Tardigrades Use Intrinsically Disordered Proteins to Survive Desiccation.

Tardigrades are microscopic animals that survive a remarkable array of stresses, including desiccation. How tardigrades survive desiccation has remained a mystery for more than 250 years. Trehalose, a disaccharide essential for several organisms to survive drying, is detected at low levels or not at all in some tardigrade species, indicating that tardigrades possess potentially novel mechanisms for surviving desiccation. Here we show that tardigrade-specific intrinsically disordered proteins (TDPs) are essential for desiccation tolerance. TDP genes are constitutively expressed at high levels or induced during desiccation in multiple tardigrade species. TDPs are required for tardigrade desiccation tolerance, and these genes are sufficient to increase desiccation tolerance when expressed in heterologous systems. TDPs form non-crystalline amorphous solids (vitrify) upon desiccation, and this vitrified state mirrors their protective capabilities. Our study identifies TDPs as functional mediators of tardigrade desiccation tolerance, expanding our knowledge of the roles and diversity of disordered proteins involved in stress tolerance.

Reveal the kernel dehydration mechanisms in maize based on proteomic and metabolomic analysis.

BACKGROUND: Kernel dehydration is an important factor for the mechanized harvest in maize. Kernel moisture content (KMC) and kernel dehydration rate (KDR) are important indicators for kernel dehydration. Although quantitative trait loci and genes related to KMC have been identified, where most of them only focus on the KMC at harvest, these are still far from sufficient to explain all genetic variations, and the relevant regulatory mechanisms are still unclear. In this study, we tried to reveal the key proteins and metabolites related to kernel dehydration in proteome and metabolome levels. Moreover, we preliminarily explored the relevant metabolic pathways that affect kernel dehydration combined proteome and metabolome. These results could accelerate the development of further mechanized maize technologies. RESULTS: In this study, three maize inbred lines (KB182, KB207, and KB020) with different KMC and KDR were subjected to proteomic analysis 35, 42, and 49 days after pollination (DAP). In total, 8,358 proteins were quantified, and 2,779 of them were differentially expressed proteins in different inbred lines or at different stages. By comparative analysis, K-means cluster, and weighted gene co-expression network analysis based on the proteome data, some important proteins were identified, which are involved in carbohydrate metabolism, stress and defense response, lipid metabolism, and seed development. Through metabolomics analysis of KB182 and KB020 kernels at 42 DAP, 18 significantly different metabolites, including glucose, fructose, proline, and glycerol, were identified. CONCLUSIONS: In sum, we inferred that kernel dehydration could be regulated through carbohydrate metabolism, antioxidant systems, and late embryogenesis abundant protein and heat shock protein expression, all of which were considered as important regulatory factors during kernel dehydration process. These results shed light on kernel dehydration and provide new insights into developing cultivars with low moisture content.

Expression profiling of Nuclear Factor-Y (NF-Y) transcription factors during dehydration and salt stress in finger millet reveals potential candidate genes for multiple stress tolerance.

