Case series: Fundus autofluorescence abnormalities in a family of ocular albinism carriers.

SIGNIFICANCE: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence. PURPOSE: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases. CASE REPORTS: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism. CONCLUSIONS: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations.

Novel Variants of HPS6 Cause Suspected Ocular Albinism: A Report of 2 Cases and the Profile of HPS6 Variants.

INTRODUCTION: Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations. METHODS: Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed. RESULTS: We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease. CONCLUSION: Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Genotypic and Phenotypic Spectrum of Foveal Hypoplasia: A Multicenter Study.

PURPOSE: To characterize the genotypic and phenotypic spectrum of foveal hypoplasia (FH). DESIGN: Multicenter, observational study. PARTICIPANTS: A total of 907 patients with a confirmed molecular diagnosis of albinism, PAX6, SLC38A8, FRMD7, AHR, or achromatopsia from 12 centers in 9 countries (n = 523) or extracted from publicly available datasets from previously reported literature (n = 384). METHODS: Individuals with a confirmed molecular diagnosis and availability of foveal OCT scans were identified from 12 centers or from the literature between January 2011 and March 2021. A genetic diagnosis was confirmed by sequence analysis. Grading of FH was derived from OCT scans. MAIN OUTCOME MEASURES: Grade of FH, presence or absence of photoreceptor specialization (PRS+ vs. PRS-), molecular diagnosis, and visual acuity (VA). RESULTS: The most common genetic etiology for typical FH in our cohort was albinism (67.5%), followed by PAX6 (21.8%), SLC38A8 (6.8%), and FRMD7 (3.5%) variants. AHR variants were rare (0.4%). Atypical FH was seen in 67.4% of achromatopsia cases. Atypical FH in achromatopsia had significantly worse VA than typical FH (P < 0.0001). There was a significant difference in the spectrum of FH grades based on the molecular diagnosis (chi-square = 60.4, P < 0.0001). All SLC38A8 cases were PRS- (P = 0.003), whereas all FRMD7 cases were PRS+ (P < 0.0001). Analysis of albinism subtypes revealed a significant difference in the grade of FH (chi-square = 31.4, P < 0.0001) and VA (P = 0.0003) between oculocutaneous albinism (OCA) compared with ocular albinism (OA) and Hermansky-Pudlak syndrome (HPS). Ocular albinism and HPS demonstrated higher grades of FH and worse VA than OCA. There was a significant difference (P < 0.0001) in VA between FRMD7 variants compared with other diagnoses associated with FH. CONCLUSIONS: We characterized the phenotypic and genotypic spectrum of FH. Atypical FH is associated with a worse prognosis than all other forms of FH. In typical FH, our data suggest that arrested retinal development occurs earlier in SLC38A8, OA, HPS, and AHR variants and later in FRMD7 variants. The defined time period of foveal developmental arrest for OCA and PAX6 variants seems to demonstrate more variability. Our findings provide mechanistic insight into disorders associated with FH and have significant prognostic and diagnostic value.

Pseudo-Gaze Deviation Resulting From Positive Angle Kappa and Esotropia.

ABSTRACT: A 6-year-old boy was referred for constant right gaze deviation. Rather than a gaze deviation, he constantly seemed to look on the left side of any displayed target. Examination revealed the association of a highly positive angle Kappa and an esotropia of equal values. He also exhibited signs of ocular albinism with no associated infantile nystagmus syndrome. The X-linked ocular albinism was confirmed genetically, explaining the presence of a positive angle Kappa. A highly positive angle Kappa can be associated with a convergent strabismus; in case both values offset each other, this can result in a constant "sidelooking," which should not be confused with a gaze deviation.

[Nystagmus secondary to albinism with ocular involvement in a female: A diagnostic challenge]. / Nistagmo secundario a albinismo con compromiso ocular en paciente femenina: Un desafío diagnóstico.

