Islatravir Dimer: Crystal Form Dependence of a Radiation-Induced Degradation Product.

A rare example of crystal form-dependent, gamma radiation-induced degradation is presented. Islatravir is known to exist in several polymorphic forms, but only one of these forms shows the generation of a specific dimer degradation product under gamma irradiation. Extended gamma irradiation studies demonstrated that only one of the known crystalline forms shows an appreciable rate of dimer formation. Additionally, this dimer is not observed to form under other forced stress conditions. We present the structural elucidation of this dimer impurity and rationalize its form-dependent generation based on the analysis of the underlying crystal structure.

Elucidation of factors shaping reactivity of 5'-deoxyadenosyl - a prominent organic radical in biology.

This study investigates the factors modulating the reactivity of 5'-deoxyadenosyl (5'dAdo˙) radical, a potent hydrogen atom abstractor that forms in the active sites of radical SAM enzymes and that otherwise undergoes a rapid self-decay in aqueous solution. Here, we compare hydrogen atom abstraction (HAA) reactions between native substrates of radical SAM enzymes and 5'dAdo˙ in aqueous solution and in two enzymatic microenvironments. With that we reveal that HAA efficiency of 5'dAdo˙ is due to (i) the in situ formation of 5'dAdo˙ in a pre-ordered complex with a substrate, which attenuates the unfavorable effect of substrate:5'dAdo˙ complex formation, and (ii) the prevention of the conformational changes associated with self-decay by a tight active-site cavity. The enzymatic cavity, however, does not have a strong effect on the HAA activity of 5'dAdo˙. Thus, we performed an analysis of in-water HAA performed by 5'dAdo˙ based on a three-component thermodynamic model incorporating the diagonal effect of the free energy of reaction, and the off-diagonal effect of asynchronicity and frustration. To this aim, we took advantage of the straightforward relationship between the off-diagonal thermodynamic effects and the electronic-structure descriptor - the redistribution of charge between the reactants during the reaction. It allows to access HAA-competent redox and acidobasic properties of 5'dAdo˙ that are otherwise unavailable due to its instability upon one-electron reduction and protonation. The results show that all reactions feature a favourable thermodynamic driving force and tunneling, the latter of which lowers systematically barriers by ∼2 kcal mol-1. In addition, most of the reactions experience a favourable off-diagonal thermodynamic contribution. In HAA reactions, 5'dAdo˙ acts as a weak oxidant as well as a base, also 5'dAdo˙-promoted HAA reactions proceed with a quite low degree of asynchronicity of proton and electron transfer. Finally, the study elucidates the crucial and dual role of asynchronicity. It directly lowers the barrier as a part of the off-diagonal thermodynamic contribution, but also indirectly increases the non-thermodynamic part of the barrier by presumably controlling the adiabatic coupling between proton and electron transfer. The latter signals that the reaction proceeds as a hydrogen atom transfer rather than a proton-coupled electron transfer.

Cordycepin Triphosphate as a Potential Modulator of Cellular Plasticity in Cancer via cAMP-Dependent Pathways: An In Silico Approach.

Cordycepin, or 3'-deoxyadenosine, is an adenosine analog with a broad spectrum of biological activity. The key structural difference between cordycepin and adenosine lies in the absence of a hydroxyl group at the 3' position of the ribose ring. Upon administration, cordycepin can undergo an enzymatic transformation in specific tissues, forming cordycepin triphosphate. In this study, we conducted a comprehensive analysis of the structural features of cordycepin and its derivatives, contrasting them with endogenous purine-based metabolites using chemoinformatics and bioinformatics tools in addition to molecular dynamics simulations. We tested the hypothesis that cordycepin triphosphate could bind to the active site of the adenylate cyclase enzyme. The outcomes of our molecular dynamics simulations revealed scores that are comparable to, and superior to, those of adenosine triphosphate (ATP), the endogenous ligand. This interaction could reduce the production of cyclic adenosine monophosphate (cAMP) by acting as a pseudo-ATP that lacks a hydroxyl group at the 3' position, essential to carry out nucleotide cyclization. We discuss the implications in the context of the plasticity of cancer and other cells within the tumor microenvironment, such as cancer-associated fibroblast, endothelial, and immune cells. This interaction could awaken antitumor immunity by preventing phenotypic changes in the immune cells driven by sustained cAMP signaling. The last could be an unreported molecular mechanism that helps to explain more details about cordycepin's mechanism of action.