MAIN CONCLUSION: Expression profiling of NF-Y transcription factors during dehydration and salt stress in finger millet genotypes contrastingly differing in tolerance levels identifies candidate genes for further characterization and functional studies. The Nuclear Factor-Y (NF-Y) transcription factors are known for imparting abiotic stress tolerance in different plant species. However, there is no information on the role of this transcription factor family in naturally drought-tolerant crop finger millet (Eleusine coracana L.). Therefore, interpretation of expression profiles against drought and salinity stress may provide valuable insights into specific and/or overlapping expression patterns of Eleusine coracana Nuclear Factor-Y (EcNF-Y) genes. Given this, we identified 59 NF-Y (18 NF-YA, 23 NF-YB, and 18 NF-YC) encoding genes and designated them EcNF-Y genes. Expression profiling of these genes was performed in two finger millet genotypes, PES400 (dehydration and salt stress tolerant) and VR708 (dehydration and salt stress sensitive), subjected to PEG-induced dehydration and salt (NaCl) stresses at different time intervals (0, 6, and 12 h). The qRT-PCR expression analysis reveals that the six EcNF-Y genes namely EcNF-YA1, EcNF-YA5, EcNF-YA16, EcNF-YB6, EcNF-YB10, and EcNF-YC2 might be associated with tolerance to both dehydration and salinity stress in early stress condition (6 h), suggesting the involvement of these genes in multiple stress responses in tolerant genotype. In contrast, the transcript abundance of finger millet EcNF-YA5 genes was also observed in the sensitive genotype VR708 under late stress conditions (12 h) of both dehydration and salinity stress. Therefore, the EcNF-YA5 gene might be important for adaptation to salinity and dehydration stress in sensitive finger millet genotypes. Therefore, this gene could be considered as a susceptibility determinant, which can be edited to impart tolerance. The phylogenetic analyses revealed that finger millet NF-Y genes share strong evolutionary and functional relationship to NF-Ys governing response to abiotic stresses in rice, sorghum, maize, and wheat. This is the first report of expression profiling of EcNF-Ys genes identified from the finger millet genome and reveals potential candidate for enhancing dehydration and salt tolerance.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Genetic basis and repeatability for desiccation resistance in Drosophila melanogaster (Diptera: Drosophilidae).

Dehydration is a stress factor for organisms inhabiting natural habitats where water is scarce. Thus, it may be expected that species facing arid environments will develop mechanisms that maximize resistance to desiccation. Insects are excellent models for studying the effects of dehydration as well as the mechanisms and processes that prevent water loss since the effect of desiccation is greater due to the higher area/volume ratio than larger animals. Even though physiological and behavioral mechanisms to cope with desiccation are being understood, the genetic basis underlying the mechanisms related to variation in desiccation resistance and the context-dependent effect remain unsolved. Here we analyze the genetic bases of desiccation resistance in Drosophila melanogaster and identify candidate genes that underlie trait variation. Our quantitative genetic analysis of desiccation resistance revealed sexual dimorphism and extensive genetic variation. The phenotype-genotype association analyses (GWAS) identified 71 candidate genes responsible for total phenotypic variation in desiccation resistance. Half of these candidate genes were sex-specific suggesting that the genetic architecture underlying this adaptive trait differs between males and females. Moreover, the public availability of desiccation data analyzed on the same lines but in a different lab allows us to investigate the reliability and repeatability of results obtained in independent screens. Our survey indicates a pervasive micro-environment lab-dependent effect since we did not detect overlap in the sets of genes affecting desiccation resistance identified between labs.

QTL mapping and omics analysis to identify genes controlling kernel dehydration in maize.

KEY MESSAGE: This study mapped and screened three candidate genes related to kernel dehydration in maize. The slow development rate of maize kernels during later stages leads to high kernel moisture content at harvest, posing a challenge for mechanized maize harvesting in China. This study utilized a recombinant inbred line population derived from Zheng 58 (slow dehydration) and PH6WC (fast dehydration) as parents. After four years of trait investigation and analysis, 25 quantitative trait loci (QTLs) associated with kernel dehydration rate and moisture content were identified, with six QTLs showing a significant contribution value exceeding 10% in the phenotype. Furthermore, a comparison was made between the QTLs identified in this study and those from previous research on maize kernel moisture content and dehydration rate, followed by screening through the omics analysis of the parental lines. Three candidate genes related to kernel dehydration rate were identified, primarily involving carbohydrate metabolism, energy metabolism processes (Zm00001d014030 and Zm00001d006476), and stimulus resistance (Zm00001d040113). These findings provide valuable insights to assist and guide future breeding efforts for mechanical harvesting of maize.

Physiological and gene expression response mechanisms of dehydration process in Cinnamomum cassia (L.) J. Presl seeds.

