The Resistance of Soybean Variety Heinong 84 to Apple Latent Spherical Virus Is Controlled by Two Genetic Loci.

Apple latent spherical virus (ALSV) is widely used as a virus-induced gene silencing (VIGS) vector for function genome study. However, the application of ALSV to soybeans is limited by the resistance of many varieties. In this study, the genetic locus linked to the resistance of a resistant soybean variety Heinong 84 was mapped by high-throughput sequencing-based bulk segregation analysis (HTS-BSA) using a hybrid population crossed from Heinong 84 and a susceptible variety, Zhonghuang 13. The results showed that the resistance of Heinong 84 to ALSV is controlled by two genetic loci located on chromosomes 2 and 11, respectively. Cleaved amplified polymorphic sequence (CAPS) markers were developed for identification and genotyping. Inheritance and biochemical analyses suggest that the resistance locus on chromosome 2 plays a dominant dose-dependent role, while the other locus contributes a secondary role in resisting ALSV. The resistance locus on chromosome 2 might encode a protein that can directly inhibit viral proliferation, while the secondary resistance locus on chromosome 11 may encode a host factor required for viral proliferation. Together, these data reveal novel insights on the resistance mechanism of Heinong 84 to ALSV, which will benefit the application of ALSV as a VIGS vector.

Transcriptome Analysis Reveals the Effect of Oyster Mushroom Spherical Virus Infection in Pleurotus ostreatus.

Oyster mushroom spherical virus (OMSV) is a mycovirus that inhibits mycelial growth, induces malformation symptoms, and decreases the yield of fruiting bodies in Pleurotus ostreatus. However, the pathogenic mechanism of OMSV infection in P. ostreatus is poorly understood. In this study, RNA sequencing (RNA-seq) was conducted, identifying 354 differentially expressed genes (DEGs) in the mycelium of P. ostreatus during OMSV infection. Verifying the RNA-seq data through quantitative real-time polymerase chain reaction on 15 DEGs confirmed the consistency of gene expression trends. Both Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses highlighted the pivotal role of primary metabolic pathways in OMSV infection. Additionally, significant changes were noted in the gene expression levels of carbohydrate-active enzymes (CAZymes), which are crucial for providing the carbohydrates needed for fungal growth, development, and reproduction by degrading renewable lignocellulose. The activities of carboxymethyl cellulase, laccase, and amylase decreased, whereas chitinase activity increased, suggesting a potential mechanism by which OMSV influenced mycelial growth through modulating CAZyme activities. Therefore, this study provided insights into the pathogenic mechanisms triggered by OMSV in P. ostreatus.

Transmission of Oyster Mushroom Spherical Virus to Progeny via Basidiospores and Horizontally to a New Host Pleurotus floridanus.

Mycoviruses are usually transmitted horizontally via hyphal anastomosis and vertically through sporulation in natural settings. Oyster mushroom spherical virus (OMSV) is a mycovirus that infects Pleurotus ostreatus, with horizontal transmission via hyphal anastomosis. However, whether OMSV can be vertically transmitted is unclear. This study aimed to investigate the transmission characteristics of OMSV to progeny via basidiospores and horizontally to a new host. A total of 37 single-basidiospore offspring were obtained from OMSV-infected P. ostreatus and Pleurotus pulmonarius for Western blot detection of OMSV. The OMSV-carrying rate among monokaryotic isolates was 19% in P. ostreatus and 44% in P. pulmonarius. Then, OMSV-free and OMSV-infected monokaryotic isolates were selected for hybridization with harvested dikaryotic progeny strains. Western blot analyses of the offspring revealed that the OMSV transmission efficiency was 50% in P. ostreatus and 75% in P. pulmonarius, indicating vertical transmission via sexual basidiospores. Furthermore, we observed the horizontal transfer of OMSV from P. pulmonarius to Pleurotus floridanus. OMSV infection in P. floridanus resulted in significant inhibition of mycelial growth and yield loss. This study was novel in reporting the vertical transmission of OMSV through basidiospores, and its infection and pathogenicity in a new host P. floridanus.

Oyster Mushroom Spherical Virus Crosses the Species Barrier and Is Pathogenic to a New Host Pleurotus pulmonarius.