Verification of In Vitro Anticancer Activity and Bioactive Compounds in Cordyceps Militaris-Infused Sweet Potato Shochu Spirits.

Many liqueurs, including spirits infused with botanicals, are crafted not only for their taste and flavor but also for potential medicinal benefits. However, the scientific evidence supporting their medicinal effects remains limited. This study aims to verify in vitro anticancer activity and bioactive compounds in shochu spirits infused with Cordyceps militaris, a Chinese medicine. The results revealed that a bioactive fraction was eluted from the spirit extract with 40% ethanol. The infusion time impacted the inhibitory effect of the spirit extract on the proliferation of colon cancer-derived cell line HCT-116 cells, and a 21-day infusion showed the strongest inhibitory effect. Furthermore, the spirit extract was separated into four fractions, A-D, by high-performance liquid chromatography (HPLC), and Fractions B, C, and D, but not A, exerted the effects of proliferation inhibition and apoptotic induction of HCT-116 cells and HL-60 cells. Furthermore, Fractions B, C, and D were, respectively, identified as adenosine, cordycepin, and N6-(2-hydroxyethyl)-adenosine (HEA) by comprehensive chemical analyses, including proton nuclear magnetic resonance (1H-NMR), Fourier transform infrared spectroscopy (FT-IR), and electrospray ionization mass spectrometry (ESI-MS). To better understand the bioactivity mechanisms of cordycepin and HEA, the agonist and antagonist tests of the A3 adenosine receptor (A3AR) were performed. Cell viability was suppressed by cordycepin, and HEA was restored by the A3AR antagonist MR1523, suggesting that cordycepin and HEA possibly acted as agonists to activate A3ARs to inhibit cell proliferation. Molecular docking simulations revealed that both adenosine and cordycepin bound to the same pocket site of A3ARs, while HEA exhibited a different binding pattern, supporting a possible explanation for the difference in their bioactivity. Taken together, the present study demonstrated that cordycepin and HEA were major bioactive ingredients in Cordyceps militaries-infused sweet potato shochu spirits, which contributed to the in vitro anticancer activity.

Decreased Transition-State Analogue Affinity in Isotopically Heavy MTAN with Increased Catalysis.

5'-Methylthioadenosine/S-adenosylhomocysteine nucleosidase from Helicobacter pylori (HpMTAN) demonstrated faster chemistry when expressed as an isotopically heavy protein, with 2H, 13C, and 15N replacing the bulk of normal isotopes. The inverse heavy enzyme isotope effect has been attributed to improved enzyme-reactant interactions causing more frequent transition-state formation ( Proc. Natl. Acad. Sci. U.S.A. 2021, 118, e2109118118). Transition-state analogues stabilize the transient dynamic geometry of the transition state and inform on transition-state dynamics. Here, a slow-onset, tight-binding transition-state analogue of HpMTAN is characterized with heavy and light enzymes. Dissociation constants for the initial encounter complex (Ki) and for the tightly bound complex after slow-onset inhibition (Ki*) with hexylthio-DADMe-Immucillin-A (HTDIA) gave Ki values for light and heavy HpMTAN = 52 ± 10 and 85 ± 13 pM and Ki* values = 5.9 ± 0.3 and 10.0 ± 1.2 pM, respectively. HTDIA dissociates from heavy HpMTAN at 0.063 ± 0.002 min-1, faster than that from light HpMTAN at 0.032 ± 0.004 min-1. These values are consistent with transition-state formation by an improved catalytic site dynamic search and inconsistent with catalytic efficiency proportional to tight binding of the transition state.

Residence Times for Femtomolar and Picomolar Inhibitors of MTANs.