BACKGROUND: A critical factor in the storability of recalcitrant seeds is their moisture content (MC), but its effect on the viability of Cinnamomum cassia (L.) J. Presl (C. cassia) seeds is not fully understood. METHODS AND RESULTS: Measured the germination rate, starch and soluble sugar content, and transcriptome of 8 seed samples with different MC obtained by low-temperature drying method. It was found that the germination rate was significantly negatively correlated with MC. The lethal MC was around 15.6%. During the dehydration process, there was a significant increase in the content of soluble sugars and starch. Transcriptome analysis was performed on CK, W3, W6 showed a total of 62.78 Gb of clean data. Among the 30,228 Unigenes, 28,195 were successfully annotated. In the three comparative groups (CK and W3, CK and W6, W3 and W6), 6,842, 7,640, and 11,628 differentially expressed genes (DEGs) were obtained, respectively. These DEGs were found to be involved in a variety of metabolic pathways, including carbon metabolism, amino acid biosynthesis, starch and sucrose metabolism, glycolysis/gluconeogenesis, and nucleotide and amino sugar metabolism. A total of 1,416 common genes were identified among all three comparison groups. Furthermore, among all the DEGs, a total of 71 transcription factor families were identified, with the C2H2 transcription factor family having the highest number of genes. CONCLUSIONS: This ground-breaking study sheds light on the physiological response and gene expression profiles of C. cassia seeds after undergoing dehydration treatment, which will provide valuable insights for further research and understanding of this process.

Overexpression of a pearl millet WRKY transcription factor gene, PgWRKY74, in Arabidopsis retards shoot growth under dehydration and salinity-stressed conditions.

Pearl millet (Cenchrus americanus) is a cereal crop that can tolerate high temperatures, drought, and low-fertility conditions where other crops lose productivity. However, genes regulating this ability are largely unknown. Transcription factors (TFs) regulate transcription of their target genes, regulate downstream biological processes, and thus are candidates for regulators of such tolerance of pearl millet. PgWRKY74 encodes a group IIc WRKY TF in pearl millet and is downregulated by drought. PgWRKY74 may have a role in drought tolerance. The objective of this study was to gain insights into the physiological and biochemical functions of PgWRKY74. Yeast one-hybrid and gel shift assays were performed to examine transcriptional activation potential and deoxyribonucleic acid (DNA)-binding ability, respectively. Transgenic Arabidopsis thaliana plants overexpressing PgWRKY74-green fluorescent protein (GFP) fusion gene were generated and tested for growth and stress-responsive gene expression under mannitol and NaCl-stressed conditions. A construct with PgWRKY74 enabled yeast reporter cells to survive on test media in the yeast one-hybrid assays. The electrophoretic mobility of DNA with putative WRKY TF-binding motifs was lower in the presence of a recombinant PgWRKY74 protein than its absence. The PgWRKY74-GFP-overexpressing Arabidopsis plants exhibited smaller rosette areas than did wild-type plants under mannitol-stressed and NaCl-stressed conditions, and exhibited weaker expression of RD29B, which is induced by the stress-related phytohormone abscisic acid (ABA), under the mannitol-stressed condition. PgWRKY74 have transcriptional activation potential and DNA-binding ability, and can negatively regulate plant responses to mannitol and NaCl stresses, possibly by decreasing ABA levels or ABA sensitivity.

DNA methylation-mediated modulation of rapid desiccation tolerance acquisition and dehydration stress memory in the resurrection plant Boea hygrometrica.

