An Improved Evans Blue Staining Method for Consistent, Accurate Assessment of Plasmodiophora brassicae Resting Spore Viability.

Clubroot caused by Plasmodiophora brassicae is an important disease of brassica crops. The use of vital stains to determine the viability of P. brassicae resting spores can provide useful information regarding spore longevity, inoculum potential, or the efficacy of antimicrobial treatments. Evans blue is one example of a vital stain that has been reported to differentially stain viable and nonviable resting spores. Some previously published protocols using Evans blue to stain P. brassicae resting spores have not provided accurate or consistent results. In this study, we modified the Evans blue method by increasing the staining time to 8 h or more and evaluated P. brassicae resting spores after heat treatment at various combinations of temperature and time. Extending staining times significantly increased the numbers of stained resting spores up to 7 h, after which the numbers of stained spores did not change significantly (R2 = 96.88; P ≤ 0.001). The accuracy of the modified method to discriminate viable and nonviable spores was evaluated in repeated experiments and by comparing the staining data with those derived from inoculation assays and propidium monoazide quantitative PCR (qPCR). The results demonstrated that the modified Evans blue staining method improved the accuracy and consistency of measurement of P. brassicae resting spore viability. Additionally, it was equivalent to the qPCR method for differentiating viable and nonviable spores (R2 = 99.84; P ≤ 0.001) and confirmed in canola infection bioassays.

Adaptive working memory strategy training in early Alzheimer's disease: randomised controlled trial.

BACKGROUND: Interventions that improve cognitive function in Alzheimer's disease are urgently required. AIMS: To assess whether a novel cognitive training paradigm based on 'chunking' improves working memory and general cognitive function, and is associated with reorganisation of functional activity in prefrontal and parietal cortices (trial registration: ISRCTN43007027). METHOD: Thirty patients with mild Alzheimer's disease were randomly allocated to receive 18 sessions of 30 min of either adaptive chunking training or an active control intervention over approximately 8 weeks. Pre- and post-intervention functional magnetic resonance imaging (fMRI) scans were also conducted. RESULTS: Adaptive chunking training led to significant improvements in verbal working memory and untrained clinical measures of general cognitive function. Further, fMRI revealed a bilateral reduction in task-related lateral prefrontal and parietal cortex activation in the training group compared with controls. CONCLUSIONS: Chunking-based cognitive training is a simple and potentially scalable intervention to improve cognitive function in early Alzheimer's disease.

Effects of electromagnetic fields emitted by GSM phones on working memory: a meta-analysis.

BACKGROUND AND OBJECTIVE: Current treatments for Alzheimer's Disease (AD) do not affect the course of the illness and brain stimulation techniques are increasingly promoted as potential therapeutic interventions for AD. This study reviews the effects of electromagnetic field (EMF) exposure versus sham exposure on working memory (WM) performance of healthy human participants. METHOD: Online literature databases and previous systematic reviews were searched for studies of EMF and WM in participants without reported memory problems. Two thousand eight hundred and fifty seven studies were identified, and 10 studies met the inclusion criteria. An assessment of study quality was completed, and separate, random effects meta-analyses were conducted for each of the three WM tasks included: n-back, substitution and digit span forward. RESULTS: No differences were found between participants exposed to active EMF versus sham conditions in any of the three working memory tasks examined. CONCLUSION: Results indicate that EMF does not affect WM during the n-back, substitution and digit-span tasks. Future studies should focus on the possible effects of chronic exposure to EMF in older adults with AD using a battery of comparable WM and attention tasks, before EMF can be seriously considered as a potential modulator of WM in AD. Copyright © 2016 John Wiley & Sons, Ltd.

Backscattered electron SEM imaging of resin sections from plant specimens: observation of histological to subcellular structure and CLEM.

