Severe neonatal seizures: From molecular diagnosis to precision therapy?

Early onset epileptic encephalopathies (EOEE) are heterogeneous group of severe epilepsies that still need to be better defined and characterized. On a genetic point of view, several dozen of genes have been associated with EOEE, and to date, it is difficult to find a common mechanism to explain EOEE. In this short review, we show that two mains genes are involved in EOEE: STXBP1 and KCNQ2. Focusing on KCNQ2 related EOEE, we show that a relatively similar phenotype can be related to various consequences of mutations on a single gene. This will probably challenge the treatment of EOEE patients.

[Health status and quality of life in ß-thalassemia adults in Marseille, France]. / État de santé et qualité de vie des patients ß-thalassémiques adultes à Marseille, France.

INTRODUCTION: The life expectancy of ß-thalassemia patients has increased over the last 20 years. In this study, we evaluated the current health status and quality of life of these patients managed in a reference center in Marseille. METHODS: This is a single-center, descriptive study conducted between June and August 2019 in patients over 18 years of age with ß-thalassemia major or intermedia. Clinical and paraclinical data were collected retrospectively and the SF-36 health survey questionnaire was proposed to each patient. RESULTS: 43 of 64 selected patients were included and divided into 2 groups: 35 patients with transfusion-dependent ß-thalassemia and 8 patients with non-transfusion-dependent ß-thalassemia. Liver iron overload is the most frequent complication, present in 80% of transfusion-dependent and 62.5% of non-transfusion-dependent patients. Cardiac iron overload is present only in the transfusion dependent ß-thalassemia group (20%). Hypogonadotropic hypogonadism remains the most common endocrine disorder (41.9%) followed by osteoporosis (37.2%). Among the 31 patients who completed the SF-36 questionnaire, physical and mental quality of life scores were lowered in transfusion dependent (respectively 42.7 and 46.8) as in non-transfusion-dependent patients (respectively 43.8 and 28.9). CONCLUSION: Despite an improvement in medical care, our patients with ß-thalassemia show an alteration in their quality of life that will need to be characterized in the entire French cohort.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

New KCNN4 Variants Associated With Anemia: Stomatocytosis Without Erythrocyte Dehydration.

The K+ channel activated by the Ca2+, KCNN4, has been shown to contribute to red blood cell dehydration in the rare hereditary hemolytic anemia, the dehydrated hereditary stomatocytosis. We report two de novo mutations on KCNN4, We reported two de novo mutations on KCNN4, V222L and H340N, characterized at the molecular, cellular and clinical levels. Whereas both mutations were shown to increase the calcium sensitivity of the K+ channel, leading to channel opening for lower calcium concentrations compared to WT KCNN4 channel, there was no obvious red blood cell dehydration in patients carrying one or the other mutation. The clinical phenotype was greatly different between carriers of the mutated gene ranging from severe anemia for one patient to a single episode of anemia for the other patient or no documented sign of anemia for the parents who also carried the mutation. These data compared to already published KCNN4 mutations question the role of KCNN4 gain-of-function mutations in hydration status and viability of red blood cells in bloodstream.

Dunnigan lipodystrophy syndrome: French National Diagnosis and Care Protocol (PNDS; Protocole National de Diagnostic et de Soins).