Pre-exposure of plants to various abiotic conditions confers improved tolerance to subsequent stress. Mild drought acclimation induces acquired rapid desiccation tolerance (RDT) in the resurrection plant Boea hygrometrica, but the mechanisms underlying the priming and memory processes remain unclear. In this study, we demonstrated that drought acclimation-induced RDT can be maintained for at least four weeks but was completely erased after 18 weeks based on a combination of the phenotypic and physiological parameters. Global transcriptome analysis identified several RDT-specific rapid dehydration-responsive genes related to cytokinin and phospholipid biosynthesis, nitrogen and carbon metabolism, and epidermal morphogenesis, most of which were pre-induced by drought acclimation. Comparison of whole-genome DNA methylation revealed dehydration stress-responsive hypomethylation in the CG, CHG, and CHH contexts and acclimation-induced hypermethylation in the CHH context of the B. hygrometrica genome, consistent with the transcriptional changes in methylation pathway genes. As expected, the global promoter and gene body methylation levels were negatively correlated with gene expression levels in both acclimated and dehydrated plants but showed no association with transcriptional divergence during the procedure. Nevertheless, the promoter methylation variations in the CG and CHG contexts were significantly associated with the differential expression of genes required for fundamental genetic processes of DNA conformation, RNA splicing, translation, and post-translational protein modification during acclimation, growth, and rapid dehydration stress response. It was also associated with the dehydration stress-induced upregulation of memory genes, including pre-mRNA-splicing factor 38A, vacuolar amino acid transporter 1-like, and UDP-sugar pyrophosphorylase, which may contribute directly or indirectly to the improvement of dehydration tolerance in B. hygrometrica plants. Altogether, our findings demonstrate the potential implications of DNA methylation in dehydration stress memory and, therefore, provide a molecular basis for enhanced dehydration tolerance in plants induced by drought acclimation.

Picea wilsonii NAC31 and DREB2A Cooperatively Activate ERD1 to Modulate Drought Resistance in Transgenic Arabidopsis.

The NAC family of transcription factors (TFs) regulate plant development and abiotic stress. However, the specific function and response mechanism of NAC TFs that increase drought resistance in Picea wilsonii remain largely unknown. In this study, we functionally characterized a member of the PwNAC family known as PwNAC31. PwNAC31 is a nuclear-localized protein with transcriptional activation activity and contains an NAC domain that shows extensive homology with ANAC072 in Arabidopsis. The expression level of PwNAC31 is significantly upregulated under drought and ABA treatments. The heterologous expression of PwNAC31 in atnac072 Arabidopsis mutants enhances the seed vigor and germination rates and restores the hypersensitive phenotype of atnac072 under drought stress, accompanied by the up-regulated expression of drought-responsive genes such as DREB2A (DEHYDRATION-RESPONSIVE ELEMENT BINDING PROTEIN 2A) and ERD1 (EARLY RESPONSIVE TO DEHYDRATION STRESS 1). Yeast two-hybrid and bimolecular fluorescence complementation assays confirmed that PwNAC31 interacts with DREB2A and ABF3 (ABSCISIC ACID-RESPONSIVE ELEMENT-BINDING FACTOR 3). Yeast one-hybrid and dual-luciferase assays showed that PwNAC31, together with its interaction protein DREB2A, directly regulated the expression of ERD1 by binding to the DRE element of the ERD1 promoter. Collectively, our study provides evidence that PwNAC31 activates ERD1 by interacting with DREB2A to enhance drought tolerance in transgenic Arabidopsis.

The transcriptome of acute dehydration in myeloid leukemic cells.

Human myeloid leukemia cells (HL-60/S4) exposed to hyperosmotic stress with sucrose undergo dehydration and cell shrinkage. Interphase chromatin and mitotic chromosomes congeal, exhibiting altered phase separation (demixing) of chromatin proteins. To investigate changes in the transcriptome, we exposed HL-60/S4 cells to hyperosmotic sucrose stress (~600 milliOsmolar) for 30 and 60 minutes. We employed RNA-Seq of polyA mRNA to identify genes with increased or decreased transcript levels relative to untreated control cells (i.e., differential gene expression). These genes were examined for over-representation of Gene Ontology (GO) terms.  In stressed cells, multiple GO terms associated with transcription, translation, mitochondrial function and proteosome activity, as well as "replication-dependent histones", were over-represented among genes with increased transcript levels; whereas, genes with decreased transcript levels were over-represented with transcription repressors. The transcriptome profiles of hyperosmotically-stressed cells suggest acquisition of cellular rebuilding, a futile homeostatic response, as these cells are ultimately doomed to a dehydrated death.