5'-Methylthioadenosine nucleosidases (MTANs) catalyze the hydrolysis of 5'-substituted adenosines to form adenine and 5-substituted ribose. Escherichia coli MTAN (EcMTAN) and Helicobacter pylori MTAN (HpMTAN) form late and early transition states, respectively. Transition state analogues designed for the late transition state bind with fM to pM affinity to both classes of MTANs. Here, we compare the residence times (off-rates) with the equilibrium dissociation constants for HpMTAN and EcMTAN, using five 5'-substituted DADMe-ImmA transition state analogues. The inhibitors dissociate orders of magnitude slower from EcMTAN than from HpMTAN. For example, the slowest release rate was observed for the EcMTAN-HTDIA complex (t1/2 = 56 h), compared to a release rate of t1/2 = 0.3 h for the same complex with HpMTAN, despite similar structures and catalytic sites for these enzymes. Other inhibitors also reveal disconnects between residence times and equilibrium dissociation constants. Residence time is correlated with pharmacological efficacy; thus, experimental analyses of dissociation rates are useful to guide physiological function of tight-binding inhibitors. Steered molecular dynamics simulations for the dissociation of an inhibitor from both EcMTAN and HpMTAN provide atomic level mechanistic insight for the differences in dissociation kinetics and inhibitor residence times for these enzymes.

Enzymatic bypass of an N6-deoxyadenosine DNA-ethylene dibromide-peptide cross-link by translesion DNA polymerases.

Unrepaired DNA-protein cross-links, due to their bulky nature, can stall replication forks and result in genome instability. Large DNA-protein cross-links can be cleaved into DNA-peptide cross-links, but the extent to which these smaller fragments disrupt normal replication is not clear. Ethylene dibromide (1,2-dibromoethane) is a known carcinogen that can cross-link the repair protein O6-alkylguanine-DNA alkyltransferase (AGT) to the N6 position of deoxyadenosine (dA) in DNA, as well as four other positions in DNA. We investigated the effect of a 15-mer peptide from the active site of AGT, cross-linked to the N6 position of dA, on DNA replication by human translesion synthesis DNA polymerases (Pols) η, ⍳, and κ. The peptide-DNA cross-link was bypassed by the three polymerases at different rates. In steady-state kinetics, the specificity constant (kcat/Km) for incorporation of the correct nucleotide opposite to the adduct decreased by 220-fold with Pol κ, tenfold with pol η, and not at all with Pol ⍳. Pol η incorporated all four nucleotides across from the lesion, with the preference dT > dC > dA > dG, while Pol ⍳ and κ only incorporated the correct nucleotide. However, LC-MS/MS analysis of the primer-template extension product revealed error-free bypass of the cross-linked 15-mer peptide by Pol η. We conclude that a bulky 15-mer peptide cross-linked to the N6 position of dA can retard polymerization and cause miscoding but that overall fidelity is not compromised because only correct pairs are extended.

Selective Unnatural Base Pairing and Recognition of 2-Hydroxy-2'-deoxyadenosine in DNA Using Pseudo-dC Derivatives.

The formation of unnatural base pairs within duplex DNA would facilitate DNA nanotechnology and biotechnology. Iso-2'-deoxyguanosine (iso-dG) forms base pairs with iso-2'-deoxycytidine, and its use as an unnatural base pair was investigated. Iso-dG is one of the tautomers of 2-hydroxy-2'-deoxyadenosine (2-OH-dA), known as an oxidatively damaged nucleobase, and its selective recognition in DNA plays an important role in the diagnosis and pathogenesis of disease. Therefore, we focused on pseudo-dC (ψdC) as a suitable molecule that recognizes 2-OH-dA in DNA. Since 2-OH-dA shows tautomeric structures in DNA, we designed and used ψdC, which also has a tautomeric structure. We successfully synthesized a ψdC phosphoramidite compound for the synthesis of oligonucleotides (ODNs) as well as its triphosphate derivative (ψdCTP). Tm measurements revealed that ODNs including ψdC showed stable base pair formation with ODNs having 2-OH-dA. In contrast, low Tm values were observed for other bases (dG, dA, dC, and T). The results obtained for the single-nucleotide primer extension reaction revealed that ψdCTP was incorporated into the complementary position of 2-OH-dA in template DNA with high selectivity. In addition, the primer elongation reaction was confirmed to proceed in the presence of dNTPs. The present study reports an artificial nucleic acid that selectively and stably forms unnatural base pairs with 2-OH-dA in DNA.

Structural insights into FTO's catalytic mechanism for the demethylation of multiple RNA substrates.