Oyster mushroom spherical virus (OMSV) is a mycovirus with a positive-sense single-stranded RNA genome that infects the edible mushroom Pleurotus ostreatus. OMSV is horizontally transferred from an infected strain to a cured strain via mycelia. The infection results in significant inhibition of mycelial growth, malformation of fruiting bodies, and yield loss in oyster mushrooms. This study successfully transferred OMSV from P. ostreatus to Pleurotus pulmonarius. However, transmission was not successful in other Pleurotus species including P. citrinopileatus, P. eryngii, P. nebrodensis, and P. salmoneostramineus. The successful OMSV infection in P. pulmonarius was further verified with Western blot analysis using a newly prepared polyclonal antiserum against the OMSV coat protein. Furthermore, OMSV infection reduced the mycelial growth rate of P. pulmonarius. The OMSV-infected strain demonstrated abnormal performance including twisted mushrooms or irregular edge of the cap as well as reduced yield of fruiting bodies in P. pulmonarius, compared to the OMSV-free strain. This study is the first report on the infection and pathogenicity of OMSV to the new host P. pulmonarius. The data from this study therefore suggest that OMSV is a potential threat to P. pulmonarius.

Multiplex Detection of Pleurotus ostreatus Mycoviruses.

Mycoviruses are viruses that specifically infect and replicate in fungi. Several mycoviruses have been previously reported in Pleurotus ostreatus, including the oyster mushroom spherical virus (OMSV), oyster mushroom isometric virus (OMIV), Pleurotus ostreatus spherical virus (POSV), and Pleurotus ostreatus virus 1 (PoV1). This study was designed to develop a multiplex RT-PCR for simultaneous detection and differentiation of the four P. ostreatus mycoviruses. Four pairs of primers were designed from conserved regions based on the reported sequences and the multiplex RT-PCR products were 672 bp for OMSV, 540 bp for OMIV, 310 bp for POSV, and 200 bp for PoV1. The optimal annealing temperature of the multiplex RT-PCR was 62 °C and the detection limits of the plasmids were 100 fg for OMSV and OMIV and 1 pg for POSV and PoV1. This technique was successfully applied for the detection of OMSV, OMIV, and POSV from different P. ostreatus strains and the plasmid containing the PoV1 sequence. This methodology can serve as a powerful diagnostic tool for the survey of the incidence and epidemiology of the four P. ostreatus mycoviruses, further contributing to the prevention and treatment of mycoviral diseases in P. ostreatus.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

Estimation of the functions of viral RNA silencing suppressors by apple latent spherical virus vector.

Apple latent spherical virus (ALSV) is a latent virus with wide host range of plant species. In the present study, we prepared ALSV vectors expressing RNA silencing suppressors (RSSs) from eight plant viruses: P19 of carnation Italian ring spot virus (tombusvirus), 2b of peanut stunt virus (cucumovirus), NSs of tomato spotted wilt virus (tospovirus), HC-Pro of bean yellow mosaic virus (potyvirus), γb of barley stripe mosaic virus (hordeivirus), P15 of peanut clump virus (pecluvirus), P1 of rice yellow mottle virus (sobemovirus), or P21 of beet yellows virus (closterovirus). These vectors were inoculated to Nicotiana benthamiana to investigate the effects of RSSs on the virulence and accumulation of ALSV. Among the vectors, ALSV expressing NSs (ALSV-NSs) developed severe mosaic symptoms in newly developed leaves followed by plant death. Infection of ALSV-γb induced characteristic concentric ringspot symptoms on leaves, and plants infected with ALSV-HC-Pro showed mosaic and dwarf symptoms. Infection of the other five ALSV vectors did not show symptoms. ELISA and immunoblot assay indicated that virus titer increased in leaves infected with ALSV-NSs, γb, HC-Pro, or P19. RT-qPCR indicated that the amount of ALSV in plants infected with ALSV-NSs was increased by approximately 45 times compared with that of wtALSV without expression of any RSS. When ALSV-P19, NSs, or HC-Pro was inoculated to Cucumis sativus plants, none of these ALSV vectors induced symptoms, but accumulation of ALSV in plants infected with ALSV-NSs was increased, suggesting that functions of RSSs on virulence and accumulation of ALSV depend on host species.