Genome-wide identification and characterization of members of the LEA gene family in Panax notoginseng and their transcriptional responses to dehydration of recalcitrant seeds.

BACKGROUND: Late embryogenesis abundant (LEA) proteins play an important role in dehydration process of seed maturation. The seeds of Panax notoginseng (Burkill) F. H. Chen are typically characterized with the recalcitrance and are highly sensitive to dehydration. However, it is not very well known about the role of LEA proteins in response to dehydration stress in P. notoginseng seeds. We will perform a genome-wide analysis of the LEA gene family and their transcriptional responses to dehydration stress in recalcitrant P. notoginseng seeds. RESULTS: In this study, 61 LEA genes were identified from the P. notoginseng genome, and they were renamed as PnoLEA. The PnoLEA genes were classified into seven subfamilies based on the phylogenetic relationships, gene structure and conserved domains. The PnoLEA genes family showed relatively few introns and was highly conserved. Unexpectedly, the LEA_6 subfamily was not found, and the LEA_2 subfamily contained 46 (75.4%) members. Within 19 pairs of fragment duplication events, among them 17 pairs were LEA_2 subfamily. In addition, the expression of the PnoLEA genes was obviously induced under dehydration stress, but the germination rate of P. notoginseng seeds decreased as the dehydration time prolonged. CONCLUSIONS: We found that the lack of the LEA_6 subfamily, the expansion of the LEA_2 subfamily and low transcriptional levels of most PnoLEA genes might be implicated in the recalcitrant formation of P. notoginseng seeds. LEA proteins are essential in the response to dehydration stress in recalcitrant seeds, but the protective effect of LEA protein is not efficient. These results could improve our understanding of the function of LEA proteins in the response of dehydration stress and their contributions to the formation of seed recalcitrance.

Delineating the tissue-mediated drought stress governed tuning of conserved miR408 and its targets in rice.

Engineering drought tolerance in rice needs to focus on regulators that enhance tolerance while boosting plant growth and vigor. The present study delineated the concealed function and tissue-mediated interplay of the miR408/target module in imparting drought stress tolerance in rice. The plant miR408 family comprises three dominant mature forms (21 nt), including a distinct monocot variant (F-7 with 5' C) and is divided into six groups. miR408 majorly cleaves genes belonging to the blue copper protein in addition to several other species-specific targets in plants. Comparative sequence analysis in 4726 rice accessions identified 22 sequence variants (SNP and InDELs) in its promoter (15) and pre-miR408 region. Haplotype analysis of the sequence variants indicated eight haplotypes (three: Japonica-specific and five: Indica-specific) of the miR408 promoter. In drought-tolerant Nagina 22, miR408 follows flag leaf preferential expression. Under drought conditions, its levels are upregulated in flag leaf and roots which seems to be regulated by a differential fraction of methylated cytosines (mCs) in the precursor region. The active pool of miR408 regulated targets under control and drought conditions is impacted by the tissue type. Comparative expression analysis of the miR408/target module under different sets of conditions features 83 targets exhibiting antagonistic expression in rice, out of which 12 genes, including four PLANTACYANINS (OsUCL6, 7, 9 and 30), PIRIN, OsLPR1, OsCHUP1, OsDOF12, OsBGLU1, glycine-rich cell wall gene, OsDUT, and OsERF7, are among the high confidence targets. Further, overexpression of MIR408 in drought-sensitive rice cultivar (PB1) leads to the massive enhancement of vegetative growth in rice with improved ETR and Y(II) and enhanced dehydration stress tolerance. The above results suggest that miR408 is likely to act as a positive regulator of growth and vigor, as well as dehydration stress, making it a potential candidate for engineering drought tolerance in rice.

Characterization of the basic leucine zipper transcription factor family of Neoporphyra haitanensis and its role in acclimation to dehydration stress.