INTRODUCTION: Infantile nystagmus is an infrequent condition that represents a diagnostic challenge for the pediatri cian. Albinism is one of its main causes, being difficult to suspect in the absence of evident cutaneous involvement, especially in female patients, due to the inheritance type of ocular albinism. Objec tive: To describe a case of nystagmus secondary to albinism with isolated ocular involvement in a female patient, in order to provide tools for pediatric approach and diagnosis. CLINICAL CASE: Three- weeks-old female patient, without morbid history, referred to a pediatric neurosurgeon and ophthal mologist due to paroxysmal eye movements since 2 weeks of age. The electroencephalogram and brain images were normal. In follow-up monitoring at 3 months, iris translucency, nystagmus, and hypermetropic astigmatism were confirmed. Dermatologic evaluation ruled out cutaneous invol vement. The patient developed cephalic downward inclination and coordination development de lay was confirmed, the patient was handled with corrective lenses and kinesiotherapy. In follow-up monitoring at 3 years, there was an improvement in visual acuity, decreased nystagmus and normal neurodevelopment. The ophthalmological evaluation of both parents was normal and there was no history of nystagmus or albinism in the family. Upon her parents' decision, no genetic study was ca rried out. CONCLUSION: The diagnosis of nystagmus secondary to ocular albinism, even in the absence of cutaneous involvement, is clinical. The genetic study allows confirming the etiology, without being an essential examination, unless family planning is considered. Timely research and multidisciplinary intervention determine a better prognosis.

Congenital grouped albinotic spots of the retinal pigment epithelium in a patient with hemihypertrophy and café au lait spots.

PURPOSE: To describe the finding of circularly grouped hypomelanotic spots in the central macula of a patient with syndromic characteristics. METHODS: Case report of a patient with albinotic spots grouped within the macula, café au lait spots, and left-sided hemihypertrophy. RESULTS: A 15-year-old boy presented with hypomelanotic spots which were hyperautofluorescent on fundus autofluorescence imaging with no disruption of the retinal laminae or photoreceptor inner and outer segment (IS/OS) junction on spectral domain optical coherence tomography. His developmental history included hemihypertrophy, café au lait spots over his axilla and extremities, and surgically corrected left-sided cryptorchidism. Other ocular history included resolved convergence insufficiency and red-green color blindness. CONCLUSIONS: It is essential to recognize that circularly grouped hypomelanotic spots are a benign condition. The location and arrangement of the hypomelanotic spots were atypical for congenital grouped albinotic spots of the retinal pigment epithelium (CGAS) as they were grouped within the macula in addition to a more characteristic linear "bear track" formation in the periphery. To the authors' knowledge, this is the first report of CGAS present in a patient with hemihypertrophy, café au lait spots, and cryptorchidism and may represent a novel syndromic association.

Progressive retinal degeneration in a girl with Knobloch syndrome who presented with signs of ocular albinism.

PURPOSE: We report for the first time electroretinographic (ERG) evidence of progressive retinal abnormalities in a girl who presented in infancy with ocular features of albinism and gradually developed choroidal sclerosis and patchy retinal atrophy leading to a diagnosis of Knobloch syndrome (KS, OMIM 267750, COL18A1). METHODS: At age 2 months, nystagmus and esotropia prompted ophthalmic evaluation. The appearance of choroidal sclerosis and atrophic retinal patches led to further evaluation at age 8 years. Genetics consultation was obtained in infancy and again at age 8 years as retinal findings evolved. Full field ERG responses in both scotopic and photopic conditions were recorded at both ages and compared to those in healthy control subjects. RESULTS: At age 2 months ERG response parameters were within normal limits for age and tyrosinase (TYR) gene sequencing revealed one novel mutation, p.S466F, and the temperature-sensitive polymorphism, p.R402Q, suggesting the diagnosis of oculocutaneous albinism type 1 (OCA1). At age 8 years, there was significant attenuation of both scotopic and photopic ERG responses. Genetic re-analysis led to the identification of a homozygous mutation, c.3213dupC, in the COL18A1 gene, thus confirming the diagnosis of Knobloch syndrome. CONCLUSIONS: Our patient with Knobloch syndrome developed abnormal ERG responses similar to those found in col18a1 knockout mice. Thus, we have documented progressive attenuation of the scotopic and photopic responses in KS.