FTO demethylates internal N6-methyladenosine (m6A) and N6,2'-O-dimethyladenosine (m6Am; at the cap +1 position) in mRNA, m6A and m6Am in snRNA, and N1-methyladenosine (m1A) in tRNA in vivo, and in vitro evidence supports that it can also demethylate N6-methyldeoxyadenosine (6mA), 3-methylthymine (3mT), and 3-methyluracil (m3U). However, it remains unclear how FTO variously recognizes and catalyzes these diverse substrates. Here we demonstrate-in vitro and in vivo-that FTO has extensive demethylation enzymatic activity on both internal m6A and cap m6Am Considering that 6mA, m6A, and m6Am all share the same nucleobase, we present a crystal structure of human FTO bound to 6mA-modified ssDNA, revealing the molecular basis of the catalytic demethylation of FTO toward multiple RNA substrates. We discovered that (i) N6-methyladenine is the most favorable nucleobase substrate of FTO, (ii) FTO displays the same demethylation activity toward internal m6A and m6Am in the same RNA sequence, suggesting that the substrate specificity of FTO primarily results from the interaction of residues in the catalytic pocket with the nucleobase (rather than the ribose ring), and (iii) the sequence and the tertiary structure of RNA can affect the catalytic activity of FTO. Our findings provide a structural basis for understanding the catalytic mechanism through which FTO demethylates its multiple substrates and pave the way forward for the structure-guided design of selective chemicals for functional studies and potential therapeutic applications.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Genotoxic C8-Arylamino-2'-deoxyadenosines Act as Latent Alkylating Agents to Induce DNA Interstrand Cross-Links.

DNA interstrand cross-links (ICLs) are extremely deleterious and structurally diverse, driving the evolution of ICL repair pathways. Discovering ICL-inducing agents is, thus, crucial for the characterization of ICL repair pathways and Fanconi anemia, a genetic disease caused by mutations in ICL repair genes. Although several studies point to oxidative stress as a cause of ICLs, oxidative stress-induced cross-linking events remain poorly characterized. Also, polycyclic aromatic amines, potent environmental carcinogens, have been implicated in producing ICLs, but their identities and sequences are unknown. To close this knowledge gap, we tested whether ICLs arise by the oxidation of 8-arylamino-2'-deoxyadenosine (ArNHdA) lesions, adducts produced by arylamino carcinogens. Herein, we report that ArNHdA acts as a latent cross-linking agent to generate ICLs under oxidative conditions. The formation of an ICL from 8-aminoadenine, but not from 8-aminoguanine, highlights the specificity of 8-aminopurine-mediated ICL production. Under the influence of the reactive oxygen species (ROS) nitrosoperoxycarbonate, ArNHdA (Ar = biphenyl, fluorenyl) lesions were selectively oxidized to generate ICLs. The cross-linking reaction may occur between the C2-ArNHdA and N2-dG, presumably via oxidation of ArNHdA into a reactive diiminoadenine intermediate followed by the nucleophilic attack of the N2-dG on the diiminoadenine. Overall, ArNHdA-mediated ICLs represent rare examples of ROS-induced ICLs and polycyclic aromatic amine-mediated ICLs. These results reveal novel cross-linking chemistry and the genotoxic effects of arylamino carcinogens and support the hypothesis that C8-modified adenines with low redox potential can cause ICLs in oxidative stress.

Investigation of 2'-Deoxyadenosine-Derived Adducts Specifically Formed in Rat Liver and Lung DNA by N'-Nitrosonornicotine Metabolism.