BACKGROUND: Neoporphyra haitanensis, a major marine crop native to southern China, grows in the harsh intertidal habitats of rocky coasts. The thallus can tolerate fluctuating and extreme environmental stresses, for example, repeated desiccation/rehydration due to the turning tides. It is also a typical model system for investigating stress tolerance mechanisms in intertidal seaweed. The basic leucine zipper (bZIP) transcription factors play important roles in the regulation of plants' responses to environmental stress stimuli. However, little information is available regarding the bZIP family in the marine crop Nh. haitanensis. RESULTS: We identified 19 bZIP genes in the Nh. haitanensis genome and described their conserved domains. Based on phylogenetic analysis, these 19 NhhbZIP genes, distributed unevenly on the 11 superscaffolds, were divided into four groups. In each group, there were analogous exon/intron numbers and motif compositions, along with diverse exon lengths. Cross-species collinearity analysis indicated that 17 and 9 NhhbZIP genes were orthologous to bZIP genes in Neopyropia yezoensis and Porphyra umbilicalis, respectively. Evidence from RNA sequencing (RNA-seq) data showed that the majority of NhhbZIP genes (73.68%) exhibited transcript abundance in all treatments. Furthermore, genes NN 2, 4 and 5 showed significantly altered expression in response to moderate dehydration, severe dehydration, and rehydration, respectively. Gene co-expression network analysis of the representative genes was carried out, followed by gene set enrichment analysis. Two NhhbZIP genes collectively responding to dehydration and rehydration and their co-expressing genes mainly participated in DNA repair, DNA metabolic process, and regulation of helicase activity. Two specific NhhbZIP genes responding to severe dehydration and their corresponding network genes were mainly involved in macromolecule modification, cellular catabolic process, and transmembrane transport. Three specific NhhbZIP genes responding to rehydration and their co-expression gene networks were mainly involved in the regulation of the cell cycle process and defense response. CONCLUSIONS: This study provides new insights into the structural composition, evolution, and function of the NhhbZIP gene family. Our results will help us to further study the functions of bZIP genes in response to dehydration and rehydration in Nh. haitanensis and improve Nh. haitanensis in southern China.

Iris lactea var. chinensis plant drought tolerance depends on the response of proline metabolism, transcription factors, transporters and the ROS-scavenging system.

BACKGROUND: Iris lactea var. chinensis, a perennial herbaceous species, is widely distributed and has good drought tolerance traits. However, there is little information in public databases concerning this herb, so it is difficult to understand the mechanism underlying its drought tolerance. RESULTS: In this study, we used Illumina sequencing technology to conduct an RNA sequencing (RNA-seq) analysis of I. lactea var. chinensis plants under water-stressed conditions and rehydration to explore the potential mechanisms involved in plant drought tolerance. The resulting de novo assembled transcriptome revealed 126,979 unigenes, of which 44,247 were successfully annotated. Among these, 1187 differentially expressed genes (DEGs) were identified from a comparison of the water-stressed treatment and the control (CK) treatment (T/CK); there were 481 upregulated genes and 706 downregulated genes. Additionally, 275 DEGs were identified in the comparison of the rehydration treatment and the water-stressed treatment (R/T). Based on Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) analysis, the expression levels of eight randomly selected unigenes were consistent with the transcriptomic data under water-stressed and rehydration treatment, as well as in the CK. According to Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, proline metabolism-related DEGs, including those involved in the 'proline catabolic process', the 'proline metabolic process', and 'arginine and proline metabolism', may play important roles in plant drought tolerance. Additionally, these DEGs encoded 43 transcription factors (TFs), 46 transporters, and 22 reactive oxygen species (ROS)-scavenging system-related proteins. Biochemical analysis and histochemical detection showed that proline and ROS were accumulated under water-stressed conditions, which is consistent with the result of the transcriptomic analysis. CONCLUSIONS: In summary, our transcriptomic data revealed that the drought tolerance of I. lactea var. chinensis depends on proline metabolism, the action of TFs and transporters, and a strong ROS-scavenging system. The related genes found in this study could help us understand the mechanisms underlying the drought tolerance of I. lactea var. chinensis.