[Oculocutaneous and ocular albinism]. / Okulokutaner und okulärer Albinismus.

Albinism can be divided into oculocutaneous albinism (OCA) and ocular albinism (OA). In the differential diagnostics these can be distinguished from rarer syndromes with partial albinism, which are frequently associated with susceptibility to infections and neurological symptoms. The OCA is an autosomal recessive inherited disease of melanin biosynthesis, which leads to complete or partial loss of melanin in the skin, hair follicles and eyes. Of the seven currently known subtypes (OCA 1-7), four are well-characterized (OCA 1-4). These are based on gene mutations, which code for tyrosinase, a key enzyme in melanin synthesis and for further proteins. These play an important role in the catalytic activity of tyrosinase and the structure and function of melanosomes. In the presence of these subtypes, the clinical symptoms and the course of the disease show a pronounced variability, especially in the type and extent of pigmentation of the skin and hair as well as the severity of eye involvement, which makes the phenotypic classification difficult. Treatment priorities are a consistent protection from UV light for prophylaxis against skin cancer and regular preventive investigations. The ocular alterations typical for albinism necessitate timely diagnostics and care by institutions specialized in ophthalmology. Novel strategies for systemic treatment of subtypes of albinism are in preclinical testing. The OA without skin involvement shows X­linked inheritance, is much rarer and is characterized by reduced pigmentation of the retina and iris, nystagmus and macular hypoplasia, sometimes with substantial loss of visual acuity. The typical ocular symptoms of OA can be manifested to a varying extent in all forms of OCA.

Homozygosity mapping in albinism patients using a novel panel of 13 STR markers inside the nonsyndromic OCA genes: introducing 5 novel mutations.

Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented hair, skin and eyes. It is associated with decreased visual acuity, nystagmus, strabismus and photophobia. Six genes are known to be involved in nonsyndromic oculocutaneous albinism (OCA). In this study, we aimed to find the disease causing mutations in albinism patients using homozygosity mapping. Twenty three unrelated patients with nonsyndromic OCA or autosomal recessive ocular albinism were recruited in this study. All of the patients' parents had consanguineous marriage and all were screened for TYR mutations previously. At first, we performed homozygosity mapping using fluorescently labeled primers to amplify a novel panel of 13 STR markers inside the OCA genes and then the screened loci in each family were studied using PCR and cycle sequencing methods. We found five mutations including three mutations in OCA2, one mutation in SLC45A2 and one mutation in C10ORF11 genes, all of which were novel. In cases where the disease causing mutations are identical by descent due to a common ancestor, these STR markers can enable us to screen for the responsible genes.

Novel HPS6 mutations identified by whole-exome sequencing in two Japanese sisters with suspected ocular albinism.

Hermansky-Pudlak syndrome (HPS) is an autosomal recessive disorder characterized by oculocutaneous albinism, platelet dysfunction and ceroid deposition. We report suspected ocular albinism in two Japanese sisters, caused by mutations in the HPS6 (Hermansky-Pudlak syndrome 6) gene. Trio-based whole-exome sequencing (WES) identified novel compound heterozygous mutations in HPS6 (c.1898delC: mother origin and c.2038C>T: father origin) in the two sisters. To date, 10 associated mutations have been detected in HPS6. Although we detected no general manifestations, including platelet dysfunction, in the sisters, even in long-term follow-up, we established a diagnosis of HPS type 6 based on the HPS6 mutations and absence of dense bodies in the platelets, indicating that WES can identify cases of HPS type 6. To the best of our knowledge, this is the first report of HPS6 mutations in Japanese patients.