Dunnigan syndrome, or Familial Partial Lipodystrophy type 2 (FPLD2; ORPHA 2348), is a rare autosomal dominant disorder due to pathogenic variants of the LMNA gene. The objective of the French National Diagnosis and Care Protocol (PNDS; Protocole National de Diagnostic et de Soins), is to provide health professionals with a guide to optimal management and care of patients with FPLD2, based on a critical literature review and multidisciplinary expert consensus. The PNDS, written by members of the French National Reference Center for Rare Diseases of Insulin Secretion and Insulin Sensitivity (PRISIS), is available on the French Health Authority website (in French). Dunnigan syndrome is characterized by a partial atrophy of the subcutaneous adipose tissue and by an insulin resistance syndrome, associated with a risk of metabolic, cardiovascular and muscular complications. Its prevalence, assessed at 1/100.000 in Europe, is probably considerably underestimated. Thorough clinical examination is key to diagnosis. Biochemical testing frequently shows hyperinsulinemia, abnormal glucose tolerance and hypertriglyceridemia. Elevated hepatic transaminases (hepatic steatosis) and creatine phosphokinase, and hyperandrogenism in women, are common. Molecular analysis of the LMNA gene confirms diagnosis and allows for family investigations. Regular screening and multidisciplinary monitoring of the associated complications are necessary. Diabetes frequently develops from puberty onwards. Hypertriglyceridemia may lead to acute pancreatitis. Early atherosclerosis and cardiomyopathy should be monitored. In women, polycystic ovary syndrome is common. Overall, the management of patients with Dunnigan syndrome requires the collaboration of several health care providers. The attending physician, in conjunction with the national care network, will ensure that the patient receives optimal care through regular follow-up and screening. The various elements of this PNDS are described to provide such a support.

Mutations in NBAS and SCYL1, genetic causes of recurrent liver failure in children: Three case reports and a literature review.

Acute liver failure (ALF) in childhood is a life-threatening emergency. ALF is often caused by drug toxicity, autoimmune hepatitis, inherited metabolic diseases, and infections. However, despite thorough investigations, a cause cannot be determined in approximately 50% of cases. Here, we report three cases with recurrent ALF caused by NBAS and SCYL1 pathogenic variants. These patients did not present with any other phenotypic sign usually associated with NBAS and SCYL1 pathogenic variants. Two of them underwent liver transplantation and are healthy without recurrence of ALF. We propose NBAS and SCYL1 genetic analysis in children with unexplained fever-triggered recurrent ALF even without a typical phenotype.

Primary red cell hydration disorders: Pathogenesis and diagnosis.

Hydration status is critical for erythrocyte survival and is mainly determined by intracellular cation content. Active pumps, passive transporters, and ion channels are the key components of volume homeostasis, whereas water passively fits ionic movements. Whenever cation content increases, erythrocyte swells, whereas it shrinks when cation content decreases. Thus, inappropriate cation leak causes erythrocyte hydration disorders, hemolytic anemia, and characteristic red cell shape abnormalities named stomatocytosis. All types of stomatocytosis either overhydrated or dehydrated are linked to inherited or de novo mutations in genes encoding ion transporters or channels. Although intracellular ion content can be assessed by experimental methods, laboratory diagnosis is guided by a combination of red blood cell parameters and deformability measurement when possible, and confirmed by sequencing of the putative genes. A better knowledge of the mechanisms underlying erythrocyte hydration imbalance will further lead to therapeutic improvements.

[NISCH syndrome, a rare cause of neonatal cholestasis: A case report]. / Le syndrome NISCH, une cause rare de cholestase néonatale : à propos d'un cas.

NISCH syndrome is a rare autosomal recessive disease. It is characterized by scalp hypotrichosis, scarring alopecia, ichthyosis, and neonatal sclerosing cholangitis. It is caused by mutations in the CLDN1 gene encoding the claudin-1 protein, which is located at tight junctions. Fifteen cases have been reported to date and three different mutations have been identified. We report on the case of a 2-year-old boy from a consanguineous Moroccan family, presenting with NISCH syndrome and carrying the so-called Moroccan homozygous mutation (c.200-201delTT). The patient presented with the characteristic symptoms of the syndrome and a favorable progression with normalization of hepatic analyses under symptomatic treatment (vitamin supplementation and ursodeoxycholic acid). The currently limited availability of clinical and therapeutic data does not allow accurate prediction of the course of the disease and short- and long-term prognosis. Moreover, substantial interindividual variability has been reported. Description of new cases will provide new insights into the understanding and the overall management of this syndrome, the course of which remains elusive.

[Next-generation DNA sequencing in clinical diagnostics]. / Le séquençage d'ADN à haut débit en pratique clinique.

