A ternary correlation multi-symptom network strategy based on in vivo chemical profile identification and metabolomics to explore the molecular basis of Ephedra herb against viral pneumonia.

Ephedra herb (EH), an important medicine prescribed in herbal formulas by Traditional Chinese Medicine practitioners, has been widely used in the treatment of viral pneumonia in China. However, the molecular basis of EH in viral pneumonia remains unclear. In this study, a ternary correlation multi-symptom network strategy was established based on in vivo chemical profile identification and metabolomics to explore the molecular basis of EH against viral pneumonia. Results showed that 143 compounds of EH and 70 prototype components were identified in vivo. EH could reduce alveolar-capillary barrier disruption in rats with viral pneumonia and significantly downregulate the expression of inflammatory factors and bronchoalveolar lavage fluid. Plasma metabolomics revealed that EH may be involved in the regulation of arachidonic acid, tryptophan, tyrosine, nicotinate, and nicotinamide metabolism. The multi-symptom network showed that 12 compounds have an integral function in the treatment of viral pneumonia by intervening in many pathways related to viruses, immunity and inflammation, and lung injury. Further verification demonstrated that sinapic acid and frambinone can regulate the expression of related genes. It has been shown to be a promising representative of the pharmacological constituents of ephedra.

Comparison of Non-ephedrine Constituents from Ephedra Plants Cultivated in Japan.

Ephedra plants, the main components of which are ephedrine alkaloids, are used as traditional medicines in Eastern Asian countries. In this study, we isolated non-ephedrine constituents from various Ephedra plant species cultivated in Japan. HPLC analysis suggested that kynurenic acid and its derivatives accumulated in a wide range of Ephedra plant species. Furthermore, a large amount of (2R,3S)-O-benzoyl isocitrate has been isolated from E. intermedia. This study suggests that Ephedra plants have diverse non-ephedrine constituents.

Ephedra intermedia Schrenk & C. A. Mey Methanol Extract: Nanoencapsulation by Mini-Emulsion Polymerization and its Release Trend under Simulated Conditions of the Human Body.

In this research, the extract of Ephedra intermedia Schrenk & C.A.Mey. was encapsulated using the mini-emulsion polymerization method based on methyl methacrylate polymers with a nanometer size. The encapsulated extract was characterized using different analytical techniques. Furthermore, the loading efficiency and release of the plant extract were examined. FT-IR spectroscopy confirmed the formation of an expectational product. The TEM and SEM imaging showed a spherical morphology for the prepared encapsulated extract. The average size of poly-methyl-methacrylate nanoparticles containing Ephedra extract was found to be approximately 47 nm. The extract loading efficiency and encapsulation efficiency test demonstrated a dose-depending behavior on E. intermedia extract for both analyses, which is highly advantageous for traversing biological barriers. The release assay shows a controlled release for the extract at phosphate buffer solution (PBS). A 38 % release was calculated after 36 hours. The results obtained from the present study reveal that encapsulating the plant extract is a suitable alternative to control and increase their medicinal properties.

Six New Compounds from the Herbaceous Stems of Ephedra intermedia Schrenket C. A. Meyer and Their Lung-Protective Activity.

Six new compounds, (7R,8S,8'R)-balanophorone (1), (7'S,8'R,8R)-yunnanensin A (2), (3S)-thunberginol C (3), (8R,8'R)-maninsigin B (4), (7S,8R)-4,7,8-dihydroxy-9,9-dimethyl-chroman (5), and 4-hydroxy-1-(4-hydroxy-3-methoxyphenyl)butan-1-one (6), along with eight known compounds (7-14), were isolated from the herbaceous stems of Ephedra intermedia Schrenket C. A. Meyer. Their structures were elucidated based on their spectroscopic (MS, NMR, IR, and UV) data, and their absolute configurations were determined by comparing their calculated and experimental electronic circular dichroic (ECD) spectra. Moreover, compounds 1 and 3-6 were evaluated for their ability to protect human pulmonary epithelial cells (BEAS-2B) from injury induced by lipopolysaccharide (LPS) in vitro. The results showed that compound 6 exhibited a significant protective effect against LPS-induced injury in BEAS-2B, and compound 5 exhibited a slightly protective effect at the concentration of 10 µM.