Genome-wide analysis of the GDSL esterase/lipase family genes in Physcomitrium patens and the involvement of GELP31 in spore germination.

In plants, the ability to produce hydrophobic substances that would provide protection from dehydration was required for the transition to land. This genome-wide investigation outlines the evolution of GDSL-type esterase/lipase (GELP) proteins in the moss Physcomitrium patens and suggests possible functions of some genes. GELP proteins play roles in the formation of hydrophobic polymers such as cutin and suberin that protect against dehydration and pathogen attack. GELP proteins are also implicated in processes such as pollen development and seed metabolism and germination. The P. patens GELP gene family comprises 48 genes and 14 pseudogenes. Phylogenetic analysis of all P. patens GELP sequences along with vascular plant GELP proteins with reported functions revealed that the P. patens genes clustered within previously identified A, B and C clades. A duplication model predicting the expansion of the GELP gene family within the P. patens lineage was constructed. Expression analysis combined with phylogenetic analysis suggested candidate genes for functions such as defence against pathogens, cutin metabolism, spore development and spore germination. The presence of relatively fewer GELP genes in P. patens may reduce the occurrence of functional redundancy that complicates the characterization of vascular plant GELP genes. Knockout lines of GELP31, which is highly expressed in sporophytes, were constructed. Gelp31 spores contained amorphous oil bodies and germinated late, suggesting (a) role(s) of GELP31 in lipid metabolism in spore development or germination. Future knockout studies of other candidate GELP genes will further elucidate the relationship between expansion of the family and the ability to withstand the harsh land environment.

Spatiotemporal dynamics of the tomato fruit transcriptome under prolonged water stress.

Water availability influences all aspects of plant growth and development; however, most studies of plant responses to drought have focused on vegetative organs, notably roots and leaves. Far less is known about the molecular bases of drought acclimation responses in fruits, which are complex organs with distinct tissue types. To obtain a more comprehensive picture of the molecular mechanisms governing fruit development under drought, we profiled the transcriptomes of a spectrum of fruit tissues from tomato (Solanum lycopersicum), spanning early growth through ripening and collected from plants grown under varying intensities of water stress. In addition, we compared transcriptional changes in fruit with those in leaves to highlight different and conserved transcriptome signatures in vegetative and reproductive organs. We observed extensive and diverse genetic reprogramming in different fruit tissues and leaves, each associated with a unique response to drought acclimation. These included major transcriptional shifts in the placenta of growing fruit and in the seeds of ripe fruit related to cell growth and epigenetic regulation, respectively. Changes in metabolic and hormonal pathways, such as those related to starch, carotenoids, jasmonic acid, and ethylene metabolism, were associated with distinct fruit tissues and developmental stages. Gene coexpression network analysis provided further insights into the tissue-specific regulation of distinct responses to water stress. Our data highlight the spatiotemporal specificity of drought responses in tomato fruit and indicate known and unrevealed molecular regulatory mechanisms involved in drought acclimation, during both vegetative and reproductive stages of development.

Zinc-finger protein MdBBX7/MdCOL9, a target of MdMIEL1 E3 ligase, confers drought tolerance in apple.