The advent of next generation sequencing (NGS) technologies is so scale-changing that it modifies molecular diagnostics indications and induces laboratories to rethink their diagnostic strategies, until now based on the Sanger sequencing routine. Several high-throughput approaches are available from the sequencing of a gene panel, to an exome, or even a genome. In all cases, a tremendous amount of data is generated, which has to be filtered, interpreted and analyzed using powerful bioinformatics tools. In parallel, ethical considerations are raised to avoid the potential drifts of these powerful approaches. In all medical fields, and particularly in pediatrics, this new strategy offers better efficacy and faster mutation identification, allowing better support and care for patients and their families and even improving genetic counseling. In the present paper, we discuss the different NGS-based approaches and strategies as well as the issues involved in these new technologies applied to molecular diagnosis of rare diseases. Altogether, rare diseases affect more than 3 million people in France and are responsible for about one-third of childhood deaths.

[Beta(o)/beta(o) thalassemia with a mild phenotype]. / Thalassémie beta(o)/beta(o) avec phénotype "intermédiaire": un diagnostic rare... auquel il faut penser.

We report the case of a 30 years old patient of Algerian origin, presenting a beta-thalassemia major with a phenotype of intermediate severity. Its genotype is beta(o)/beta(o), leading to a complete absence of beta-globin synthesis. This genotype is usually responsible for major clinical complications and a severe anaemia requiring regular transfusions. However, the patient presents with a mild form of the disease and a moderate relatively well tolerated anaemia. This phenotype was found related to a high level of synthesis of foetal haemoglobin, dependent most probably on an homozygous state for the polymorphism (XmnI -158, C>T) in the promoter of the Ggamma gene. This observation shows that it is important to keep in mind that beta-thalassemia major may have a mild or intermediate phenotype because of polymorphisms of the beta locus.

[ATR-X syndrome: a new mutation in the XNP/ATRX gene near the helicase domain]. / Syndrome ATR-X: une nouvelle mutation du gène XNP/ATRX à proximité du domaine hélicase.

The alpha-thalassemia/mental retardation syndrome, X linked, also named ATR-X syndrome is a X-linked mental retardation syndrome. Mutations have been found in the ATRX gene in about one half of the patients. We report a typical clinical case. The clinical evidence leads us to continue the analysis of the gene despite a negative first screening. Indeed a new mutation was found, just behind the helicase domain, bringing up the interest of an effective collaboration between physicians and biologists.

[Oculocutaneous albinism in French overseas territories (Reunion, French Guyana, Martinique) and Mayotte. Study of 21 cases in 16 families]. / L'albinisme oculocutané dans les départements français d'Outre-Mer (Réunion, Guyane, Martinique) et à Mayotte: à propos de 21 observations dans 16 familles.

The dual purpose of this study was to determine the genotype of patients with oculocutaneous albinism type 1 and 2 based on analysis of tyrosinase and P gene mutations and to attempt to establish a correlation between phenotype and genotype. This study included a total of 21 Caucasian, Indian and Black African patients from La Reunion, la Martinique, French Guyana and Mayotte. PCR-sequencing of genomic DNA was performed to detect tyrosinase gene mutations and PCR-separation of PCR products by agarose gel electrophoresis was performed to detect 2.7kb deletion allele of the P gene. Tyrosinase gene mutations were identified in two cases, i.e., on eheterozygous guanine "g" deletion (c.572 delG) with a frameshift (Gly191fs) resulting in apremature termination signal at codon 225 in a Caucasian patient from La Reunion and one homozygous missense mutation, Glycine419Arginine, in an Indian patient from La Reunion. The 2.7-kb deletion allele of the P gene was detected in three Black African patients, i.e. two in the homozygous state in siblings from Mayotte and one in the heterozygous state in a girl from la Martinique. The latter patient whose mother was from la Martinique inherited the mutation from her father who was from Cameroon. This study shows that characterization of tyrosinase and P gene mutations in albinos patients is crucial to (a) differentiate subjects with oculocutaneous albinism types 1 and 2 and establish a correlation between phenotype and genotype, (b) identify healthy heterozygous carriers among the patient's immediate family (parents and siblings) and (c) allow prenatal diagnosis during subsequent pregnancies in couples who have already engendered albino children with severe visual phenotype and documented mutation(s).

Molecular basis of haemoglobinopathies and G6PD deficiency in the Comorian population.