We have refined methods for biological specimen preparation and low-voltage backscattered electron imaging in the scanning electron microscope that allow for observation at continuous magnifications of ca. 130-70 000 X, and documentation of tissue and subcellular ultrastructure detail. The technique, based upon early work by Ogura & Hasegawa (1980), affords use of significantly larger sections from fixed and resin-embedded specimens than is possible with transmission electron microscopy while providing similar data. After microtomy, the sections, typically ca. 750 nm thick, were dried onto the surface of glass or silicon wafer and stained with heavy metals-the use of grids avoided. The glass/wafer support was then mounted onto standard scanning electron microscopy sample stubs, carbon-coated and imaged directly at an accelerating voltage of 5 kV, using either a yttrium aluminum garnet or ExB backscattered electron detector. Alternatively, the sections could be viewed first by light microscopy, for example to document signal from a fluorescent protein, and then by scanning electron microscopy to provide correlative light/electron microscope (CLEM) data. These methods provide unobstructed access to ultrastructure in the spatial context of a section ca. 7 × 10 mm in size, significantly larger than the typical 0.2 × 0.3 mm section used for conventional transmission electron microscopy imaging. Application of this approach was especially useful when the biology of interest was rare or difficult to find, e.g. a particular cell type, developmental stage, large organ, the interface between cells of interacting organisms, when contextual information within a large tissue was obligatory, or combinations of these factors. In addition, the methods were easily adapted for immunolocalizations.

Organ Procurement Organizations and the Electronic Health Record.

The adoption of electronic health records (EHRs) has adversely affected the ability of organ procurement organizations (OPOs) to perform their federally mandated function of honoring the donation decisions of families and donors who have signed the registry. The difficulties gaining access to potential donor medical record has meant that assessment, evaluation, and management of brain dead organ donors has become much more difficult. Delays can occur that can lead to potential recipients not receiving life-saving organs. For over 40 years, OPO personnel have had ready access to paper medical records. But the widespread adoption of EHRs has greatly limited the ability of OPO coordinators to readily gain access to patient medical records and to manage brain dead donors. Proposed solutions include the following: (1) hospitals could provide limited access to OPO personnel so that they could see only the potential donor's medical record; (2) OPOs could join with other transplant organizations to inform regulators of the problem; and (3) hospital organizations could be approached to work with Center for Medicare and Medicaid Services (CMS) to revise the Hospital Conditions of Participation to require OPOs be given access to donor medical records.

Hippocampal abnormalities and age in chronic schizophrenia: morphometric study across the adult lifespan.

BACKGROUND: Hippocampal abnormalities have been demonstrated in schizophrenia. It is unclear whether these abnormalities worsen with age, and whether they affect cognition and function. AIMS: To determine whether hippocampal abnormalities in chronic schizophrenia are associated with age, cognition and socio-occupational function. METHOD: Using 3 T magnetic resonance imaging we scanned 100 persons aged 19-82 years: 51 were out-patients with stable schizophrenia at least 2 years after diagnosis and 49 were healthy volunteers matched for age and gender. Automated analysis was used to determine hippocampal volume and shape. RESULTS: There were differential effects of age in the schizophrenia and control samples on total hippocampal volume (group × age interaction: F(1,95) = 6.57, P = 0.012), with steeper age-related reduction in the schizophrenia group. Three-dimensional shape analysis located the age-related deformations predominantly in the mid-body of the hippocampus. In the schizophrenia group similar patterns of morphometric abnormalities were correlated with impaired cognition and poorer socio-occupational function. CONCLUSIONS: Hippocampal abnormalities are associated with age in people with chronic schizophrenia, with a steeper decline than in healthy individuals. These abnormalities are associated with cognitive and functional deficits, suggesting that hippocampal morphometry may be a biomarker for cognitive decline in older patients with schizophrenia.

Investigating geographic variation in mortality in the context of organ donation.

Organ procurement organizations (OPOs) report a nearly fourfold difference in donor availability as measured by eligible deaths per million population (PMP) based on hospital referrals. We analyzed whether mortality data help explain geographic variation in organ supply as measured by the number of eligible deaths for organ donation. Using the 2007 National Center for Health Statistics' mortality data, we analyzed deaths occurring in acute care hospitals, aged ≤ 70 years from cerebrovascular accidents and trauma. These deaths were mapped at the county level and compared to eligible deaths reported by OPOs. In 2007, there were 2 428 343 deaths reported in the United States with 42 339 in-hospital deaths ≤ 70 years from cerebrovascular accidents (CVA) or trauma that were correlated with eligible deaths PMP (r(2) = 0.79.) Analysis revealed a broad range in the death rate across OPOs: trauma deaths: 44-118 PMP; deaths from CVA: 34-118 PMP; and combined CVA and trauma: 91-229 PMP. Mortality data demonstrate that deaths by neurologic criteria of people who are likely to be suitable deceased donors are not evenly distributed across the nation. These deaths are correlated with eligible deaths for organ donation. Regional availability of organs is affected by deaths which should be accounted for in the organ allocation system.