Visual electrophysiology in the clinical evaluation of optic neuritis, chiasmal tumours, achiasmia, and ocular albinism: an overview.

BACKGROUND AND METHODS: In routine clinical evaluation of optic neuritis and chiasmal tumours, pattern electroretinography and visual evoked potentials (VEPs) to pattern-reversal stimulation are useful examinations. Similarly, in achiasmia and ocular albinism, VEPs to flash and pattern-onset stimulation provide relevant information. RESULTS: The role of visual electrophysiology in these diseases is to assess potential dysfunction of the visual pathway: (a) at the acute stage of optic neuritis, to determine the magnitude of conduction block of the optic nerve fibres; (b) at the clinical recovery stage of optic neuritis, to determine optic nerve conduction delay due to demyelination, and to follow possible remyelination; (c) at the recovery of optic neuritis when visual acuity does not normalise, to define loss of optic nerve fibres and retrograde degeneration of retinal ganglion cells; (d) in tumours at the chiasm, to detect abnormal conduction along the crossed and/or uncrossed fibres; and (e) in achiasmia or albinism, which are both congenital disorders associated with nystagmus, to detect achiasmia and absence of or reduced optic nerve fibre decussation at the chiasm, or to detect ocular albinism and excess of optic nerve fibre decussation at the chiasm. In optic neuritis, two recent examinations have been used to detect retrograde axonal degeneration: photopic negative response of the electroretinogram, to assess dysfunction of ganglion cell axons; and optic coherence tomography, to measure thinning of the retinal nerve fibre layer. In optic neuritis, multifocal VEPs provide a promising clinical examination, because this can show areas that are associated with normal or abnormal optic nerve fibre function. CONCLUSIONS: Visual electrophysiology defines function of the visual pathway and is relevant: (1) in optic neuritis, when visual acuity does not recover well; (2) in tumours of the chiasm with normal visual fields, as in paediatric patients who cannot adequately perform perimetry; and (3) in children with congenital nystagmus and suspected achiasmia or ocular albinism.

Case of multiple sulfatase deficiency and ocular albinism: a diagnostic odyssey.

BACKGROUND: Multiple sulfatase deficiency (MSD) is a rare autosomal recessive inborn error of lysosomal metabolism. The clinical phenotypic spectrum encompasses overlapping features of variable severity and is suggestive of individual single sulfatase deficiencies (i.e., metachromatic leukodystrophy, mucopolysaccharidosis, and X-linked ichthyosis). CASE REPORT: We describe a 3-year-old male with severe hypotonia, developmental regression and progressive neurodegeneration, coarse facial features, nystagmus (from ocular albinism), and dysmyelinating motor sensory neuropathy. Ethics approval was obtained from the Western University Ontario. RESULTS: Extensive investigative work-up identified deficiencies of multiple sulfatases: heparan sulfate sulfamidase: 6.5 nmoles/mg/protein/17 hour (reference 25.0-75.0), iduronate-2-sulfate sulfatase: 9 nmol/mg/protein/4 hour (reference 31-110), and arylsulfatase A: 3.8 nmoles/hr/mg protein (reference 22-50). The identification of compound heterozygous pathogenic mutations in the SUMF1 gene c.836 C>T (p.A279V) and c.1045C>T (p.R349W) confirmed the diagnosis of MSD. CONCLUSION: The complex clinical manifestations of MSD and the unrelated coexistence of ocular albinism as in our case can delay diagnosis. Genetic counselling should be provided to all affected families.

Clinical and mutational characteristics of oculocutaneous albinism type 7.

The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.

Reading performance in infantile nystagmus.