Novel alleles of rice eIF4G generated by CRISPR/Cas9-targeted mutagenesis confer resistance to Rice tungro spherical virus.

Rice tungro disease (RTD) is a serious constraint in rice production across tropical Asia. RTD is caused by the interaction between Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus. RTSV resistance found in traditional cultivars has contributed to a reduction in the incidence of RTD in the field. Natural RTSV resistance is a recessive trait controlled by the translation initiation factor 4 gamma gene (eIF4G). The Y1059 V1060 V1061 residues of eIF4G are known to be associated with the reactions to RTSV. To develop new sources of resistance to RTD, mutations in eIF4G were generated using the CRISPR/Cas9 system in the RTSV-susceptible variety IR64, widely grown across tropical Asia. The mutation rates ranged from 36.0% to 86.6%, depending on the target site, and the mutations were successfully transmitted to the next generations. Among various mutated eIF4G alleles examined, only those resulting in in-frame mutations in SVLFPNLAGKS residues (mainly NL), adjacent to the YVV residues, conferred resistance. Furthermore, our data suggest that eIF4G is essential for normal development, as alleles resulting in truncated eIF4G could not be maintained in homozygous state. The final products with RTSV resistance and enhanced yield under glasshouse conditions were found to no longer contain the Cas9 sequence. Hence, the RTSV-resistant plants with the novel eIF4G alleles represent a valuable material to develop more diverse RTSV-resistant varieties.

Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus × domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth.

MAIN CONCLUSION: The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

Allelic variants of the esterase gene W14/15 differentially regulate overwinter survival in perennial gentian (Gentiana L.).

Overwinter survival has to be under critical regulation in the lifecycle of herbaceous perennial plants. Gentians (Gentiana L.) maintain their perennial life style through producing dormant and freezing-tolerant overwinter buds (OWBs) to overcome cold winter. However, the mechanism acting on such an overwinter survival and the genes/proteins contributing to it have been poorly understood. Previously, we identified an OWB-enriched protein W14/15, a member of a group of α/ß hydrolase fold superfamily that is implicated in regulation of hormonal action in plants. The W14/15 gene has more than ten variant types in Gentiana species. However, roles of the W14/15 gene in OWB survival and functional difference among those variants have been unclear. In the present study, we examined whether the W14/15 gene variants are involved in the mechanism acting on overwinter survival, by crossing experiments using cultivars carrying different W14/15 variant alleles and virus-induced gene silencing experiments. We found that particular types of the W14/15 variants (W15a types) contributed toward obtaining high ability of overwinter survival, while other types (W14b types) did not, or even interfered with the former type gene. This study demonstrates two findings; first, contribution of esterase genes to winter hardiness, and second, paired set or paired partner among the allelic variants determines the ability of overwinter survival.

Rice tungro spherical virus resistance into photoperiod-insensitive japonica rice by marker-assisted selection.

Rice tungro disease (RTD) is one of the destructive and prevalent diseases in the tropical region. RTD is caused by Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus. Cultivation of japonica rice (Oryza sativa L. ssp japonica) in tropical Asia has often been restricted because most japonica cultivars are sensitive to short photoperiod, which is characteristic of tropical conditions. Japonica1, a rice variety bred for tropical conditions, is photoperiod-insensitive, has a high yield potential, but is susceptible to RTD and has poor grain quality. To transfer RTD resistance into Japonica1, we made two backcrosses (BC) and 8 three-way crosses (3-WC) among Japonica1 and RTSV-resistant cultivars. Among 8,876 BC1F2 and 3-WCF2 plants, 342 were selected for photoperiod-insensitivity and good grain quality. Photoperiod-insensitive progenies were evaluated for RTSV resistance by a bioassay and marker-assisted selection (MAS), and 22 BC1F7 and 3-WCF7 lines were selected based on the results of an observational yield trial. The results demonstrated that conventional selection for photoperiod-insensitivity and MAS for RTSV resistance can greatly facilitate the development of japonica rice that is suitable for cultivation in tropical Asia.

Reduced generation time of apple seedlings to within a year by means of a plant virus vector: a new plant-breeding technique with no transmission of genetic modification to the next generation.