Semantic memory and language dysfunction in early Alzheimer's disease: a review.

BACKGROUND: Language impairment in Alzheimer's disease occurs early, and language function deteriorates with progression of the illness to cause significant disability. This review focuses on language dysfunction in Alzheimer's disease and the contribution of semantic memory impairment. METHODS: Electronic publication databases were searched for literature relevant to the review. Additionally, individual references were examined to elicit further studies not found by online search. RESULTS: Language impairment in Alzheimer's disease initially affects verbal fluency and naming before breakdown in other facets. Naming and fluency require integrity of semantic concepts, and dysfunction may be a marker of primary semantic memory impairment rather than overall cognitive decline. Research suggests the presence of semantic loss several years prior to diagnosis. Imaging studies indicate an altered connectivity state with respect to language networks, and this is associated with potential semantic failure. This state may also be present in individuals with established risk factors for Alzheimer's disease. Compensatory recruitment of alternative cortical areas to supplement language function appears to occur and may be a target for future intervention. CONCLUSIONS: Identifying and classifying the nature and degree of language impairment more closely could aid in developing targeted therapies. Treatments already established in other aphasic states, such as post-stroke, may be especially relevant. The nature of these and the protective nature of cognitive reserve are potential therapeutic avenues.

First Report of Phytophthora infestans Genotype US23 Causing Late Blight in Canada.

Late blight is caused by the oomycete Phytophthora infestans (Mont.) de Bary and is one of the most devastating diseases of potato and tomato. Late blight occurs in all major potato- and tomato-growing regions of Canada. Its incidence in North America increased during 2009 and 2010 (2). Foliar disease symptoms appeared earlier than usual (June rather than July) and coincided with the identification of several new P. infestans genotypes in the United States, each with unique characteristics. Prior to 2007, isolates collected from potato and tomato crops were mainly US8 or US11 genotypes (1). However, P. infestans populations in the United States have recently experienced a major genetic evolution, producing isolates with unique genotypes and epidemiological characteristics in Florida and throughout the northeastern states (2). Recent discoveries of tomato transplants with late blight for sale at Canadian retail outlets prompted an examination of the genotypes inadvertently being distributed and causing disease in commercial production areas in Canada. Analysis of isolates of P. infestans from across Canada in 2010 identified the US23 genotype for the first time from each of the four western provinces (Manitoba, Saskatchewan, Alberta, and British Columbia) but not from eastern Canada. Allozyme banding patterns at the glucose phosphate isomerase (Gpi) locus indicated a 100/100 profile consistent with US6 and US23 genotypes (4). Mating type assays confirmed the isolates to be A1 and in vivo metalaxyl sensitivity was observed. Restriction fragment length polymorphic analysis of 50 isolates from western Canada with the multilocus RG57 sequence and EcoRI produced the DNA pattern 1, 2, 5, 6, 10, 13, 14, 17, 20, 21, 24, 24a, 25 that was indicative of US23 (3). The recently described P. infestans genotype US23 appears to be more aggressive on tomato, and although isolates were recovered from both tomato and potato, disease symptoms were often more severe on tomato. Results indicate that movement and evolution of new P. infestans genotypes have contributed to the increased incidence of late blight and that movement of the pathogen on retail plantlets nationally and internationally may provide an additional early season source of inoculum. A major concern is that the introduced new A1 populations in western Canada have established a dichotomy with the endogenous A2 populations in eastern Canada, increasing the potential for sexual recombination producing oospores and additional genotypes should these populations merge. References: (1) Q. Chen et al. Am. J. Potato Res. 80:9, 2003. (2) K. Deahl. (Abstr.) Phytopathology 100(suppl.):S161, 2010. (3) S. B. Goodwin et al. Curr. Genet. 22:107, 1992. (4) S. B. Goodwin et al. Phytopathology 88:939, 2004.

Knob-positive and knob-negative Plasmodium falciparum differ in expression of a strain-specific malarial antigen on the surface of infected erythrocytes.