Assessment of the anti-cancer potential of Ephedra foeminea leaf extract on MDA-MB-231, MCF-7, 4 T1, and MCF-10 breast cancer cell lines: Cytotoxic, apoptotic and oxidative assays.

Ephedra foeminea is traditionally used to treat breast cancer in several Arab countries. Scientific studies have reported different effects of this plant on some cancer cell lines. The current study determined the anti-cancer potential of the methanolic extract of Ephedra foeminea against four different types of breast cancer cell lines in-vitro. The extract was prepared by maceration and phytoconstituents were identified by LC-MS analysis. The IC50 value was determined against MDA-MB-231, MCF-7, 4 T1, and MCF-10 cell lines using the MTT assay. Further investigations were carried out using IC50 concentration of the extract (40.09 µg/ml) to determine live/dead cells by acridine orange/ethidium bromide staining. The effect on the expression of reactive oxygen species (ROS) was evaluated by flow cytometry. The results were analyzed using one-way ANOVA followed by Tukey's test. The LC-MS analysis revealed the presence of 34 and 30 phytoconstituents in positive and negative modes respectively. The Ephedra foeminea extract was most effective against 4 T1 cells in a dose-dependent manner (P < 0.001) with an IC50 value of 40.09 µg/ml and showed negligible effect against MCF-10 cells. It increased apoptosis in 77.84 % of 4 T1 cells, as determined by acridine orange/ethidium bromide staining. The extract also increased the ROS expression in the 39.57 % of 4 T1 cells. The study results showed that Ephedra foeminea extract possesses an anti-cancer effect against 4 T1 cells by increasing the expression of ROS and inducing apoptosis in the 4 T1 cells. The result suggests Ephedra foemenia methanolic extract possesses a reasonable anti-cancer effect due to its effect on apoptosis and oxidative pathways. The results confirm the traditional belief that Ephedra is effective against breast cancerز.

A Case Report of Acute Bilateral Mydriasis Induced by Herbal Medication.

Ma Huang (Ephedra), a traditional herbal remedy, which contains pseudoephedrine and ephedrine, has sympathomimetic characteristics. Despite being banned by the Federal Drug Administration in 2004, it is still used for weight loss and energy boosting in some countries. A previous healthy 42-year-old woman experienced sudden blurred vision in both eyes. Her pupils were dilated to 6 mm each, showing diminished light reflex responses, and were not responsive to both 0.1% and 1% pilocarpine. The day before the onset of her symptoms she had taken a herbal supplement. The woman's herbal medicine was believed to contain ephedrine, a component found in Ma Huang. The sympathomimetic effects of this substance could potentially induce mydriasis. After discontinuing the medication, her symptoms improved over 4 days, leading to a suspicion of drug-induced bilateral mydriasis. Herbal products prescribed for weight loss, which may contain potential elements such as Ma Huang, could lead to unforeseen side effects like bilateral mydriasis, and should be appropriately highlighted.

Inhibitory effect of Ephedra herba on human norovirus infection in human intestinal organoids.

Human norovirus (HuNoV) is a major cause of acute gastroenteritis and foodborne diseases worldwide with public health concern, yet no antiviral therapies have been developed. In this study, we aimed to screen crude drugs, which are components of Japanese traditional medicine, ''Kampo'' to see their effects on HuNoV infection using a reproducible HuNoV cultivation system, stem-cell derived human intestinal organoids/enteroids (HIOs). Among the 22 crude drugs tested, Ephedra herba significantly inhibited HuNoV infection in HIOs. A time-of-drug addition experiment suggested that this crude drug more preferentially targets post-entry step than entry step for the inhibition. To our knowledge, this is the first anti-HuNoV inhibitor screen targeting crude drugs, and Ephedra herba was identified as a novel inhibitor candidate that merits further study.