INTRODUCTION: The Comoro archipelago is characterised by a high prevalence of red cell genetic disorders such as G6PD deficiency and haemoglobinopathies, being a region endemic for malaria. Over the last 15 years, the city of Marseilles in France has become the main destination for Comorian immigrants. This Comorian community includes patients with sickle cell disease, sickle cell/beta-thalassaemia trait, thalassaemias and G6PD deficiency. MATERIALS AND METHODS: Allele frequencies for haemoglobin S, beta-thalassaemia and G6PD deficiency were determined from neonatal and prenatal screenings of the Comorian community. Haemoglobin fractions were detected by isoelectrofocalisation, and the quantitation of HbS, HbA, HbA(2) and HbF was performed by cation exchange high performance liquid chromatography. The molecular study involved 31 alleles carrying the betaS mutation (Cd 6 [A-->T]), six beta-thalassaemic alleles and 17 G6PD-deficient alleles, selected from a group of carriers or affected subjects. RESULTS: Allele frequencies were 3% for haemoglobin S, 1% for beta-thalassaemia trait and 9.5% for G6PD deficiency. Molecular analysis had revealed that the African alleles are predominant, being present in almost all the subjects studied. Mediterranean alleles were found for all the beta-thalassaemia mutations and for three G6PD chromosomes out of 17. CONCLUSION: These data are consistent with the mixed Arab and African origin of the population of the Comoro Islands, and are of clinical interest in prenatal and newborn screening plans.

Outcome of a school screening programme for carriers of haemoglobin disease.

OBJECTIVES: To assess the impact of a screening programme for haemoglobinopathies which was organised from 1978 to 1985 in high secondary schools of the Marseille region. METHODS: Several variables that reflected the influence of this preventive programme on the uptake of prenatal diagnosis were investigated. To evaluate the partner's uptake for the testing, a letter was sent, together with an anonymous questionnaire, to all the haemoglobin carriers detected in this programme. To evaluate the number of prenatal diagnoses, the charts of all couples from the Marseille area who underwent genetic counselling for haemoglobinopathies were compiled. The number of affected children born between 1980 to 2000 was recorded, and the cases in which one of the parents had previously been screened at school were noted. RESULTS: Half of the carriers replied to the questionnaire: 86% knew that they have to test their partner. Six carrier couples were identified, four asked for genetic counselling and requested eight prenatal diagnoses, two couples did not request genetic counselling and have had two affected children. CONCLUSIONS: Despite the time lapse between screening, informing, and pregnancy (mean 15 years), the information was well conserved and resulted in testing of the partner. The screening programme was effective in motivating requests for prenatal diagnosis.

Compound heterozygosity Hb S/Hb Hope (beta 136 Gly-->Asp): a pitfall in the newborn screening for sickle cell disease.

The presence of Hb Hope associated with Hb S may represent a pitfall (false positive) in the neonatal detection of sickle cell disease by two of the most widely used analytical methods in screening programmes-isoelectric focusing (IEF) and high performance liquid chromatography (HPLC). This example illustrates the need to improve analytical strategies to avoid unnecessary anxiety and summoning of families often from a cultural background in which testing of the father is difficult to obtain. It is suggested that using two independent HPLC procedures might improve the specificity of the screening strategies. Additionally, simple procedures for detection of the most common mutations of the beta globin gene of DNA extracted from dried blood specimens could be easily developed for the control of abnormal samples. These procedures could be introduced into the analytical strategy.

[Prevention of hemoglobinopathies in non-endemic countries]. / La prévention des hémoglobinopathies dans les pays non endémiques.

Although hemoglobinopathies are primarily found in Africa, India, SouthEast Asia and the Mediterranean area, their distribution is becoming worldwide due to increased migration. Unlike other genetic diseases, carriers can be detected by simple and cost-effective means. Prenatal hemoglobinopathy screening is possible and direct prenatal diagnosis can be offered to couples at risk of giving birth to a child affected by a major defect of the beta-globin chain. Several hemoglobinopathy screening programmes have been organised in various countries of Northern Europe and have been effective in identifying couples at risk.