We have investigated the expression of a strain-specific malarial antigen on the surface of erythrocytes infected with knobless (K-) variants of knob-positive (K+) strains of Plasmodium falciparum. Aotus blood infected with K+ or K- parasites derived from two independent geographical isolates (Malayan camp and Santa Lucia) was surface iodinated by the lactoperoxidase method. Infected and uninfected erythrocytes were then separated by a new procedure involving equilibrium density sedimentation on a Percoll gradient containing sorbitol. Strain-specific antigens were readily identified on the surface of erythrocytes infected with either of the K+ strains by their characteristic size and detergent solubility. These proteins were not detected on the surface of erythrocytes infected with either of the K- variants nor on uninfected erythrocytes isolated from K+- or K- -infected blood. These results are consistent with a role for the strain-specific surface antigen in cytoadherence of P. falciparum-infected erythrocytes. Our findings represent the second biochemical difference (with the knob-associated histidine-rich protein) between K+ and K- P. falciparum.

Identification of a strain-specific malarial antigen exposed on the surface of Plasmodium falciparum-infected erythrocytes.

We have identified strain-specific antigens with Camp and St. Lucia strains of P. falciparum of Mr approximately 285,000 and approximately 260,000, respectively. These strain-specific antigens were metabolically labeled with radioactive amino acids, indicating that they were of parasite origin rather than altered host components. These proteins had the properties of a molecule exposed on the surface of infected erythrocytes (IE). First, the proteins are accessible to lactoperoxidase-catalyzed radioiodination of IE. Second, the radioiodinated proteins were cleaved by low concentrations of trypsin (0.1 microgram/ml). Third, these antigens were immunoprecipitated after addition of immune sera to intact IE. Fourth, the strain-specific immuno-precipitation of these proteins correlated with the capacity of immune sera to block cytoadherence of IE in a strain-specific fashion. Fifth, the strain-specific antigen had detergent solubility properties (i.e., insolubility in 1% Triton X-100, solubility in 5% sodium dodecyl sulfate) similar to the variant antigen of P. knowlesi, which has been proven to be a malarial protein exposed on the erythrocyte surface.

The glomerular mesangium. 3. Acute immune mesangial injury: a new model of glomerulonephritis.

A mechanism of immune glomerular injury is described based on the fixation of antibody (Ab) to an antigen (Ag) that has localized in the glomerular mesangium. Rabbits were given, intravenously (i.v.), aggregated human IgG (AHIgG) or albumin (AHSA) and 10 h later, when the Ag by immunofluorescent microscopy was present in the mesangium, a kidney was removed and transplanted into a normal rabbit. The recipient then received, i.v., rabbit anti-HIgG or anti-HSA. Within minutes of Ab infusion, glomeruli of the donor kidney had polymorphonuclear (PMN) infiltration that over the next few hours became marked and was associated with glomerular cell swelling. At 24 h a decrease in PMN's and early mesangial proliferation was seen. By 3 days there was marked mesangial hypercellularity and increased mesangial matrix. Within minutes after Ab administration rabbit IgG, C3, and fibrin were seen in the glomerular mesangium. There was a fall in complement titer by 1 min after Ab infusion that was due to complement consumption by the donor kidney. Complement then returned to normal levels by 48 h. Significant glomerular injury did not occur (a) in the recipient's own kidney, (b) from Ag administration and transplantation without recipient Ab administration, or (c) from transplantation and Ab administration without prior Ag administration. These studies demonstrated that Ag localized in the glomerular mesangium can react with circulating Ab and complement resulting in severe glomerular injury.

Working memory in early Alzheimer's disease: a neuropsychological review.

BACKGROUND: Reports of the extent of working memory (WM) impairment in early Alzheimer's disease (AD) have been inconsistent. Using the model of WM proposed by Baddeley, neuropsychological evidence for the impairment of WM in early AD is evaluated. METHOD: Literature searches were performed using Medline, PsycINFO and Embase databases. Individual papers were then examined for additional references not revealed by computerised searches. RESULTS: Phonological loop function is intact at the preclinical and early stages of AD, becoming more impaired as the disease progresses. In mild AD, there is impairment on tasks assessing visuospatial sketchpad (VSS) function; however, these tasks also require executive processing by the central executive system (CES). There is evidence that the CES is impaired in mild AD and may be affected in the earlier preclinical stage of the disease. Episodic buffer function may be impaired but further research is required. CONCLUSIONS: Future research into central executive functioning at the earliest stages of the disease, combined with further longitudinal studies, needs to be carried out. Tasks to assess the proposed functions of the episodic buffer and specific tests of the VSS suitable for AD subjects need to be developed and validated. Learning more about these processes and how they are affected in AD is important in understanding and managing the cognitive deficits seen in the early stages of AD.