Ephedrine Alkaloid-Independent High-Affinity Immunoglobulin-E Receptor (FcεRI) Internalization Results in CCL2 Production without Inducing Mast Cell Degranulation.

Mast cells (MCs) play an important role in allergies, leading to the development of MC-targeted therapies. Ephedra herb (Mao) has potent anti-allergic activity, but contains ephedrine alkaloids (EAs); therefore, its hazardous effects are taken into consideration during its clinical use. We previously reported that Mao attenuates robust MC degranulation by an allergen through high-affinity immunoglobulin E (IgE) receptor (FcεRI) internalization, in which an EA-independent mechanism was suggested to be at play. This study aimed to deepen our understanding of the potential of Mao against FcεRI internalization using two strains with different EA contents. Mao extracts were administered to bone marrow-derived MCs (BMMCs), and their cellular responses, including FcεRI internalization, were analyzed. In addition, physiological events were evaluated using a passive cutaneous anaphylactic (PCA) reaction mouse model. BMMCs mediate the production of diverse inflammatory mediators. Among these, the potent chemokine CCL2 is thought to be differentially regulated from other pro-inflammatory mediators. We found that Mao significantly induces CCL2 expression in BMMCs despite suppressing robust degranulation through FcεRI internalization. Importantly, this was a distinctly EAs-independent response. In the PCA reaction, local MC activation following allergen challenge was suppressed by Mao treatment, which strengthened the view that Mao sufficiently decreased the rapid activation of MCs and promoted CCL2 secretion. Collectively, these observations provide additional insights into the mechanism of Mao-induced silent FcεRI internalization in MCs and the complex and heterogeneous secretory responses operating in MCs.

Evaluation of the Influence of Genetic and Environmental Factors on the Ephedrine Alkaloids Content of Ephedra sinica.

Ephedra herb, a dried terrestrial stem of Ephedra sinica, is used in traditional Japanese medicine (Kampo) and Chinese medicine to treat the common cold, headaches, bronchial asthma, and nasal inflammation. E. sinica predominantly contains two ephedrine alkaloids-(-)-ephedrine and (+)-pseudoephedrine-which are crucial for its medicinal effects. This study aimed to reveal the influence of genetic and environmental factors on ephedrine alkaloids content using statistical genetic analyses. To evaluate the influence of genetic factors on ephedrine alkaloids content, 25 clonal lines were cultivated in Ibaraki and the broad-sense heritability of the traits was estimated. The heritabilities of (-)-ephedrine, (+)-pseudoephedrine, and "total alkaloids" (TA) content were 0.871, 0.969, and 0.865, respectively. The heritabilities of ephedrine alkaloids content were high. To evaluate the influence of environmental factors on ephedrine alkaloids content, four clonal lines which have different genotypes were cultivated in three locations (Ibaraki, Shizuoka, and Yamanashi prefectures). The effects of genotype (G), location (L), and genotype by environment (G × E) interactions on ephedrine alkaloids content were found to be significant (p < 0.05) by two-way ANOVA, and, in particular, the genotypic effects were found to be the largest. Our results indicate that the ephedrine alkaloids content in E. sinica is under relatively strong genetic control and remains stable under various environments. These findings suggest that E. sinica with a higher and stable ephedrine alkaloids content could be cultivated in different locations through selective breeding.

Comparative pharmacokinetic studies of Ephedra herba in common cold and nephrotic syndrome rat models.

Ephedra herba is a conventional Chinese medicine to treat cold, fever, asthma, edema, and lung diseases in the clinic. At present, most pharmacokinetic studies focus on the pharmacokinetic process of alkaloids in normal animals. However, the non-alkaloid components are also active. In addition, the pharmacokinetic studies under pathological state make more sense for clarifying the material basis of efficacy. In this study, a sensitive and rapid ultra-high-performance-tandem mass spectrometry method was developed and applied to determine nine bioactive components (ephedrine, pseudoephedrine, methylephedrine, (+)-catechin, epicatechin, vitexin, vicenin-2, cinnamic acid, and ferulic acid) in normal, common cold and nephrotic syndrome rats after the oral administration of Ephedra herba. Compared to the normal group, except for ferulic acid, the exposure levels of the other eight components were significantly increased and the plasma clearance clearly declined in common cold rats. Similarly, the exposure levels of seven components other than cinnamic acid and ferulic acid were also significantly augmented and the plasma clearance decreased significantly in nephrotic syndrome rats. In brief, the pathological conditions of the common cold and nephrotic syndrome could lead to alterations in the pharmacokinetics profiles of the nine components, which provide a reference for further exploration of the pharmacodynamics basis of Ephedra herba.

