First Report of Late Blight Caused by Phytophthora infestans Clonal Lineage US-23 on Tomato and Potato in Atlantic Canada.

Phytophthora infestans (Mont.) de Bary has produced significant losses in potato and tomato yield and quality during recent late blight epidemics in North America. During the 1990s, more aggressive and genetically diverse P. infestans genotypes migrated to Canada and the United States (2). For example, US-8 became predominant and was found to be more aggressive in potato than previous clonal lineages of P. infestans. Recent P. infestans genotypes in potato and tomato plants from the United States and Canada include US-22, US-23, and US-24 representing clonal lineages with unique epidemiological characteristics (2,3,4). Characteristic phenotypic traits have been described for P. infestans clonal lineages US-8, US-22, US-23, and US-24 based on the mating type, mefenoxam sensitivity, pathogenicity, and rate of germination suggesting an association between phenotypic variations and the genotype (1,4). Analysis of P. infestans isolates collected in Canada during 2010 revealed the presence of the US-23 clonal lineage in four different areas of western Canada but not in eastern Canada (4). Isolates of P. infestans collected from eastern Canada for several years prior to 2011 were all US-8 A2 mating type. Isolation and analysis of 98 P. infestans isolates in 2011 from New Brunswick and Prince Edward Island followed standard procedures (2,3,4). Results confirmed the presence of the US-23 clonal lineage in Atlantic Canada on potato and tomato leaves with late blight symptoms, increasing the genetic complexity of P. infestans in eastern Canada. Allozyme banding patterns at the glucose-6-phosphate isomerase (Gpi) locus showed a 100/100 profile in 10 P. infestans isolates, consistent with the US-23 clonal lineage (2,3,4). Furthermore, in vitro mefenoxam sensitivity was observed in all 10 P. infestans US-23 isolates from New Brunswick and Prince Edward Island. Mating type assays confirmed the isolates were of the A1 mating type. RFLP analysis of EcoR1-digested genomic DNA using the multilocus RG57 sequence as a probe produced the DNA pattern 1, 2, 5, 6, 10, 13, 14, 17, 20, 21, 24, 24a, 25, indicative of US-23 (2,4). Microsatellite analysis using polymorphic markers on New Brunswick and Prince Edward Island P. infestans isolates produced the Pi4B 213/217 bp, D13 134 bp, and PiG11 140/155 bp profile of P. infestans US-23 (1). These results show the presence of the P. infestans A1 and A2 mating types in New Brunswick and Prince Edward Island, which increases the probability of sexual recombination. To our knowledge, this is the first report of P. infestans clonal lineage US-23 causing late blight in New Brunswick and Prince Edward Island, increasing the genetic diversity from previous years in eastern Canada and underscoring the annual fluctuation occurring in the population composition. References: (1) G. Danies et al. Plant Dis. 97:873, 2013. (2) S. B. Goodwin et al. Phytopathology 84:553, 1994. (3) C. H. Hu et al. Plant Dis. 96:1323, 2012. (4) M. L. Kalischuk et al. Plant Dis. 96:1729, 2012.

First Report of Phytophthora infestans Genotype US23 Causing Late Blight in Canada.