Fruit trees have a long juvenile phase. For example, the juvenile phase of apple (Malus × domestica) generally lasts for 5-12 years and is a serious constraint for genetic analysis and for creating new apple cultivars through cross-breeding. If modification of the genes involved in the transition from the juvenile phase to the adult phase can enable apple to complete its life cycle within 1 year, as seen in herbaceous plants, a significant enhancement in apple breeding will be realized. Here, we report a novel technology that simultaneously promotes expression of Arabidopsis FLOWERING LOCUS T gene (AtFT) and silencing of apple TERMINAL FLOWER 1 gene (MdTFL1-1) using an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) to accelerate flowering time and life cycle in apple seedlings. When apple cotyledons were inoculated with ALSV-AtFT/MdTFL1 immediately after germination, more than 90% of infected seedlings started flowering within 1.5-3 months, and almost all early-flowering seedlings continuously produced flower buds on the lateral and axillary shoots. Cross-pollination between early-flowering apple plants produced fruits with seeds, indicating that ALSV-AtFT/MdTFL1 inoculation successfully reduced the time required for completion of the apple life cycle to 1 year or less. Apple latent spherical virus was not transmitted via seeds to successive progenies in most cases, and thus, this method will serve as a new breeding technique that does not pass genetic modification to the next generation.

Efficient virus-induced gene silencing system in pumpkin (Cucurbita maxima) using apple latent spherical virus vector.

Crude-sap of apple latent spherical virus (ALSV)-infected Chenopodium quinoa leaves was rub-inoculated on the expanded cotyledons of various Cucurbitaceae plants. Most of the species were systemically infected with the virus without obvious symptoms, except pumpkin (Cucurbita maxima). In pumpkin, the ALSV infection was restricted to inoculated cotyledons; it did not spread to the upper true leaves. In situ hybridization showed that the ALSV was confined to part of the cotyledon tissues and it did not invade the phloem tissue, when inoculated at the expanded cotyledon stage. However, when total RNAs from ALSV-infected C. quinoa leaves were inoculated into the cotyledons immediately after germination (folded cotyledon stage) using particle bombardment, ALSV efficiently caused systemic infection. Systemic infection of pumpkin seedlings occurred only when the cotyledons were inoculated within a few days after germination. No systemic infection was observed in the seedlings 4 days after germination. In the grafting test, ALSV was not transmitted from the infected rootstocks to the healthy scions of pumpkins. An efficient virus-induced gene silencing system for pumpkins was established, in which infection with ALSV vectors harboring the phytoene desaturase or sulfur gene fragments resulted in a uniform phenotype in the true leaves of pumpkin seedlings.

Preliminary Studies on the Effects of Oyster Mushroom Spherical Virus China Strain on the Mycelial Growth and Fruiting Body Yield of the Edible Mushroom Pleurotus ostreatus.

Oyster mushroom spherical virus (OMSV) is a positive-sense single-stranded RNA mycovirus which is associated with a devastating oyster mushroom die-back disease. However, little is known about its diversity, and the effects of OMSV infection on its fungal host are not well understood. In this study, we determined the nearly complete nucleotide sequence of OMSV isolated from cultivated oyster mushrooms in China. Sequence analysis suggested that the virus represents a new strain of OMSV (referred to here as OMSV-Ch). A GenBank BLAST search of the genomic sequences demonstrated that the OMSV-Ch had the highest identity (74.9%) with the OMSV from Korea (OMSV-Kr). At the amino acid-sequence level, these two strains shared 84.1% identity in putative replication protein (RP) and 94.1% identity in coat protein (CP). Phylogenetic analysis based on RP showed that OMSV-Ch clustered with OMSV-Kr, closely related to Tymoviridae. Phylogenetic analysis based on both the RP and CP showed that OMSV had a distant clade relationship with tymoviruses, marafiviruses, and maculaviruses. We obtained the OMSV-Ch-free Pleurotus ostreatus strain via single hyphal tip cultures combined with high-temperature treatment. Preliminary studies indicate that OMSV-Ch can significantly inhibit mycelial growth, cause malformations of the fruiting bodies, and reduce the yield of P. ostreatus. Co-cultivation resulted in horizontal transmission of the OMSV-Ch to a virus-cured strain. The findings of our study contribute to the prevention and control of mycoviral diseases in the future.

