Phenotyping xylem connections in grafted plants using X-ray micro-computed tomography.

Plants are able to naturally graft or inosculate their trunks, branches and roots together, this mechanism is used by humans to graft together different genotypes for a range of purposes. Grafts are considered successful if functional vascular connections between the two genotypes occur. Various techniques can evaluate xylem connections across the graft interface. However, these methods are generally unable to assess the heterogeneity and three-dimensional (3D) structure of xylem vessel connections. Here we present the use of X-ray micro-computed tomography to characterize the 3D morphology of grafts of grapevine. We show that xylem vessels form between the two plants of natural root and human-made stem grafts. The main novelty of this methodology is that we were able to visualize the 3D network of functional xylem vessels connecting the scion and rootstock in human-made stem grafts thanks to the addition of a contrast agent to the roots and improved image analysis pipelines. In addition, we reveal the presence of extensive diagonal xylem connections between the main axial xylem vessels in 2-year old grapevine stems. In conclusion, we present a method that has the potential to provide new insights into the structure and function of xylem vessels in large tissue samples.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Differential regulation of caffeine metabolism in Coffea arabica (Arabica) and Coffea canephora (Robusta).

Caffeine is a metabolite of great economic importance, especially in coffee, where it influences the sensorial and physiological impacts of the beverage. Caffeine metabolism in the Coffea species begins with the degradation of purine nucleotides through three specific N-methyltransferases: XMT, MXMT and DXMT. A comparative analysis was performed to clarify the molecular reasons behind differences in caffeine accumulation in two Coffea species, namely Coffea arabica and Coffea canephora var. robusta. Three different genes encoding N-methyltransferase were amplified in the doubled haploid Coffea canephora: CcXMT1, CcMXMT1 and CcDXMT. Six genes were amplified in the haploid Coffea arabica: CaXMT1, CaXMT2, CaMXMT1, CaMXMT2, CaDXMT1, and CaDXMT2. A complete phylogenic analysis was performed to identify specific key amino acids defining enzymatic function for each protein identified. Furthermore, a quantitative gene-expression analysis was conducted on leaves and on maturing coffee beans, simultaneously analyzing caffeine content. In the different varieties analyzed, caffeine accumulation is higher in leaves than in the coffee bean maturation period, higher in Robusta than in Arabica. In Robusta, CcXMT1 and CcDXMT gene expressions are predominant and transcriptional activity is higher in leaves than in maturing beans, and is highly correlated to caffeine accumulation. In Arabica, the CaXMT1 expression level is high in leaves and CaDXMT2 as well to a lesser extent, while global transcriptional activity is weak during bean maturation, suggesting that the transcriptional control of caffeine-related genes differs within different organs and between Arabica and Robusta. These findings indicate that caffeine accumulation in Coffea species has been modulated by a combination of differential transcriptional regulation and genome evolution.

Natural diversity in the model legume Medicago truncatula allows identifying distinct genetic mechanisms conferring partial resistance to Verticillium wilt.

Verticillium wilt is a major threat to alfalfa (Medicago sativa) and many other crops. The model legume Medicago truncatula was used as a host for studying resistance and susceptibility to Verticillium albo-atrum. In addition to presenting well-established genetic resources, this wild plant species enables to investigate biodiversity of the response to the pathogen and putative crosstalk between disease and symbiosis. Symptom scoring after root inoculation and modelling of disease curves allowed assessing susceptibility levels in recombinant lines of three crosses between susceptible and resistant lines, in a core collection of 32 lines, and in mutants affected in symbiosis with rhizobia. A GFP-expressing V. albo-atrum strain was used to study colonization of susceptible plants. Symptoms and colonization pattern in infected M. truncatula plants were typical of Verticillium wilt. Three distinct major quantitative trait loci were identified using a multicross, multisite design, suggesting that simple genetic mechanisms appear to control Verticillium wilt resistance in M. truncatula lines A17 and DZA45.5. The disease functional parameters varied largely in lines of the core collection. This biodiversity with regard to disease response encourages the development of association genetics and ecological approaches. Several mutants of the resistant line, impaired in different steps of rhizobial symbiosis, were affected in their response to V. albo-atrum, which suggests that mechanisms involved in the establishment of symbiosis or disease might have some common regulatory control points.