Late blight is caused by the oomycete Phytophthora infestans (Mont.) de Bary and is one of the most devastating diseases of potato and tomato. Late blight occurs in all major potato- and tomato-growing regions of Canada. Its incidence in North America increased during 2009 and 2010 (2). Foliar disease symptoms appeared earlier than usual (June rather than July) and coincided with the identification of several new P. infestans genotypes in the United States, each with unique characteristics. Prior to 2007, isolates collected from potato and tomato crops were mainly US8 or US11 genotypes (1). However, P. infestans populations in the United States have recently experienced a major genetic evolution, producing isolates with unique genotypes and epidemiological characteristics in Florida and throughout the northeastern states (2). Recent discoveries of tomato transplants with late blight for sale at Canadian retail outlets prompted an examination of the genotypes inadvertently being distributed and causing disease in commercial production areas in Canada. Analysis of isolates of P. infestans from across Canada in 2010 identified the US23 genotype for the first time from each of the four western provinces (Manitoba, Saskatchewan, Alberta, and British Columbia) but not from eastern Canada. Allozyme banding patterns at the glucose phosphate isomerase (Gpi) locus indicated a 100/100 profile consistent with US6 and US23 genotypes (4). Mating type assays confirmed the isolates to be A1 and in vivo metalaxyl sensitivity was observed. Restriction fragment length polymorphic analysis of 50 isolates from western Canada with the multilocus RG57 sequence and EcoRI produced the DNA pattern 1, 2, 5, 6, 10, 13, 14, 17, 20, 21, 24, 24a, 25 that was indicative of US23 (3). The recently described P. infestans genotype US23 appears to be more aggressive on tomato, and although isolates were recovered from both tomato and potato, disease symptoms were often more severe on tomato. Results indicate that movement and evolution of new P. infestans genotypes have contributed to the increased incidence of late blight and that movement of the pathogen on retail plantlets nationally and internationally may provide an additional early season source of inoculum. A major concern is that the introduced new A1 populations in western Canada have established a dichotomy with the endogenous A2 populations in eastern Canada, increasing the potential for sexual recombination producing oospores and additional genotypes should these populations merge. References: (1) Q. Chen et al. Am. J. Potato Res. 80:9, 2003. (2) K. Deahl. (Abstr.) Phytopathology 100(suppl.):S161, 2010. (3) S. B. Goodwin et al. Curr. Genet. 22:107, 1992. (4) S. B. Goodwin et al. Phytopathology 88:939, 2004.

First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi.

Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 µm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 µm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 µm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5'GCATCGATGAAGAACGCAGC3' and 5'TCCTCCGCTTATTGATATGC3' specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.

First Report of Rubus yellow net virus on Rubus idaeus in Alberta, Canada.

In North America, Rubus yellow net virus (RYNV), a member of the genus Badnavirus, family Caulimoviridae, is vectored in a semipersistent manner by the large raspberry aphid (Amphorophora agathonica Hottes) and is responsible for producing net-like chlorosis of tissue along the leaf veins (2). Red raspberry (Rubus idaeus L.) is commonly grown in Canada and after the dry, hot summer of 2006 in southern Alberta, a group of garden raspberry plants located near Lethbridge, Alberta exhibited interveinal chlorosis resembling viral symptoms. Nonenveloped, 140 × 30 nm, bacilliform particles typical of badnaviruses were observed in infected leaves by transmission electron microscopy. The presence of RYNV was confirmed by immunocapture of virions from extracts of symptomatic leaves using Sugarcane bacilliform virus polycolonal antiserum (Agdia Incorporated, Elkhart, IN) followed by PCR amplification of a 451-bp fragment with RYNV-specific primers based on the highly conserved region of the reverse transcriptase and ribonuclease H genes (5'-ATCCTCAAAGGGTTACGTAGCTGGTT-3' and 5'-TTCAAGCCACCTTACCCTCGAAGGTTT-3'). Sequence of clones from the PCR product (GenBank Accession No. EU327346) showed 87% identity to a previously sequenced isolate of RYNV (GenBank Accession No. AF468454) (1). To our knowledge, this is the first report of RYNV in Alberta, Canada, and as an important component of raspberry veinbanding disease, it poses a new threat to the Alberta raspberry industry. References: (1) A. T. Jones et al. Ann. Appl. Biol. 141:1, 2002. (2) R. Stace-Smith. Can. J. Bot. 33:269, 1955.

Identification of a Gene Conferring High Levels of Resistance to Verticillium Wilt in Solanum chacoense.

