotaviruses affecting other animal species rely on Sanger sequencing and are significantly time-consuming, costly and labor intensive. Here, we developed the first one-step multiplex TaqMan® real-time reverse transcription polymerase chain reaction (RT-qPCR) assay targeting the NSP3 and VP7 genes of ERVA G3 and G14 genotypes for the rapid detection and G-typing directly from fecal specimens. METHODS: A one-step multiplex TaqMan® RT-qPCR assay targeting the NSP3 and VP7 genes of ERVA G3 and G14 genotypes was designed. The analytical sensitivity was assessed using serial dilutions of in vitro transcribed RNA containing the target sequences while the analytical specificity was determined using RNA and DNA derived from a panel of group A rotaviruses along with other equine viruses and bacteria. The clinical performance of this multiplex assay was evaluated using a panel of 177 fecal samples and compared to a VP7-specific standard RT-PCR assay and Sanger sequencing. Limits of detection (LOD), sensitivity, specificity, and agreement were determined. RESULTS: The multiplex G3 and G14 VP7 assays demonstrated high specificity and efficiency, with perfect linearity. A 100-fold difference in their analytical sensitivity was observed when compared to the singleplex assays; however, this difference did not have an impact on the clinical performance. Clinical performance of the multiplex RT-qPCR assay demonstrated that this assay had a high sensitivity/specificity for every target (100% for NSP3, > 90% for G3 VP7 and > 99% for G14 VP7, respectively) and high overall agreement (> 98%) compared to conventional RT-PCR and sequencing. CONCLUSIONS: This new multiplex RT-qPCR assay constitutes a useful, very reliable tool that could significantly aid in the rapid detection and G-typing of ERVA strains circulating in the field.