First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi.

Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 µm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 µm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 µm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5'GCATCGATGAAGAACGCAGC3' and 5'TCCTCCGCTTATTGATATGC3' specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.

Arrangement and symmetry of the fungal E3BP-containing core of the pyruvate dehydrogenase complex.

The pyruvate dehydrogenase complex (PDC) is a multienzyme complex central to aerobic respiration, connecting glycolysis to mitochondrial oxidation of pyruvate. Similar to the E3-binding protein (E3BP) of mammalian PDC, PX selectively recruits E3 to the fungal PDC, but its divergent sequence suggests a distinct structural mechanism. Here, we report reconstructions of PDC from the filamentous fungus Neurospora crassa by cryo-electron microscopy, where we find protein X (PX) interior to the PDC core as opposed to substituting E2 core subunits as in mammals. Steric occlusion limits PX binding, resulting in predominantly tetrahedral symmetry, explaining previous observations in Saccharomyces cerevisiae. The PX-binding site is conserved in (and specific to) fungi, and complements possible C-terminal binding motifs in PX that are absent in mammalian E3BP. Consideration of multiple symmetries thus reveals a differential structural basis for E3BP-like function in fungal PDC.

Cytoplasmic microtubules and fungal morphogenesis: ultrastructural effects of methyl benzimidazole-2-ylcarbamate determined by freeze-substitution of hyphal tip cells.

The effects of methyl benzimidazole-2-ylcarbamate (MBC), one of only a few agents that are active against microtubules of fungi, were analyzed at the ultrastructural level in freeze-substituted hyphal tip cells of Fusarium acuminatum. Nontreated and control cells had numerous microtubules throughout. After just 10 min of exposure to MBC, almost no cytoplasmic microtubules were present, except near spindle pole bodies. After 45 min of exposure to MBC, no microtubules were present in hyphal tip cells, but they were present in the relatively quiescent subapical cells. These observations suggested that there are different rates of turnover for cytoplasmic microtubules in apical and subapical cells and for microtubules near spindle pole bodies and that MBC acts by inhibiting microtubules assembly. A statistical analysis of the distribution of intracytoplasmic vesicles in thick sections of cells treated with MBC, D2O or MBC + D2O was obtained by use of a high-voltage electron microscope. More than 50% of the vesicles in the apical 30 micrometers of control cells were found to lie within 2 micrometers of the tip cell apex. MBC treatment caused this vesicle distribution to become uniform, resulting in a substantial increase in the number of vesicles in subapical regions. The reduction in the number of cytoplasmic microtubules, induced by MBC, apparently inhibited intracellular transport of these vesicles and rendered random the longitudinal orientation of mitochondria. In most cases, D2O appeared capable of preventing these MBC-effects through stabilization of microtubules. These observations support the "vesicle hypothesis" of tip growth and establish a transport role for cytoplasmic microtubules in fungal morphogenesis.

Trafficking of malarial proteins to the host cell cytoplasm and erythrocyte surface membrane involves multiple pathways.