Verticillium wilt (Verticillium albo-atrum) is an important disease affecting potato tuber yield and quality. In North America the major commercial cultivars are susceptible and management strategies for control of the pathogen rely mainly on soil fumigation and crop rotation. In this study 398 genotypes from accessions of Solanum berthaultii, S. chacoense, and S. tarijense were screened for resistance to Verticillium albo-atrum. Resistant genotypes were identified in all but two accessions; however, results indicate that tolerance is more common than resistance. We identified two genotypes in S. chacoense (PI 472819) that had low stem-colonization levels and also did not develop wilt symptoms when inoculated with V. albo-atrum. These genotypes and a susceptible genotype from PI 472810 (S. chacoense) were studied to determine genetic inheritance. Segregation ratios in F1, F2, and backcross populations indicated that resistance in one of the resistant genotypes (18-21R) was controlled by a single dominant gene. Transfer of the Vc gene to tetraploid germ plasm could provide effective and economical control of Verticillium wilt.

Comparative degradation of oomycete, ascomycete, and basidiomycete cell walls by mycoparasitic and biocontrol fungi.

Fourteen fungi (primarily representing mycoparasitic and biocontrol fungi) were tested for their ability to grow on and degrade cell walls (CWs) of an oomycete (Pythium ultimum), ascomycete (Fusarium equisetii), and basidiomycete (Rhizoctonia solani), and their hydrolytic enzymes were characterized. Protein was detected in the cultural medium of eleven of the test isolates, and these fungi significantly degraded CWs over the 14-day duration of the experiment. In general, a greater level of CW degradation occurred for F. equisetii and P. ultimum than for R. solani. Fungi that degraded F. equisetii CWs were Coniothyrium minitans, Gliocladium roseum, Myrothecium verrucaria, Talaromyces flavus, and Trichoderma harzianum. Taxa degrading P ultimum CWs included Chaetomium globosum, Coniothyrium minitans, M. verrucaria, Seimatosporium sp., Talaromyces flavus, Trichoderma hamatum, Trichoderma harzianum, and Trichoderma viride. Production of extracellular protein was highly correlated with CW degradation. Considerable variation in the molecular weights of CW-degrading enzymes were detected among the test fungi and the CW substrates in zymogram electrophoresis. Multivariate analysis between CW degradation and hydrolysis of barley beta-glucan (beta1,3- and beta1,4-glucanases), laminarin (beta1,3- and beta1,6-glucanases), carboxymethyl cellulose (endo-beta1,4-glucanases), colloidal chitin (chitinases), and chitosan (chitosanases) was conducted. For F. equisetii CWs, the regression model accounted for 80% of the variability, and carboxymethyl cellulases acting together with beta-glucanases contributed an R2 of 0.52, whereas chitinases and beta-glucanases alone contributed an R2 of 0.11 and 0.12, respectively. Only 61% of the variability observed in the degradation of P. ultimum CWs was explained by the enzyme classes tested, and primarily beta-glucanases (R2 of 0.53) and carboxymethyl cellulases (R2 of 0.08) alone contributed to CW break down. Too few of the test fungi degraded R. solani CWs to perform multivariate analysis effectively. This study identified several fungi that degraded ascomyceteous and oomyceteous, and to a lesser extent, basidiomycetous CWs. An array of enzymes were implicated in CW degradation.

Development of sequence characterized DNA markers linked to a dominant verticillium wilt resistance gene in tomato.

Sequences were determined for codominant RAPD markers closely linked to the Ve locus, a dominant verticillium wilt resistance gene in tomato. Analysis of the sequences linked to Ve and ve revealed a perfectly homologous sequence with a central polymorphic region comprising 79 nucleotide substitutions, insertions, and deletions. Codominant and allele-specific SCARs were developed using conserved and polymorphic sequences linked to the Ve locus. High resolution linkage analysis using F2 progeny segregating for resistance and marker-assisted selection indicated that linkage between the genetic markers and the Ve locus is less than 0.67 +/- 0.49 cM. Sequences were useful in determining the molecular structure of a polymorphic genomic region closely linked to the Ve locus and in developing genetic markers that facilitated marker-assisted selection of the resistant, susceptible, heterozygous, and homozygous genotypes.

Identification of a codominant amplified polymorphic DNA marker linked to the verticillium wilt resistance gene in tomato.