OBJECTIVE: To characterize reading deficits in infantile nystagmus (IN), to determine optimal font sizes for reading in IN, and to investigate whether visual acuity (VA) and severity of nystagmus are good indicators of reading performance in IN. DESIGN: Prospective cross-sectional study. PARTICIPANTS AND CONTROLS: Seventy-one participants with IN (37 idiopathic, 34 with albinism) and 20 age-matched controls. METHODS: Reading performance was assessed using Radner reading charts and was compared with near logarithm of the minimum angle of resolution (logMAR) VA, nystagmus intensity, and foveation characteristics as quantified using eye movement recordings. MAIN OUTCOME MEASURES: Reading acuity (smallest readable font size), maximum reading speed, critical print size (font size below which reading is suboptimal), near logMAR VA, nystagmus intensity, and foveation characteristics (using the eXpanded Nystagmus Acuity Function). RESULTS: Using optimal reading conditions, maximum reading speeds were 18.8% slower in albinism and 14.7% slower in idiopathic IN patients compared with controls. Reading acuities were significantly worse (P<0.001) in IN patients compared with controls. Also, the range of font sizes over which reading speeds were less than the optimum were much larger in IN patients compared with controls (P<0.001). Reading acuity was correlated strongly to near VA (r(2) = 0.74 albinism, r(2) = 0.55 idiopathic), but was better than near VA in participants with poor VA. Near VA was a poor predictor of maximum reading speed. Nystagmus intensity and foveation were poor indicators of both reading acuity and maximum reading speed. CONCLUSIONS: Maximum reading speeds can be near normal in IN when optimal font sizes are provided, even in individuals with poor VA or intense nystagmus. However, reading performance in IN is acutely sensitive to font size limitations. Font sizes for optimal reading speeds in IN may be as much as 6 logMAR lines worse than the near VA. FINANCIAL DISCLOSURE(S): The author(s) have no proprietary or commercial interest in any materials discussed in this article.

Potential of handheld optical coherence tomography to determine cause of infantile nystagmus in children by using foveal morphology.

OBJECTIVE: To investigate the feasibility of handheld (HH) ultra-high-resolution spectral-domain optical coherence tomography (SD-OCT) in young children with nystagmus, to determine its sensitivity and specificity in classifying foveal abnormalities, and to investigate its potential to determine the cause of infantile nystagmus with the use of foveal morphology. DESIGN: Prospective, case-control study. PARTICIPANTS AND CONTROLS: A total of 50 patients with nystagmus and 50 healthy control subjects (mean age, 3.2 years; range, 0-8 years). METHODS: Each patient was scanned using HH SD-OCT (Bioptigen Inc., Research Triangle Park, NC) without sedation, and foveal morphology was classified into 1 of 4 categories: (1) typical foveal hypoplasia (predicting clinical diagnosis of albinism, PAX6 mutations, or isolated foveal hypoplasia); (2) atypical foveal hypoplasia (predicting achromatopsia); (3) other foveal changes (corresponding to retinal dystrophies); and (4) normal fovea (predicting idiopathic or manifest latent nystagmus). An independent interpretation of the HH SD-OCT scans by masked examiners was performed, and the sensitivity and specificity of the predicted diagnosis were calculated. MAIN OUTCOME MEASURES: The success rate of image acquisition and sensitivity and specificity of the HH SD-OCT in classifying foveal abnormalities. RESULTS: In 94% of examinations, HH SD-OCT was successful. Twenty-three patients had typical foveal hypoplasia (category 1). Of these patients, 21 were diagnosed with albinism and 2 were diagnosed with PAX6 mutations. Five patients were classified as atypical (category 2) and diagnosed with achromatopsia. Six patients had other abnormal foveal morphology (category 3) and were diagnosed with retinal dystrophy. Sixteen patients had normal foveal morphology (category 4). Of these patients, 12 were diagnosed with idiopathic nystagmus and 4 were diagnosed with manifest latent nystagmus. Sensitivities of HH SD-OCT for classifying typical or atypical foveal hypoplasia, other abnormal foveal morphology, and normal morphology were 92.8%, 86.7%, 41.1%, and 88.4%, respectively, with specificities of 91.4%, 94.8%, 97.7% and 95.1%, respectively. CONCLUSIONS: We demonstrate excellent feasibility of HH SD-OCT in the diagnosis of conditions associated with infantile nystagmus. The HH SD-OCT classification of foveal abnormalities was highly sensitive and specific. This classification was used to determine the underlying cause of infantile nystagmus. Handheld SD-OCT in early childhood can facilitate focused investigations and earlier diagnosis. This is important in an era when potentially time-sensitive treatment, such as gene therapy, is imminent.

