Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 12 de 12
Filter
1.
Kidney Blood Press Res ; 49(1): 490-494, 2024.
Article in English | MEDLINE | ID: mdl-38865986

ABSTRACT

INTRODUCTION: Patients with idiopathic membranous nephropathy (IMN) are particularly susceptible to thromboembolism (TE). The phospholipase A2 receptor (PLA2R) antibody (Ab) has been indicated to work as an independent risk predictor for venous TE in IMN. This study aimed to further explore the predictive value of PLA2R Ab for both venous and arterial TE in IMN patients. METHODS: A total of 91 IMN patients were retrospectively selected and divided into anti-PLA2R-positive or anti-PLA2R-negative groups according to the anti-PLA2R Ab titer (cutoff: 20 RU/mL). Serum PLA2R Abs were estimated using ELISA. Anti-PLA2R-positive IMN patients were further assigned into two groups based on the presence or absence of TE. RESULTS: Twelve (18.18%) IMN patients with anti-PLA2R positivity had TE, including both venous and arterial TE. No TE occurred in the anti-PLA2R-negative group. IMN patients in the anti-PLA2R-positive group had significantly higher levels of total cholesterol and low-density lipoprotein than those in the anti-PLA2R-negative group. No significant difference was observed in the anti-PLA2R Ab titer between patients with and without TE. Patients with TE were significantly older than those without TE. CONCLUSION: This study demonstrates that the positive status of anti-PLA2R Abs contributes to thrombosis formation in IMN.


Subject(s)
Glomerulonephritis, Membranous , Receptors, Phospholipase A2 , Humans , Glomerulonephritis, Membranous/blood , Glomerulonephritis, Membranous/immunology , Receptors, Phospholipase A2/immunology , Male , Female , Middle Aged , Retrospective Studies , Autoantibodies/blood , Adult , Aged , Thromboembolism/blood , Thromboembolism/etiology
2.
J Sci Food Agric ; 103(10): 5087-5095, 2023 Aug 15.
Article in English | MEDLINE | ID: mdl-36991224

ABSTRACT

BACKGROUND: Mycosporine-like amino acids (MAAs) are known as the strongest solar guardians in nature. RESULTS: In the present study, the extraction of MAAs from dried Pyropia haitanensis was achieved. Fish gelatin and oxidized starch composite films embedded with MAAs (0-0.3% w/w) were fabricated. The maximum absorption wavelength of the composite film appeared at 334 nm, which was consistent with MAA solution. Furthermore, the UV absorption intensity of the composite film was highly dependent on the concentration of MAAs. The composite film exhibited excellent stability during the 7-day storage period. The physicochemical features of composite film were demonstrated by the measurement of water content, water vapor transmission rate, oil transmission, and visual characteristics. Furthermore, in the actual anti-UV effect investigation, the increase in peroxide value and the acid value of grease under the films coverage was delayed. In the meantime, the decrease in ascorbic acid content in dates was postponed, and survivability of Escherichia coli was increased. CONCLUSION: Our results suggest that fish gelatin-oxidized starch-mycosporine-like amino acids film (FOM film) with biodegradable and anti-ultraviolet properties has a high potential for usage in food packaging materials. © 2023 Society of Chemical Industry.


Subject(s)
Fishes , Animals , Gelatin/chemistry , Amino Acids/chemistry , Ultraviolet Rays , Starch/chemistry , Ascorbic Acid/chemistry
3.
Int J Mol Sci ; 23(16)2022 Aug 20.
Article in English | MEDLINE | ID: mdl-36012648

ABSTRACT

Salecan (Sal) is a novel marine microbial polysaccharide. In the present research, Sal and soy protein isolate (SPI) were adopted to fabricate Sal-SPI composite hydrogel based on a stepwise process (thermal treatment and transglutaminase induction). The effect of Sal concentration on morphology, texture properties, and the microstructure of the hydrogel was evaluated. As Sal concentration varied from 0.4 to 0.6 wt%, hydrogel elasticity increased from 0.49 to 0.85 mm. Furthermore, the internal network structure of Sal-SPI composite hydrogel also became denser and more uniform as Sal concentration increased. Rheological studies showed that Sal-SPI elastic hydrogel formed under the gelation process. Additionally, FTIR and XRD results demonstrated that hydrogen bonds formed between Sal and SPI molecules, inferring the formation of the interpenetrating network structure. This research supplied a green and simple method to fabricate Sal-SPI double network hydrogels.