Water deficit is one of the main challenges for apple (Malus × domestica) growth and productivity. Breeding drought-tolerant cultivars depends on a thorough understanding of the drought responses of apple trees. Here, we identified the zinc-finger protein B-BOX 7/CONSTANS-LIKE 9 (MdBBX7/MdCOL9), which plays a positive role in apple drought tolerance. The overexpression of MdBBX7 enhanced drought tolerance, whereas knocking down MdBBX7 expression reduced it. Chromatin immunoprecipitation-sequencing (ChIP-seq) analysis identified one cis-element of MdBBX7, CCTTG, as well as its known binding motif, the T/G box. ChIP-seq and RNA-seq identified 1,197 direct targets of MdBBX7, including ETHYLENE RESPONSE FACTOR (ERF1), EARLY RESPONSIVE TO DEHYDRATION 15 (ERD15), and GOLDEN2-LIKE 1 (GLK1) and these were further verified by ChIP-qPCR and electronic mobility shift assays. Yeast two-hybrid screen identified an interacting protein of MdBBX7, RING-type E3 ligase MYB30-INTERACTING E3 LIGASE 1 (MIEL1). Further examination revealed that MdMIEL1 could mediate the ubiquitination and degradation of MdBBX7 by the 26S proteasome pathway. Genetic interaction analysis suggested that MdMIEL1 acts as an upstream factor of MdBBX7. In addition, MdMIEL1 was a negative regulator of the apple drought stress response. Taken together, our results illustrate the molecular mechanisms by which the MdMIEL1-MdBBX7 module influences the response of apple to drought stress.

Evolution of the DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN subfamily in green plants.

Adapting to unfavorable environments is a necessary step in plant terrestrialization and radiation. The dehydration-responsive element-binding (DREB) protein subfamily plays a pivotal role in plant abiotic stress regulation. However, relationships between the origin and expansion of the DREB subfamily and adaptive evolution of land plants are still being elucidated. Here, we constructed the evolutionary history of the DREB subfamily by compiling APETALA2/ethylene-responsive element-binding protein superfamily genes from 169 representative species of green plants. Through extensive phylogenetic analyses and comparative genomic analysis, our results revealed that the DREB subfamily diverged from the ethylene-responsive factor (ERF) subfamily in the common ancestor of Zygnemophyceae and Embryophyta during the colonization of land by plants, followed by expansions to form three different ancient archetypal genes in Zygnemophyceae species, designated as groups archetype-I, archetype-II/III, and archetype-IV. Four large-scale expansions paralleling the evolution of land plants led to the nine-subgroup divergence of group archetype-II/III in angiosperms, and five whole-genome duplications during Brassicaceae and Poaceae radiation shaped the diversity of subgroup IIb-1. We identified a Poaceae-specific gene in subgroup IIb-1, ERF014, remaining in a Poaceae-specific microsynteny block and co-evolving with a small heat shock protein cluster. Expression analyses demonstrated that heat acclimation may have driven the neofunctionalization of ERF014s in Pooideae by engaging in the conserved heat-responsive module in Poaceae. This study provides insights into lineage-specific expansion and neofunctionalization in the DREB subfamily, together with evolutionary information valuable for future functional studies of plant stress biology.

The positive feedback regulatory loop of miR160-Auxin Response Factor 17-HYPONASTIC LEAVES 1 mediates drought tolerance in apple trees.

Drought stress tolerance is a complex trait regulated by multiple factors. Here, we demonstrate that the miRNA160-Auxin Response Factor 17 (ARF17)-HYPONASTIC LEAVES 1 module is crucial for apple (Malus domestica) drought tolerance. Using stable transgenic plants, we found that drought tolerance was improved by higher levels of Mdm-miR160 or MdHYL1 and by decreased levels of MdARF17, whereas reductions in MdHYL1 or increases in MdARF17 led to greater drought sensitivity. Further study revealed that modulation of drought tolerance was achieved through regulation of drought-responsive miRNA levels by MdARF17 and MdHYL1; MdARF17 interacted with MdHYL1 and bound to the promoter of MdHYL1. Genetic analysis further suggested that MdHYL1 is a direct downstream target of MdARF17. Importantly, MdARF17 and MdHYL1 regulated the abundance of Mdm-miR160. In addition, the Mdm-miR160-MdARF17-MdHYL1 module regulated adventitious root development. We also found that Mdm-miR160 can move from the scion to the rootstock in apple and tomato (Solanum lycopersicum), thereby improving root development and drought tolerance of the rootstock. Our study revealed the mechanisms by which the positive feedback loop of Mdm-miR160-MdARF17-MdHYL1 influences apple drought tolerance.