A novel splicing site mutation of the GPR143 gene in a Chinese X-linked ocular albinism pedigree.

Ocular albinism is an X-linked inherited disease characterized by hypopigmentation of the iris and nystagmus. To identify a new disease-causing mutation of ocular albinism, we collected a Han Chinese pedigree with 7 male congenital nystagmus patients over 3 generations. Slit-lamp photography and optical coherence tomography were performed for the proband. Genomic DNA was extracted from a whole blood sample from the proband using the high-salt method. Polymerase chain reaction (PCR) sequencing was carried out for GPR143 and FRMD7 genes. The three-dimensional structures of the wild-type and mutant GPR143 proteins were determined using SWISS-MODEL. The transmission of the disease in the pedigree clearly followed an X-linked pattern. The proband had significant iris and fundus hypopigmentation. Optical coherence tomography showed severe foveal hypoplasias in both eyes of the proband. A novel splicing site (G/C) mutation was found on the boundary of the 6th intron and the 7th exon of the GPR143 gene, resulting in a 9-amino-acid deletion (codons 257-265) in the 6th transmembrane domain of the GPR143 protein. In conclusion, a novel splicing site mutation of the GPR143 gene was found in a Han Chinese congenital ocular albinism pedigree.

Ocular findings and a comparative study of hair, skin and iris color in Chinese patients with albinism.

BACKGROUND: Oculocutaneous albinism (OCA) could be either non-syndromic or syndromic. There are significant challenges in clinically recognizing and differentiating Hermansky-Pudlak syndrome (HPS) from non-syndromic OCA. MATERIALS AND METHODS: In a prospective consecutive case series, 63 patients (less than 18 years old) with a molecular genetic diagnosis of albinism (except OCA1A), Ocular albinism (OA) and Hermansky-Pudlak syndrome seen over a 3-year period were evaluated and analyzed. Hair colour, iris colour was graded, compared and correlated with the degree of fundus pigmentation and foveal development. RESULTS: A total of 63 patients were evaluated. Forty-five patients had non-syndromic OCA (11 OCA1B, 24 OCA2, 9 OCA4, and 1 OCA6), 5 patients had OA and 13 patients had HPS. All 3 BLOC-related HPS categories were seen (1 with BLOC1, 7 with BLOC-2 and 5 with BLOC-3 related HPS). All patients with OA were hyperopic, had darker fundus pigmentation, but had poor foveal development. All HPS patients had lighter fundus pigmentation. The degree of fundus pigmentation correlated positively with the iris pigmentation and also with the foveal development only in OCA2. CONCLUSIONS: Careful observation of the phenotype by comparison of the skin, hair, iris colour, with the degree of fundus pigmentation and foveal development may help clinically differentiate HPS from OCA patients of Chinese ethnicity even in the absence of any bleeding tendency.

Macular Findings in Carriers of Ocular Albinism With a Novel GPR143 Mutation.

This case series details macular findings in three female siblings who were found to be carriers of a previously unreported splice mutation in GPR143 (X-linked ocular albinism [OA1]). Presumed lyonization is responsible for both the subtle and varied findings in OA1 carriers, even among siblings, and especially in patients with darker skin pigmentation. In this series, we used green-light autofluorescence to reveal subtle subfoveal involvement and used optical coherence tomography angiography to uncover previously unreported narrowing of the foveal avascular zone, consistent with foveal hypoplasia. [Ophthalmic Surg Lasers Imaging Retina 2022;53:460-463.].