The International Agency for Research on Cancer has classified the tobacco-specific nitrosamines N'-nitrosonornicotine (NNN) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) as "carcinogenic to humans" (Group 1). To exert its carcinogenicity, NNN requires metabolic activation to form reactive intermediates which alkylate DNA. Previous studies have identified cytochrome P450-catalyzed 2'-hydroxylation and 5'-hydroxylation of NNN as major metabolic pathways, with preferential activation through the 5'-hydroxylation pathway in some cultured human tissues and patas monkeys. So far, the only DNA adducts identified from NNN 5'-hydroxylation in rat tissues are 2-[2-(3-pyridyl)-N-pyrrolidinyl]-2'-deoxyinosine (Py-Py-dI), 6-[2-(3-pyridyl)-N-pyrrolidinyl]-2'-deoxynebularine (Py-Py-dN), and N6-[4-hydroxy-1-(pyridine-3-yl)butyl]-2'-deoxyadenosine (N6-HPB-dAdo) after reduction. To expand the DNA adduct panel formed by NNN 5'-hydroxylation and identify possible activation biomarkers of NNN metabolism, we investigated the formation of dAdo-derived adducts using a new highly sensitive and specific liquid chromatography-nanoelectrospray ionization-high-resolution tandem mass spectrometry method. Two types of NNN-specific dAdo-derived adducts, N6-[5-(3-pyridyl)tetrahydrofuran-2-yl]-2'-deoxyadenosine (N6-Py-THF-dAdo) and 6-[2-(3-pyridyl)-N-pyrrolidinyl-5-hydroxy]-2'-deoxynebularine (Py-Py(OH)-dN), were observed for the first time in calf thymus DNA incubated with 5'-acetoxyNNN. More importantly, Py-Py(OH)-dN was also observed in relatively high abundance in the liver and lung DNA of rats treated with racemic NNN in the drinking water for 3 weeks. These new adducts were characterized using authentic synthesized standards. Both NMR and MS data agreed well with the proposed structures of N6-Py-THF-dAdo and Py-Py(OH)-dN. Reduction of Py-Py(OH)-dN by NaBH3CN led to the formation of Py-Py-dN both in vitro and in vivo, which was confirmed by its isotopically labeled internal standard [pyridine-d4]Py-Py-dN. The NNN-specific dAdo adducts Py-THF-dAdo and Py-Py(OH)-dN formed by NNN 5'-hydroxylation provide a more comprehensive understanding of the mechanism of DNA adduct formation by NNN.

PrimPol, an archaic primase/polymerase operating in human cells.

We describe a second primase in human cells, PrimPol, which has the ability to start DNA chains with deoxynucleotides unlike regular primases, which use exclusively ribonucleotides. Moreover, PrimPol is also a DNA polymerase tailored to bypass the most common oxidative lesions in DNA, such as abasic sites and 8-oxoguanine. Subcellular fractionation and immunodetection studies indicated that PrimPol is present in both nuclear and mitochondrial DNA compartments. PrimPol activity is detectable in mitochondrial lysates from human and mouse cells but is absent from mitochondria derived from PRIMPOL knockout mice. PRIMPOL gene silencing or ablation in human and mouse cells impaired mitochondrial DNA replication. On the basis of the synergy observed with replicative DNA polymerases Polγ and Polε, PrimPol is proposed to facilitate replication fork progression by acting as a translesion DNA polymerase or as a specific DNA primase reinitiating downstream of lesions that block synthesis during both mitochondrial and nuclear DNA replication.

Flexizyme-catalyzed synthesis of 3'-aminoacyl-NH-tRNAs.

Structural analysis of ribosomes in complex with aminoacyl- and/or peptidyl-transfer RNA (tRNA) often suffers from rapid hydrolysis of the ester bond of aminoacyl-tRNAs. To avoid this issue, several methods to introduce an unhydrolyzable amide bond instead of the canonical ester bond have been developed to date. However, the existing methodologies require rather complex steps of synthesis and are often inapplicable to a variety of amino acids including those with noncanonical structures. Here, we report a new method to synthesize 3'-aminoacyl-NH-tRNAs by means of flexizymes-ribozymes capable of charging amino acids onto tRNAs. We show that two types of flexizymes, dFx and eFx, are able to charge various amino acids, including nonproteinogenic ones, onto tRNA or microhelix RNA bearing the 3'-deoxy-3'-amino-adenosine. Due to the versatility of the flexizymes toward any pair of nonproteinogenic amino acids and full-length or fragment tRNAs, this method provides researchers an opportunity to use a wide array of hydrolytically stable 3'-aminoacyl-NH-tRNAs and analogs for various studies.

Uric Acid as a Photosensitizer in the Reaction of Deoxyribonucleosides with UV Light of Wavelength Longer than 300 nm: Identification of Products from 2'-Deoxycytidine.