Subject(s)
Hydrogels , beta-Glucans , Hydrogels/chemistry , Soybean Proteins/metabolism , Transglutaminases/metabolism , beta-Glucans/chemistry
4.
Appl Environ Microbiol ; 81(15): 5157-73, 2015 Aug.
Article in English | MEDLINE | ID: mdl-26002902

ABSTRACT

Avermectins produced by Streptomyces avermitilis are commercially important anthelmintic agents. The detailed regulatory mechanisms of avermectin biosynthesis remain unclear. Here, we identified SAV3619, a TetR-family transcriptional regulator designated AveT, to be an activator for both avermectin production and morphological differentiation in S. avermitilis. AveT was shown to indirectly stimulate avermectin production by affecting transcription of the cluster-situated activator gene aveR. AveT directly repressed transcription of its own gene (aveT), adjacent gene pepD2 (sav_3620), sav_7490 (designated aveM), and sav_7491 by binding to an 18-bp perfect palindromic sequence (CGAAACGKTKYCGTTTCG, where K is T or G and Y is T or C and where the underlining indicates inverted repeats) within their promoter regions. aveM (which encodes a putative transmembrane efflux protein belonging to the major facilitator superfamily [MFS]), the important target gene of AveT, had a striking negative effect on avermectin production and morphological differentiation. Overexpression of aveT and deletion of aveM in wild-type and industrial strains of S. avermitilis led to clear increases in the levels of avermectin production. In vitro gel-shift assays suggested that C-5-O-B1, the late pathway precursor of avermectin B1, acts as an AveT ligand. Taken together, our findings indicate positive-feedback regulation of aveT expression and avermectin production by a late pathway intermediate and provide the basis for an efficient strategy to increase avermectin production in S. avermitilis by manipulation of AveT and its target gene product, AveM.


Subject(s)
Anthelmintics/metabolism , Gene Expression Regulation, Bacterial , Ivermectin/analogs & derivatives , Metabolic Engineering , Streptomyces/metabolism , Transcription Factors/metabolism , DNA, Bacterial/metabolism , Electrophoretic Mobility Shift Assay , Encephalitis Virus, California , Gene Deletion , Gene Expression , Ivermectin/metabolism , Protein Binding , Streptomyces/cytology , Streptomyces/growth & development , Transcription Factors/genetics
5.
Appl Environ Microbiol ; 81(11): 3753-65, 2015 Jun.
Article in English | MEDLINE | ID: mdl-25819953

ABSTRACT

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.


Subject(s)
Daptomycin/biosynthesis , Gene Expression Regulation, Bacterial , Streptomyces/genetics , Streptomyces/metabolism , Transcription Factors/metabolism , Binding Sites , Biosynthetic Pathways/genetics , DNA Footprinting , DNA, Bacterial/genetics , Gene Deletion , Streptomyces/cytology , Streptomyces/growth & development , Transcription Factors/genetics , Transcription, Genetic , Transcriptional Activation
6.
Zhong Yao Cai ; 38(10): 2095-7, 2015 Oct.
Article in Zh | MEDLINE | ID: mdl-27254922

ABSTRACT

OBJECTIVE: To study the chemical constituents from the stems and leaves in Drypetes hainanensis. METHODS: The constituents were isolated and purified by various chromatography, and the structures were identified by extensive spectral analysis. RESULTS: Eleven compounds were isolated and identified as syringaresinol-4-O-glycoside (1), koaburaside (2), abietin (3) syringin (4), kelampayoside A (5), 7,7'-bis-(4-hydroxy-3,5-dimethoxyphenyl)-8,8'-dihydroxymethyl-tetrahydrofuran-4-O-ß-glucopyranoside (6), amentoflavone (7), 3,4,5-trimethoxyphenyl-ß-D-glucopyranoside (8),1,4-di-O-methyl-myo-inositol (9), glycerol (10) and succinic acid (11). CONCLUSION: All the compounds are isolated from this plant for the first time.