Novel Functional Analysis for Pathogenic Proteins of Bursaphelenchus xylophilus in Pine Seed Embryos Using a Virus Vector.

Pine wilt disease (PWD), which is caused by the pine wood nematode Bursaphelenchus xylophilus, is among the most serious tree diseases worldwide. PWD is thought to be initiated by sequential excessive hypersensitive responses to B. xylophilus. Previous studies have reported candidate pathogenic molecules inducing hypersensitive responses in pine trees susceptible to B. xylophilus. The functions of some of these molecules have been analyzed in model plants using transient overexpression; however, whether they can induce hypersensitive responses in natural host pines remains unclear due to the lack of a suitable functional analysis method. In this study, we established a novel functional analysis method for susceptible black pine (Pinus thunbergii) seed embryos using transient overexpression by the Apple latent spherical virus vector and investigated five secreted proteins of B. xylophilus causing cell death in tobacco to determine whether they induce hypersensitive responses in pine. We found that three of five molecules induced significantly higher expression in pathogenesis-related genes ( p < 0.05), indicating hypersensitive response in pine seed embryos compared with mock and green fluorescence protein controls. This result suggests that tobacco-based screening may detect false positives. This study is the first to analyze the function of pathogenic candidate molecules of B. xylophilus in natural host pines using exogenous gene expression, which is anticipated to be a powerful tool for investigating the PWD mechanism.

Development and application of a virus-induced gene silencing protocol for the study of gene function in narrow-leafed lupin.

BACKGROUND: Lupins are promising protein crops with an increasing amount of genomic and transcriptomic resources. The new resources facilitate the in silico identification of candidate genes controlling important agronomic traits. However, a major bottleneck for lupin research and crop improvement is the in planta characterization of gene function. Here, we present an efficient protocol for virus-induced gene silencing (VIGS) to down-regulate endogenous genes in narrow-leafed lupin (NLL) using the apple latent spherical virus (ALSV). RESULTS: We identified ALSV as an appropriate VIGS vector able to infect NLL without causing a discernible phenotype. We created improved ALSV vectors to allow for efficient cloning of gene fragments into the viral genome and for easier viral propagation via agroinfiltration of Nicotiana benthamiana. Using this system, we silenced the visual marker gene phytoene desaturase (PDS), which resulted in systemic, homogenous silencing as indicated by bleaching of newly produced tissues. Furthermore, by silencing lysine decarboxylase (LaLDC)-a gene likely to be involved in toxic alkaloid biosynthesis-we demonstrate the applicability of our VIGS method to silence a target gene alone or alongside PDS in a 'PDS co-silencing' approach. The co-silencing approach allows the visual identification of tissues where silencing is actively occurring, which eases tissue harvesting and downstream analysis, and is useful where the trait under study is not affected by PDS silencing. Silencing LaLDC resulted in a ~ 61% or ~ 67% decrease in transcript level, depending on whether LaLDC was silenced alone or alongside PDS. Overall, the silencing of LaLDC resulted in reduced alkaloid levels, providing direct evidence of its involvement in alkaloid biosynthesis in NLL. CONCLUSIONS: We provide a rapid and efficient VIGS method for validating gene function in NLL. This will accelerate the research and improvement of this underutilized crop.

Viral Phrenology.

We introduce Viral Phrenology, a new scheme for understanding the genomic composition of spherical viruses based on the locations of their structural protrusions. We used icosahedral point arrays to classify 135 distinct viral capsids collected from over 600 capsids available in the VIPERdb. Using gauge points of point arrays, we found 149 unique structural protrusions. We then show how to use the locations of these protrusions to determine the genetic composition of the virus. We then show that ssDNA, dsDNA, dsRNA and ssRNA viruses use different arrangements for distributing their protrusions. We also found that Triangulation number is also partially dependent on the structural protrusions. This analysis begins to tie together Baltimore Classification and Triangulation number using point arrays.

Virus-Mediated Transient Expression Techniques Enable Functional Genomics Studies and Modulations of Betalain Biosynthesis and Plant Height in Quinoa.