DNA reacts directly with UV light with a wavelength shorter than 300 nm. Although ground surface sunlight includes little of this short-wavelength UV light due to its almost complete absorption by the atmosphere, sunlight is the primary cause of skin cancer. Photosensitization by endogenous substances must therefore be involved in skin cancer development mechanisms. Uric acid is the final metabolic product of purines in humans, and is present at relatively high concentrations in cells and fluids. When a neutral mixed solution of 2'-deoxycytidine, 2'-deoxyguanosine, thymidine, and 2'-deoxyadenosine was irradiated with UV light with a wavelength longer than 300 nm in the presence of uric acid, all the nucleosides were consumed in a uric acid dose-dependent manner. These reactions were inhibited by the addition of radical scavengers, ethanol and sodium azide. Two products from 2'-deoxycytidine were isolated and identified as N4-hydroxy-2'-deoxycytidine and N4,5-cyclic amide-2'-deoxycytidine, formed by cycloaddition of an amide group from uric acid. A 15N-labeled uric acid, uric acid-1,3-15N2, having two 14N and two 15N atoms per molecule, produced N4,5-cyclic amide-2'-deoxycytidine containing both 14N and 15N atoms from uric acid-1,3-15N2. Singlet oxygen, hydroxyl radical, peroxynitrous acid, hypochlorous acid, and hypobromous acid generated neither N4-hydroxy-2'-deoxycytidine nor N4,5-cyclic amide-2'-deoxycytidine in the presence of uric acid. These results indicate that uric acid is a photosensitizer for the reaction of nucleosides by UV light with a wavelength longer than 300 nm, and that an unidentified radical derived from uric acid with a delocalized unpaired electron may be generated.

Dynamic content changes of cordycepin and adenosine and transcriptome in Cordyceps kyushuensis Kob at different fermentation stages.

20% (w/w) Astragali radix was added to the rice medium to cultivate C. kyushuensis Kob. The fermentation product was collected at mycelium stage, coloring stage, stromata-forming initial stage and fruiting body stage of C. kyushuensis Kob. The dynamic content changes of cordycepin and adenosine were detected at different fermentation stages. In the rice medium with Astragalus radix, both cordycepin and adenosine reached the highest content value on the 30th day of fermentation, 17.31 mg/g and 0.94 mg/g, respectively, which were 8.6 times and 2.0 times of that in rice medium at the same stage. At the same time, transcriptomics technology was used to analyze C. kyushuensis Kob during these four periods.

Radical SAM Enzyme Spore Photoproduct Lyase: Properties of the Ω Organometallic Intermediate and Identification of Stable Protein Radicals Formed during Substrate-Free Turnover.

Spore photoproduct lyase is a radical S-adenosyl-l-methionine (SAM) enzyme with the unusual property that addition of SAM to the [4Fe-4S]1+ enzyme absent substrate results in rapid electron transfer to SAM with accompanying homolytic S-C5' bond cleavage. Herein, we demonstrate that this unusual reaction forms the organometallic intermediate Ω in which the unique Fe atom of the [4Fe-4S] cluster is bound to C5' of the 5'-deoxyadenosyl radical (5'-dAdo•). During catalysis, homolytic cleavage of the Fe-C5' bond liberates 5'-dAdo• for reaction with substrate, but here, we use Ω formation without substrate to determine the thermal stability of Ω. The reaction of Geobacillus thermodenitrificans SPL (GtSPL) with SAM forms Ω within ∼15 ms after mixing. By monitoring the decay of Ω through rapid freeze-quench trapping at progressively longer times we find an ambient temperature decay time of the Ω Fe-C5' bond of τ ≈ 5-6 s, likely shortened by enzymatic activation as is the case with the Co-C5' bond of B12. We have further used hand quenching at times up to 10 min, and thus with multiple SAM turnovers, to probe the fate of the 5'-dAdo• radical liberated by Ω. In the absence of substrate, Ω undergoes low-probability conversion to a stable protein radical. The WT enzyme with valine at residue 172 accumulates a Val•; mutation of Val172 to isoleucine or cysteine results in accumulation of an Ile• or Cys• radical, respectively. The structures of the radical in WT, V172I, and V172C variants have been established by detailed EPR/DFT analyses.

6-Nitrochrysene-Derived C8-2'-Deoxyadenosine Adduct: Synthesis of Site-Specific Oligodeoxynucleotides and Mutagenicity in Escherichia coli.