Resistance to verticillium wilt, a vascular disease causing yield losses in many crops, is conferred in tomato by a single dominant allele, Ve. A population segregating for the Ve allele was generated using near-isogenic tomato lines. Analysis of the parental tomato DNA using the polymerase chain reaction and 400 random primers, each 10 deoxyribonucleotides in length, produced 1,880 amplified DNA fragments. Of the four polymorphisms observed between the resistant and susceptible parental genotypes, only one was linked to the Ve gene. No recombination was observed between this DNA marker and the Ve locus, indicating that the linkage is less than 3.5±2.7 cM. The marker detected both the susceptible and resistant alleles, producing amplified DNA fragments of approximately 1,300 and 1,350 bp, respectively. The sequence of the primer, determined from cloned amplified products, was 5' CTCACATGCA 3' instead of the expected 5' CTCACATGCC 3'. The marker will be of value to tomato breeding programs because of the tight linkage, Codominant nature, and analytical procedure utilized.

Genetic diversity of potato determined by random amplified polymorphic DNA analysis.

The RAPD procedure was used to establish genetic diversity of 28 potato genotypes including siblings and genotypes with no immediate relationship. In addition amplified DNA from three parents and Solanum chacoense were compared with that from six progeny to determine the genetic relationships. Amplification of genomic DNA from the 28 genotypes using PCR and 12 decamer primers yielded 158 amplified DNA fragments, ranging in size from 490 to 3200 bp. A total of 128 unique RAPD fragments were observed among the 28 potato genotypes. Similarity measures and principal coordinate analysis generally reflected the expected trends in relationships of the full and half-sib potato genotypes. However there were important exceptions to this general trend and it appears that related varieties can be as genetically different as varieties with no immediate relationship. The data suggest that RAPD analysis used in conjunction with pedigree information can provide a superior measure of genetic divergence than analysis based solely on pedigree information.

The influence of bacterial inoculants on the microbial ecology of aerobic spoilage of barley silage.

The aerobic decomposition of barley silage treated with two inoculants (LacA and LacB) containing mixtures of Lactobacillus plantarum and Enterococcus faecium was investigated over a 28-day period. Initially, yeast and bacterial populations were larger in silage inoculated with LacA than in silage treated with LacB or water alone (control). Differences in the succession of yeasts in silage treated with LacA were observed relative to the other two treatments. From silage treatment with LacA, Issatchenkia orientalis was the most prevalent yeast taxon over all of the sample times, and the filamentous fungus Microascus brevicaulis was also frequently isolated at later sample dates (> or = 14 days). In contrast, Saccharomyces exiguus was the most prominent yeast recovered from silage treated with LacB and water alone on days 2 and 4, although it was supplanted by I. orientalis at later sample times. Successional trends of bacteria were similar for all three treatments. Lactobacillus spp. were initially the most prevalent bacteria isolated, followed by Bacillus spp. (primarily Bacillus pumilus). However, the onset of Bacillus spp. prominence was faster in LacA silage, and Klebsiella planticola was frequently recovered at later sample times (> or = 14 days). More filamentous fungi were recovered from LacA silage on media containing carboxylmethylcellulose, pectin, or xylan. The most commonly isolated taxa were Absidia sp., Aspergillus flavus, Aspergillus fumigatus, Byssochlamys nivea, Monascus ruber, Penicillium brevicompactum, Pseudoallescheria boydii, and M. brevicaulis. The results of this study indicated that the two bacterial inoculants incorporated into barley at the time of ensilage affected the microbial ecology of silage decomposition following exposure to air. However, neither of the microbial inoculants effectively delayed aerobic spoilage of barley silage, and the rate of decomposition of silage treated with one of the inoculants (LacA) was actually enhanced.

Identification and characterization of the potato leafroll virus putative coat protein gene.