Bio-Guided Assay of Ephedra foeminea Forssk Extracts and Anticancer Activities: In Vivo, In Vitro, and In Silico Evaluations.

Ephedra is one of the oldest known medicinal plants and the largest genera of the Ephedraceae family. In vivo antitumor evaluation of Ephedra foeminea revealed that ethyl acetate (EtOAc) was the most bioactive fraction. Bio-guided fractionation of EtOAc fraction afforded nine compounds isolated for the first time from the plant species. Macrocyclic spermine alkaloids (1,9), proanthocyanidins (2,4,5), quinoline alkaloids (7,8), phenolic (3), and nucleoside (6) were identified and elucidated by spectroscopic analyses including 1D and 2D NMR, ESI-MS-MS spectrometry. The tested compounds exhibited moderate anticancer activity, except for the kynurenic acid derivative (6-mKYNA) which showed significant cytotoxicity and remarkable inhibition of CA-19.9 and CA-125 tumor biomarkers. In-silico study was conducted to determine the anti-proliferative mechanism of 6-mKYNA by using the CK2 enzyme active site. Moreover, the ADME computational study suggested that 6-mKYNA is an effective candidate with a promising pharmacokinetic profile and therapeutic potential against various types of cancer.

Diploid species phylogeny and evolutionary reticulation indicate early radiation of Ephedra in the Tethys coast.

Reconstructing a robust species phylogeny and disentangling the evolutionary and biogeographic history of the gymnosperm genus Ephedra, which has a large genome and rich polyploids, remain a big challenge. Here we reconstructed a transcriptome-based phylogeny of 19 diploid Ephedra species, and explored evolutionary reticulations in this genus represented by 50 diploid and polyploid species, using four low-copy nuclear and nine plastid genes. The diploid species phylogeny indicates that the Mediterranean species diverged first, and the remaining species split into three clades, including the American species (Clade A), E. rhytidosperma, and all other Asian species (Clade B). The single-gene trees placed E. rhytidosperma sister to Clade A, Clade B, or Clades A + B in similar proportions, suggesting that radiation and gene flow likely occurred in the early evolution of Ephedra. In addition, reticulate evolution occurred not only among the deep nodes, but also in the recently evolved South American species, which further caused difficulty in phylogenetic reconstruction. Moreover, we found that allopolyploid speciation was pervasive in Ephedra. Our study also suggests that Ephedra very likely originated in the Tethys coast during the late Cretaceous, and the South American Ephedra species have a single origin by dispersal from Mexico or North America.

Dynamics of the fermentation quality and microbiotsa in Ephedra sinica treated native grass silage.

AIMS: This study aimed to evaluate the effects of Ephedra sinica on physicochemical characteristics and bacterial community of ensiled native grass by multiple physicochemical analyses combined with high-throughput sequencing. METHODS AND RESULTS: Treatments were a control treatment with no additive (CON), E. sinica was added at 1% (CEa1), 3% (CEa2), and 5% of the fresh materials (CEa3). Compared to the CON group, the dry matter and water-soluble carbohydrate contents were significantly (p < 0.05) decreased in the CEa1 group. Compared to the CON group, the pH was significantly (p < 0.05) decreased in E. sinica treated silages, and a higher lactic acid content was observed in E. sinica treated silages. At the genus level, the abundance of Enterococcus, Lactobacillus, Pediococcus, and Weissella were the predominant member in the CON, CEa1, CEa2, and CEa3 groups, respectively. The abundance of Lactobacillus was significantly (p < 0.05) increased in the CEa1 group and Pediococcus was significantly (p < 0.05) increased in the CEa2 group. According to the 16S rRNA gene-predicted functional profiles, the inoculation of E. sinica accelerated the carbohydrate metabolism. CONCLUSIONS: In summary, the addition of E. sinica could improve the silage quality of native grass by regulating the bacterial community, and the addition of a 1% percentage of fresh materials exhibited the potential possibility of responding to get high-quality native grass silages. SIGNIFICANCE AND IMPACT OF THE STUDY: The utilization of herbal additives on fermentation quality combined with 16S rRNA gene-predicted functional analyses will contribute to the direction of future research in improving silage quality.