6-Nitrochrysene (6-NC), the most potent carcinogen evaluated by the newborn mouse assay, is metabolically activated by nitroreduction and a combination of ring oxidation and nitroreduction pathways. The nitroreduction pathway yields three major DNA adducts: at the C8 and N2 positions of 2'-deoxyguanosine (dG), N-(dG-8-yl)-6-AC and 5-(dG-N2-yl)-6-AC, and at the C8 position of 2'-deoxyadenosine (dA), N-(dA-8-yl)-6-AC. A nucleotide excision repair assay demonstrated that N-(dA-8-yl)-6-AC is repaired much more slowly than many other bulky DNA adducts, including the other DNA adducts formed by 6-NC. But neither the total synthesis nor evaluation of other biological activities of this dA adduct has ever been reported. Herein, we report a convenient synthesis of the 6-NC-derived dA adduct by employing the Buchwald-Hartwig coupling strategy, which provided a high yield of the protected N-(dA-8-yl)-6-AC. The deprotected nucleoside showed syn conformational preference by NMR spectroscopy. Following DMT protection of the 5'-hydroxyl, N-(dA-8-yl)-6-AC was converted to its 3'-phosphoramidite, which was used to prepare oligonucleotides containing a single N-(dA-8-yl)-6-AC adduct. Circular dichroism spectra of the adducted duplex showed only a slight departure from the B-DNA helix profile of the control duplex. The 15-mer N-(dA-8-yl)-6-AC oligonucleotide was used to construct a single-stranded plasmid vector containing a single adduct, which was replicated in Escherichia coli. Viability of the adducted construct was ∼60% of the control, indicating slower translesion synthesis of the adduct, which increased to nearly 90% upon induction of the SOS functions. Without SOS, the mutation frequency (MF) of the adduct was 5.2%, including 2.9% targeted and 2.3% semi-targeted mutations. With SOS, the targeted MF increased 3-fold to 9.0%, whereas semi-targeted mutation increased only marginally to 3.2%. The major type of targeted mutation was A*→G in both uninduced and SOS-induced cells.

Islatravir Case Study for Enhanced Screening of Thermodynamically Stable Crystalline Anhydrate Phases in Pharmaceutical Process Development by Hot Melt Extrusion.

The emergence of new active pharmaceutical ingredient (API) polymorphs in pharmaceutical development presents significant risks. Even with thorough polymorph screening, new pathways toward alternate crystal phases can present themselves over the course of formulation development; thus, further improvements in phase screening methods are needed. Herein, a case study is presented of a thermodynamically stable crystalline phase of the HIV drug Islatravir (MK-8591, EFdA) that was not isolated from initial pharmaceutical polymorph screening. In total, five Islatravir phases are identified: one monohydrate and four anhydrate phases. The new phase, anhydrate form IV, was unexpectedly discovered during hot melt extrusion (HME) process development of polymeric implant drug product formulations while probing extreme manufacturing process conditions (elevated shear forces). X-ray diffraction (XRD), differential scanning calorimetry (DSC), and solid-state nuclear magnetic resonance (ssNMR) were utilized as principal tools to identify the new polymorph. The result suggests that HME introduces conditions that may allow a thermodynamically stable crystalline phase to form and these conditions are not necessarily captured by routine pharmaceutical polymorph screening. Subsequent investigations identified procedures to generate the new anhydrate phase without HME equipment by the use of special thermal procedures. It is found that for a crystalline hydrate phase the rate of water loss as well as water entrapment in a heating vessel play a crucial role in phase conversions into different anhydrate polymorphs. Further, the polymer involved in the HME manufacturing process also plays a critical role in the phase conversion, likely by coating the API microparticles and thereby altering the phase conversion kinetics. Strategies presented herein to mimic phase changes during formulation manufacture hold promise for the identification of thermodynamically stable anhydrate forms in earlier stages of pharmaceutical development.

2'-Functional group of adenosine in 10-23 DNAzyme promotes catalytic activity.

10-23 DNAzyme is an artificially selected catalytic DNA molecule. Its great potential as genetic therapeutics promoted chemical modifications for more efficient DNAzymes. Here, 10-23 DNAzyme was modified on its six deoxyadenosine residues (A5, A9, A11, A12, A15 in the catalytic domain and A0 of the recognition arm next to the cleavage site) with compound 1, an adenosine analogue with 2'-O-[N-(aminoethyl)carbamoyl]methyl group. A positive effect of compound 1 at A15 was observed (HJDS-05, kobs = 0.0111 min-1). Compared to the effect of 2'-H and 2'-OMe at A15, this result provided an approach for more efficient DNAzyme by combining 2'-substituted amino group of adenosine with A15 as the lead structure.