During the asexual stage of malaria infection, the intracellular parasite exports membranes into the erythrocyte cytoplasm and lipids and proteins to the host cell membrane, essentially "transforming" the erythrocyte. To investigate lipid and protein trafficking pathways within Plasmodium falciparum-infected erythrocytes, synchronous cultures are temporally analyzed by confocal fluorescence imaging microscopy for the production, location and morphology of exported membranes (vesicles) and parasite proteins. Highly mobile vesicles are observed as early as 4 h postinvasion in the erythrocyte cytoplasm of infected erythrocytes incubated in vitro with C6-NBD-labeled phospholipids. These vesicles are most prevalent in the trophozoite stage. An immunofluorescence technique is developed to simultaneously determine the morphology and distribution of the fluorescent membranes and a number of parasite proteins within a single parasitized erythrocyte. Parasite proteins are visualized with FITC- or Texas red-labeled monoclonal antibodies. Double-label immunofluorescence reveals that of the five parasite antigens examined, only one was predominantly associated with membranes in the erythrocyte cytoplasm. Two other parasite antigens localized only in part to these vesicles, with the majority of the exported antigens present in lipid-free aggregates in the host cell cytoplasm. Another parasite antigen transported into the erythrocyte cytoplasm is localized exclusively in lipid-free aggregates. A parasite plasma membrane (PPM) and/or parasitophorous vacuolar membrane (PVM) antigen which is not exported always colocalizes with fluorescent lipids in the PPM/PVM. Visualization of two parasite proteins simultaneously using FITC- and Texas red-labeled 2 degrees antibodies reveals that some parasite proteins are constitutively transported in the same vesicles, whereas other are segregated before export. Of the four exported antigens, only one appears to cross the barriers of the PPM and PVM through membrane-mediated events, whereas the others are exported across the PPM/PVM to the host cell cytoplasm and surface membrane through lipid (vesicle)-independent pathways.

Plasmodium falciparum malaria: association of knobs on the surface of infected erythrocytes with a histidine-rich protein and the erythrocyte skeleton.

Plasmodium falciparum-infected erythrocytes (RBC) develop surface protrusions (knobs) which consist of electron-dense submembrane cups and the overlying RBC plasma membrane. Knobs mediate cytoadherence to endothelial cells. Falciparum variants exist that lack knobs. Using knobby (K+) and knobless (K-) variants of two strains of P. falciparum, we confirmed Kilejian's original observation that a histidine-rich protein occurred in K+ parasites but not K- variants (Kilejian, A., 1979, Proc. Natl. Acad. Sci. USA, 76:4650-4653; and Kilejian, A., 1980, J. Exp. Med., 151:1534-1538). Two additional histidine-rich proteins of lower molecular weight were synthesized by K+ and K- variants of both strains. We used differential detergent extraction and thin-section electron microscopy to investigate the subcellular location of the histidine-rich protein unique to K+ parasites. Triton X-100, Zwittergent 314, cholic acid, CHAPS, and Triton X-100/0.6 M KCl failed to extract the unique histidine-rich protein. The residues insoluble in these detergents contained the unique histidine-rich protein and electron-dense cups. The protein was extracted by 1% SDS and by 1% Triton X-100/9 M urea. The electron-dense cups were missing from the insoluble residues of these detergents. The electron-dense cups and the unique histidine-rich protein appeared to be associated with the RBC skeleton, particularly RBC protein bands 1, 2, 4.1, and 5. We propose that the unique histidine-rich protein binds to the RBC skeleton to form the electron-dense cup. The electron-dense cup produces knobs by forming focal protrusions of the RBC membrane. These protrusions are the specific points of attachment between infected RBC and endothelium.

Secretion of a malarial histidine-rich protein (Pf HRP II) from Plasmodium falciparum-infected erythrocytes.

Plasmodium falciparum-infected erythrocytes (IRBCs) synthesize several histidine-rich proteins (HRPs) that accumulate high levels of [3H]histidine but very low levels of amino acids such as [3H]isoleucine or [35S]methionine. We prepared a monoclonal antibody which reacts specifically with one of these HRPs (Pf HRP II) and studied the location and synthesis of this protein during the parasite's intracellular growth. With the knob-positive Malayan Camp strain of P. falciparum, the monoclonal antibody identified a multiplet of protein bands with major species at Mr 72,000 and 69,000. Pf HRP II synthesis began with immature parasites (rings) and continued through the trophozoite stage. The Mr 72,000 band of Pf HRP II, but not the faster moving bands of the multiplet, was recovered as a water-soluble protein from the culture supernatant of intact IRBCs. Approximately 50% of the total [3H]histidine radioactivity incorporated into the Mr 72,000 band was extracellular between 2 and 24 h of culture. Immunofluorescence and cryothin-section immunoelectron microscopy localized Pf HRP II to several cell compartments including the parasite cytoplasm, as concentrated "packets" in the host erythrocyte cytoplasm and at the IRBC membrane. Our results provide evidence for an intracellular route of transport for a secreted malarial protein from the parasite through several membranes and the host cell cytoplasm.