Complementary DNA clones representing approximately 6100 nucleotides of potato leafroll virus (PLRV) were generated, restriction-mapped, and partially sequenced. Within one of the cDNA clones an open reading frame (ORF) encoding a 23K protein was identified and further characterized. Amino acid sequence comparison of this protein showed significant homology (47.1%) with the barley yellow dwarf virus (BYDV-PAV) coat protein. This and other observations suggested that this gene encodes the PLRV coat protein. Other similarities were observed between PLRV and BYDV sequences in this region of their genomes, including an ORF of 17K within the ORF encoding the 23K putative coat protein.

Nucleotide sequences of an Australian and a Canadian isolate of potato leafroll luteovirus and their relationships with two European isolates.

The genomes of an Australian and a Canadian isolate of potato leafroll virus have been cloned and sequenced. The sequences of both isolates are similar (about 93%), but the Canadian isolate (PLRV-C) is more closely related (about 98% identity) to a Scottish (PLRV-S) and a Dutch isolate (PLRV-N) than to the Australian isolate (PLRV-A). The 5'-terminal 18 nucleotide residues of PLRV-C, PLRV-A, PLRV-N and beet western yellows virus have 17 residues in common. In contrast, PLRV-S shows no obvious similarity in this region. PLRV-A and PLRV-C genomic sequences have localized regions of marked diversity, in particular a 600 nucleotide residue sequence in the polymerase gene. These data provide a world-wide perspective on the molecular biology of PLRV strains and their comparison with other luteoviruses and related RNA plant viruses suggests that there are two major subgroups in the plant luteoviruses.

Production of cellulases and xylanases by low-temperature basidiomycetes.

Three of four isolates, representing phylogenetically distinct groupings of low-temperature basidiomycetes (LTB), were capable of utilizing wheat straw, and to a lesser extent conifer wood at 15 degrees C. A cottony snow mould LTB (LRS 013) and a fruit rot LTB (LRS 241) grown on straw significantly degraded filter paper, carboxymethylcellulose (CMC), p-nitrophenyl beta-glucopyranoside (i.e., beta-glucosidases), and xylan. Enzymes produced by Coprinus psychromorbidus (LRS 067) were limited to xylanases from straw and wood and beta-glucosidases from wood. A sclerotia-forming LTB (LRS 131) exhibited poor growth on both substrates, and did not produce detectable quantities of extracellular enzymes. None of the LTB isolates tested degraded avicel. The temperature optima of CMCases and xylanases in the filtrates from the straw medium ranged from 25 degrees C to 55 degrees C, and with the exception of LRS 067, significant activity was observed at 5 degrees C. Two cellulases (25 and 31 kDa) and two xylanases (24 and 34 kDa) were observed on zymograms for LRS 013 and 241. Reduction of enzymes with 2-mercaptoethanol adversely affected their activity on zymograms, and an additional cellulase band was observed for non-reduced samples. This study indicates that LTB produce an array of cellulolytic and xylanolytic enzymes, and that some of these enzymes possess low-temperature optima which may facilitate degradation of plant fibre under low-temperature conditions.

Tomato Ve disease resistance genes encode cell surface-like receptors.

In tomato, Ve is implicated in race-specific resistance to infection by Verticillium species causing crop disease. Characterization of the Ve locus involved positional cloning and isolation of two closely linked inverted genes. Expression of individual Ve genes in susceptible potato plants conferred resistance to an aggressive race 1 isolate of Verticillium albo-atrum. The deduced primary structure of Ve1 and Ve2 included a hydrophobic N-terminal signal peptide, leucine-rich repeats containing 28 or 35 potential glycosylation sites, a hydrophobic membrane-spanning domain, and a C-terminal domain with the mammalian E/DXXXLphi or YXXphi endocytosis signals (phi is an amino acid with a hydrophobic side chain). A leucine zipper-like sequence occurs in the hydrophobic N-terminal signal peptide of Ve1 and a Pro-Glu-Ser-Thr (PEST)-like sequence resides in the C-terminal domain of Ve2. These structures suggest that the Ve genes encode a class of cell-surface glycoproteins with receptor-mediated endocytosis-like signals and leucine zipper or PEST sequences.