Quinoa (Chenopodium quinoa), native to the Andean region of South America, has been recognized as a potentially important crop in terms of global food and nutrition security since it can thrive in harsh environments and has an excellent nutritional profile. Even though challenges of analyzing the complex and heterogeneous allotetraploid genome of quinoa have recently been overcome, with the whole genome-sequencing of quinoa and the creation of genotyped inbred lines, the lack of technology to analyze gene function in planta is a major limiting factor in quinoa research. Here, we demonstrate that two virus-mediated transient expression techniques, virus-induced gene silencing (VIGS) and virus-mediated overexpression (VOX), can be used in quinoa. We show that apple latent spherical virus (ALSV) can induce gene silencing of quinoa phytoene desaturase (CqPDS1) in a broad range of quinoa inbred lines derived from the northern and southern highland and lowland sub-populations. In addition, we show that ALSV can be used as a VOX vector in roots. Our data also indicate that silencing a quinoa 3,4-dihydroxyphenylalanine 4,5-dioxygenase gene (CqDODA1) or a cytochrome P450 enzyme gene (CqCYP76AD1) inhibits betalain production and that knockdown of a reduced-height gene homolog (CqRHT1) causes an overgrowth phenotype in quinoa. Moreover, we show that ALSV can be transmitted to the progeny of quinoa plants. Thus, our findings enable functional genomics in quinoa, ushering in a new era of quinoa research.

Sequence and Phylogenetic Analysis of the First Complete Genome of Ricetungro spherical virus in Malaysia.

BACKGROUND: Rice tungro disease (RTD) is a viral disease mainly affecting rice in Asia. RTD caused by Rice tungro bacilliform virus and Rice tungro spherical virus. To date, there are only 5 RTSV isolates have been reported. OBJECTIVES: In this study, we aimed to report the complete nucleotide sequence of Malaysian isolate of Rice tungro spherical virus Seberang Perai (RTSV-SP) for the first time. RTSV-SP was characterized and its evolutionary relationship with previously reported Indian and Philippines isolates were elucidated. MATERIALS AND METHODS: RTSV-SP isolate was isolated from a recent outbreak in a paddy field in Seberang Perai zone of Malaysia. Its complete genome was amplified by RT-PCR, cloned and sequenced. RESULTS: Sequence analysis indicated that the genome of RTSV-SP consisted of 12,173 nucleotides (nt). Comparative analysis of 6 complete genome sequences using Clustal Omega showed that Seberang Perai isolate shared the highest nucleotide identity (96.04%) with Philippine-A isolate, except that the sORF-2 of RTSV-SP is shorter than RTSV Philippine-A by 27 amino acid residues. RTSV-SP found to cluster in Southeast Asia (SEA) group based on the whole genome sequence phylogenetic analysis using MEGA X software. CONCLUSIONS: Phylogenetic classification of RTSV isolates based on the complete nucleotide sequences showed more distinctive clustering pattern with the addition of RTSV-SP whole genome to the available isolates. Present study described the isolation and molecular characterization of RTSV-SP.

Development of a Virus-Induced Gene Silencing System for Dioecious Coccinia grandis.

Coccinia grandis is an interesting model system to understand dioecy in Cucurbitaceae family. Recent transcriptomics and proteomics studies carried out to understand the sex expression in C. grandis have resulted in identification of many candidate sex-biased genes. In absence of an efficient genetic transformation protocol for C. grandis, virus-induced gene silencing (VIGS) would be a powerful tool to enable gene functional analysis. In current study, we explored the apple latent spherical virus (ALSV) for gene knockdown in C. grandis. The viral infection was achieved through mechanical inoculation of ALSV-infected Chenopodium quinoa leaf extract onto the cotyledons of C. grandis. ALSV-VIGS mediated knockdown of CgPDS gene was successfully achieved in C. grandis by mechanical inoculation method resulting in characteristic photobleaching. Subsequently, we developed agroinfiltration compatible vectors for direct infection of C. grandis and shortened the time-frame by skipping viral propagation in C. quinoa. Typical yellow-leaf phenotype was observed in C. grandis plants agroinfiltrated with ALSV-CgSU constructs, indicating robust silencing of CgSU gene. In addition, we improved the infection efficiency of ALSV by co-infiltration of P19 viral silencing suppressor. These results suggest that ALSV-VIGS is suitable for characterization of gene function in dioecious C. grandis and it can help us understand the mechanism of sex expression.