A New Method to Visualize the Internal Morphology of Crude Drugs Using High-Resolution X-Ray Computed Tomography.

The microscopic test method (microscopic examination) used to identify crude drugs is a common method in the identification of the original plant source by determining the characteristics from a small sample quantity. However, in recent years, the number of examiners who are familiar with the microscopic examination technique has decreased. In recent years, high-resolution X-ray computed tomography (HRXCT) has been used to visualize the internal structure of plants. HRXCT scans an object using X-rays and enables visualization of the internal structure of the crude drug using a computer. Therefore, in this report, HRXCT was used to easily observe the internal morphology of crude drugs using the Ephedra Herb as an example. The same internal morphological characteristics were observed using both, microscopic examination and HRXCT methods. Image analysis using HRXCT did not require specific techniques, such as sectioning, and the same tissue could be observed from any orientation using a single scan. It afforded remarkable technical simplification and reduction in time to inspect the organization's characteristics. Therefore, image analysis using HRXCT is a useful method for crude drug identifications.

Effect of Cultivation Conditions on Components of Ephedra sp. Using Liquid Chromatography-Mass Spectrometry and Multivariate Analysis.

In this study, we investigated the correlation between the cultivation conditions and chemical composition of Ephedra sinica and E. sp. (denoted EP-13, which has been grown at the National Institutes of Biomedical Innovation, Health, and Nutrition for many years). The total contents of ephedrine and pseudoephedrine are specified in the Japanese Pharmacopoeia; therefore, we investigated the changes in their content under different cultivation conditions, including varying soil conditions and fertilization or the lack of fertilization. Poor growth due to low soil nutrition and lack of sunlight caused decrease of the alkaloid content. As expected, the plants accumulated proline, although the proline content varied considerably with cultivation location. The proline concentration correlated with the content of methanoproline. Moreover, a new compound, namely N,N-dimethyl-p-hydroxyphenylethylamine-O-[ß-D-glucopyranosyl-(1→3)-α-L-rhamnopyranoside], was isolated from E. sinica but was absent in EP-13. This study on the correlation between cultivation methods and the alkaloid content in Ephedra is expected to assist in the future production of quality Ephedra herb.

Alkaloids from the stem of Ephedra equisetina.

Two new cyclotrypyamine alkaloids equisetinines A and B, as well as three known alkaloids (3-5) were isolated from the stems of Ephedra equisetina Bunge. Their structures were characterized by spectroscopic methods, and the absolute configurations of the new compounds were determined by interpretation of their electronic circular dichroism. Anti-asthmatic activities of compounds were evaluated by releasing ß-Hex in C48/80-induced RBL-2H3 cells, and compound 5 exhibited significant anti-asthmatic activities.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Green Synthesis of Gold, Iron and Selenium Nanoparticles Using Phytoconstituents: Preliminary Evaluation of Antioxidant and Biocompatibility Potential.