Subject(s)
Drugs, Chinese Herbal/chemistry , Magnoliopsida/chemistry , Phytochemicals/analysis , Plant Leaves/chemistry , Plant Stems/chemistry , Furans/isolation & purification , Glucosides/isolation & purification , Glycosides/isolation & purification , Lignans/isolation & purification , Phenylpropionates/isolation & purification , Phytochemicals/isolation & purification , Plants, Medicinal/chemistry
7.
Pharmaceutics ; 14(7)2022 Jul 18.
Article in English | MEDLINE | ID: mdl-35890387

ABSTRACT

Salecan (Sal) is a novel microbial polysaccharide. In the present research, thermal treatment was performed to fabricate Sal hydrogel. The effect of Sal concentration on water holding capacity, swelling properties, texture properties, and microstructure of the hydrogels was discussed. It was found that the equilibrium degree of swelling (EDS) of Sal hydrogels was above 1500%, inferred Sal was a highly hydrophilic polysaccharide. As Sal concentration increased from 3.5 to 8.0 wt%, the hardness increased from 0.88 to 2.07 N and the water hold capability (WHC) increased from 91.3% to 98.2%. Furthermore, the internal network structure of Sal hydrogel also became denser and more uniform. Rheological studies suggested that elastic hydrogel formed under the gelation process. All these results demonstrated that Sal hydrogel prepared by thermal treatment had good gelling properties, which opened up a new safe way for the preparation of Sal hydrogel and broadened the application range of Sal.

8.
Polymers (Basel) ; 14(15)2022 Jul 22.
Article in English | MEDLINE | ID: mdl-35893944

ABSTRACT

Mycosporine-like amino acids (MAAs) are ultraviolet-absorbing compounds and have antioxidant functions. In this paper, MAAs were added into fish gelatin/sodium alginate films as an anti-ultraviolet additive. The effects of 0-5% MAAs (w/w, MAAs/fish gelatin) on the physical properties, antioxidant properties, antibacterial properties and anti-ultraviolet properties of fish gelatin/sodium alginate films were investigated. The results suggest that the content of the MAAs influenced the mechanical properties. The water content, swelling and water vapor permeability of the films were not altered with the addition of MAAs. In addition, the composite films showed effective antioxidant activity and antimicrobial activity. The incorporation of MAAs significantly improved the DPPH radical scavenging activity of the films from 35.77% to 46.61%. Moreover, the block ultraviolet rays' ability was also greatly improved when the film mixed with the MAAs and when the value of the light transmission was 0.6% at 350 nm. Compared with the pure composite film, the growth of E. coli covered by the composite film with 3.75% and 5% MAAs exhibited the best survival rate. These results reveal that MAAs are a good film-forming substrate, and MAAs have good potential to prepare anti-ultraviolet active films and antioxidant active films for applications. Overall, this project provides a theoretical basis for the study of active composite films with anti-ultraviolet activities, and it provides new ideas for the application of MAAs.