This study aimed at fabricating gold (Au), iron (Fe) and selenium (Se) nanoparticles (NPs) using various natural plant extracts from the Fertile Crescent area and evaluating their potential application as antioxidant and biocompatible agents to be used in the pharmaceutical field, especially in drug delivery. The Au-NPs were synthesized using Ephedra alata and Pistacia lentiscus extracts, whereas the Fe-NPs and Se-NPs were synthesized using peel, fruit and seed extracts of Punica granatum. The phytofabricated NPs were characterized by the UV-visible spectroscopy, scanning electron microscope, Fourier transform infrared spectroscopy, X-ray diffraction (XRD) and energy-dispersive X-ray (EDS) spectroscopy. Scanning electron microscope technique showed that the synthesized NPs surface was spherical, and the particle size analysis confirmed a particle size of 50 nm. The crystalline nature of the NPs was confirmed by the XRD analysis. All synthesized NPs were found to be biocompatible in the fibroblast and human erythroleukemic cell lines. Se-NPs showed a dose-dependent antitumor activity as evidenced from the experimental results with breast cancer (MCF-7) cells. A dose-dependent, free-radical scavenging effect of the Au-NPs and Se-NPs was observed in the DPPH (2,2-Diphenyl-1-picrylhydrazyl) assay, with the highest effect recorded for Au-NPs.

[Mahuang (herbaceous stem of Ephedra spp.): chemistry, pharmacodynamics, and pharmacokinetics].

The Chinese medicinal herb Mahuang is herbaceous stem of Ephedra sinica, E. intermedia, or E. equisetina(Family, Ephedraceae). In China, Mahuang has been used, all the way over a millennium, as a key component herb of many herbal medicines for management of epidemics of acute respiratory illness and is also used in officially recommended herbal medicines for COVID-19. Mahuang is the first-line medicinal herb for cold and wheezing and also an effective diuretic herb for edema. However, Mahuang can also exert significant adverse effects. The key to safety and effectiveness is rational and precise use of the herb. In this review article, we comprehensively summarize chemical composition of Mahuang and associated differences in pharmacognosy, pharmacodynamics and pharmacokinetics of Mahuang compounds, along with the adverse effects of Mahuang compounds and products. Based on full understanding of how Mahuang is used in Chinese traditional medicine, systematic research on Mahuang in line with contemporary standards of pharmaceutical sciences will facilitate promoting Chinese herbal medicines to become more efficient in management of epidemic illnesses, such as COVID-19. To this end, we recommend research on Mahuang of two aspects, i.e., pharmacological investigation for its multicompound-involved therapeutic effects and toxicological investigation for clinical manifestation of the adverse effects, chemicals responsible for the adverse effects, and conditions for safe use of the herb and the herb-containing medicines.

Ephedra Herb, Mao, Inhibits Antigen-Induced Mast Cell Degranulation by Induction of the Affinity Receptor for IgE Internalization.

PURPOSE: Ephedra herb (Mao) exerts potent anti-allergic effects. This study aimed to examine the underlying mechanisms of Mao on allergic inflammation using in vitro cultured mast cells (MCs) and an in vivo model of MC-dependent anaphylaxis. METHODS: Bone marrow-derived MCs (BMMCs) were presensitized with anti-2,4-dinitrophenol (DNP) immunoglobulin E (IgE) and challenged with antigens (Ag; DNP-human serum albumin). Degranulation responses and cell surface high-affinity receptor for IgE (FcεRI) expression were assessed with/without Mao treatment. Passive systemic anaphylaxis (PSA)-treated mice were administered Mao and the pathophysiological responses were evaluated. RESULTS: Mao inhibited Ag-induced BMMC degranulation, but not polyclonal activation with phorbol 12-myristate 13-acetate (PMA) and ionomycin, indicating that Mao inhibits IgE-dependent activation of BMMCs. Mao-treated BMMCs exhibited significant reductions in expression of surface IgE and its receptor FcεRI. Analysis of subcellular localization revealed that Mao induces FcεRI internalization in BMMCs without degranulation. In the PSA mouse model, Mao administration prevented antigen-induced hypothermia. Mao administration significantly reduced cell surface expression of IgE-bound FcεRI on peritoneal MCs. CONCLUSIONS: Mao induced FcεRI internalization in MCs, thereby inhibiting Ag-induced IgE-dependent degranulation. The inhibitory effects of Mao on MC degranulation may offer a novel therapeutic approach for allergic diseases.