9.
Materials (Basel) ; 12(16)2019 Aug 18.
Article in English | MEDLINE | ID: mdl-31426581

ABSTRACT

In the coastal areas of southeastern China, high temperatures and humidity in the summer and microfreezing in the winter, as well as a high concentration of salt spray in the environment, seriously deteriorate the durability of asphalt mixtures. Therefore, the microcharacteristics of asphalt mastics (asphalt mixed with mineral filler) under the effect of chlorine salt and "dry-wet and freeze-thaw" (DW-FT) cycles were investigated by Fourier-transform infrared (FTIR) spectroscopy, gel permeation chromatography (GPC), and atomic force microscopy (AFM) techniques. Two factors, including asphalt mastic types (base and styrene-butadiene-styrene (SBS)-modified mastics) and numbers of DW-FT cycles, were considered based on the natural environment. Regression functions were established to explore the relationship between the FTIR, GPC, and AFM indexes. The results indicate that there were no chemical reactions between the asphalt and filler because the infrared spectrum of the base and SBS-modified mastics were similar. With the increase of the salt "DW-FT" cycle numbers, the sulfoxide index and large molecular size ratios ( L M S % ) increased, and the surface roughness ( R q and R a ) of the morphology decreased, as illustrated by a flatting mastics surface phenomenon in the AFM test. Regression analysis confirmed that there was a high correlation between the FTIR, GPC, and AFM indexes, and formation of the bee structures was closely related to the long chain index. The SBS-modified mastics had a better antiaging performance with a lower increase in the sulfoxide index after the salt "DW-FT" cycles in the coastal environment.

11.
Nat Nanotechnol ; 9(12): 1024-30, 2014 Dec.
Article in English | MEDLINE | ID: mdl-25262331

ABSTRACT

Two-dimensional layered semiconductors such as MoS2 and WSe2 have attracted considerable interest in recent times. Exploring the full potential of these layered materials requires precise spatial modulation of their chemical composition and electronic properties to create well-defined heterostructures. Here, we report the growth of compositionally modulated MoS2-MoSe2 and WS2-WSe2 lateral heterostructures by in situ modulation of the vapour-phase reactants during growth of these two-dimensional crystals. Raman and photoluminescence mapping studies demonstrate that the resulting heterostructure nanosheets exhibit clear structural and optical modulation. Transmission electron microscopy and elemental mapping studies reveal a single crystalline structure with opposite modulation of sulphur and selenium distributions across the heterostructure interface. Electrical transport studies demonstrate that the WSe2-WS2 heterojunctions form lateral p-n diodes and photodiodes, and can be used to create complementary inverters with high voltage gain. Our study is an important advance in the development of layered semiconductor heterostructures, an essential step towards achieving functional electronics and optoelectronics.


Subject(s)
Semiconductors , Crystallization
12.
Cell Biol Int ; 31(8): 805-14, 2007 Aug.
Article in English | MEDLINE | ID: mdl-17376711

ABSTRACT

Tiam1 (T lymphoma invasion and metastasis 1), a guanine nucleotide exchange factor that activates Rac, was recently identified as a novel colorectal cancer metastasis-related gene. To better understand the mechanism underlying Tiam1-mediated metastasis, we applied two-dimensional polyacrylamide gel electrophoresis (2-DE) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis to identify differentially expressed proteins between Tiam1 transfected and mock transfected colorectal cancer HT29 cells. Eleven differentially expressed proteins were identified and further validated by Western blot and/or real-time PCR. The results revealed that Tiam1 transfection in colorectal cancer cells could upregulate the expression of Fascin-1, heat shock protein 27 (HSP27), high-mobility group box 1 (HMGB1), glutathione S-transferase omega 1 (GSTO1) and downregulate the expression of annexin IV. These differentially expressed proteins may be directly or indirectly regulated by Tiam1 and be helpful in studying mechanisms that lead to the function of Tiam1. These results give some clues to elucidate the mechanism of Tiam1-mediated metastasis for colorectal cancer.


Subject(s)
Colorectal Neoplasms/metabolism , Colorectal Neoplasms/pathology , Guanine Nucleotide Exchange Factors/physiology , Neoplasm Metastasis/physiopathology , Blotting, Western , Carrier Proteins/biosynthesis , Cell Line, Tumor , Electrophoresis, Gel, Two-Dimensional , Guanine Nucleotide Exchange Factors/biosynthesis , HSP27 Heat-Shock Proteins , Heat-Shock Proteins/biosynthesis , Humans , Immunohistochemistry , Microfilament Proteins/biosynthesis , Molecular Chaperones , Neoplasm Proteins/biosynthesis , Polymerase Chain Reaction , Proteomics , Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization , T-Lymphoma Invasion and Metastasis-inducing Protein 1 , Transfection , Up-Regulation
SELECTION OF CITATIONS
SEARCH DETAIL