Multiplexed and programmable regulation of gene networks with an integrated RNA and CRISPR/Cas toolkit in human cells.

RNA-based regulation and CRISPR/Cas transcription factors (CRISPR-TFs) have the potential to be integrated for the tunable modulation of gene networks. A major limitation of this methodology is that guide RNAs (gRNAs) for CRISPR-TFs can only be expressed from RNA polymerase III promoters in human cells, limiting their use for conditional gene regulation. We present new strategies that enable expression of functional gRNAs from RNA polymerase II promoters and multiplexed production of proteins and gRNAs from a single transcript in human cells. We use multiple RNA regulatory strategies, including RNA-triple-helix structures, introns, microRNAs, and ribozymes, with Cas9-based CRISPR-TFs and Cas6/Csy4-based RNA processing. Using these tools, we efficiently modulate endogenous promoters and implement tunable synthetic circuits, including multistage cascades and RNA-dependent networks that can be rewired with Csy4 to achieve complex behaviors. This toolkit can be used for programming scalable gene circuits and perturbing endogenous networks for biology, therapeutic, and synthetic biology applications.

Rapid protein evolution, organellar reductions, and invasive intronic elements in the marine aerobic parasite dinoflagellate Amoebophrya spp.

BACKGROUND: Dinoflagellates are aquatic protists particularly widespread in the oceans worldwide. Some are responsible for toxic blooms while others live in symbiotic relationships, either as mutualistic symbionts in corals or as parasites infecting other protists and animals. Dinoflagellates harbor atypically large genomes (~ 3 to 250 Gb), with gene organization and gene expression patterns very different from closely related apicomplexan parasites. Here we sequenced and analyzed the genomes of two early-diverging and co-occurring parasitic dinoflagellate Amoebophrya strains, to shed light on the emergence of such atypical genomic features, dinoflagellate evolution, and host specialization. RESULTS: We sequenced, assembled, and annotated high-quality genomes for two Amoebophrya strains (A25 and A120), using a combination of Illumina paired-end short-read and Oxford Nanopore Technology (ONT) MinION long-read sequencing approaches. We found a small number of transposable elements, along with short introns and intergenic regions, and a limited number of gene families, together contribute to the compactness of the Amoebophrya genomes, a feature potentially linked with parasitism. While the majority of Amoebophrya proteins (63.7% of A25 and 59.3% of A120) had no functional assignment, we found many orthologs shared with Dinophyceae. Our analyses revealed a strong tendency for genes encoded by unidirectional clusters and high levels of synteny conservation between the two genomes despite low interspecific protein sequence similarity, suggesting rapid protein evolution. Most strikingly, we identified a large portion of non-canonical introns, including repeated introns, displaying a broad variability of associated splicing motifs never observed among eukaryotes. Those introner elements appear to have the capacity to spread over their respective genomes in a manner similar to transposable elements. Finally, we confirmed the reduction of organelles observed in Amoebophrya spp., i.e., loss of the plastid, potential loss of a mitochondrial genome and functions. CONCLUSION: These results expand the range of atypical genome features found in basal dinoflagellates and raise questions regarding speciation and the evolutionary mechanisms at play while parastitism was selected for in this particular unicellular lineage.

Splicing factor proline and glutamine rich intron retention, reduced expression and aggregate formation are pathological features of amyotrophic lateral sclerosis.

AIM: Splicing factor proline and glutamine rich (SFPQ) is an RNA-DNA binding protein that is dysregulated in Alzheimer's disease and frontotemporal dementia. Dysregulation of SFPQ, specifically increased intron retention and nuclear depletion, has been linked to several genetic subtypes of amyotrophic lateral sclerosis (ALS), suggesting that SFPQ pathology may be a common feature of this heterogeneous disease. Our study aimed to investigate this hypothesis by providing the first comprehensive assessment of SFPQ pathology in large ALS case-control cohorts. METHODS: We examined SFPQ at the RNA, protein and DNA levels. SFPQ RNA expression and intron retention were examined using RNA-sequencing and quantitative PCR. SFPQ protein expression was assessed by immunoblotting and immunofluorescent staining. At the DNA level, SFPQ was examined for genetic variation novel to ALS patients. RESULTS: At the RNA level, retention of SFPQ intron nine was significantly increased in ALS patients' motor cortex. In addition, SFPQ RNA expression was significantly reduced in the central nervous system, but not blood, of patients. At the protein level, neither nuclear depletion nor reduced expression of SFPQ was found to be a consistent feature of spinal motor neurons. However, SFPQ-positive ubiquitinated protein aggregates were observed in patients' spinal motor neurons. At the DNA level, our genetic screen identified two novel and two rare SFPQ sequence variants not previously reported in the literature. CONCLUSIONS: Our findings confirm dysregulation of SFPQ as a pathological feature of the central nervous system of ALS patients and indicate that investigation of the functional consequences of this pathology will provide insight into ALS biology.

The U1 snRNP Subunit LUC7 Modulates Plant Development and Stress Responses via Regulation of Alternative Splicing.

Introns are removed by the spliceosome, a large macromolecular complex composed of five ribonucleoprotein subcomplexes (U snRNPs). The U1 snRNP, which binds to 5' splice sites, plays an essential role in early steps of the splicing reaction. Here, we show that Arabidopsis thaliana LETHAL UNLESS CBC7 (LUC7) proteins, which are encoded by a three-member gene family in Arabidopsis, are important for plant development and stress resistance. We show that LUC7 is a U1 snRNP accessory protein by RNA immunoprecipitation experiments and LUC7 protein complex purifications. Transcriptome analyses revealed that LUC7 proteins are not only important for constitutive splicing, but also affect hundreds of alternative splicing events. Interestingly, LUC7 proteins specifically promote splicing of a subset of terminal introns. Splicing of LUC7-dependent introns is a prerequisite for nuclear export, and some splicing events are modulated by stress in a LUC7-dependent manner. Taken together, our results highlight the importance of the U1 snRNP component LUC7 in splicing regulation and suggest a previously unrecognized role of a U1 snRNP accessory factor in terminal intron splicing.

Order of removal of conventional and nonconventional introns from nuclear transcripts of Euglena gracilis.

Nuclear genes of euglenids and marine diplonemids harbor atypical, nonconventional introns which are not observed in the genomes of other eukaryotes. Nonconventional introns do not have the conserved borders characteristic for spliceosomal introns or the sequence complementary to U1 snRNA at the 5' end. They form a stable secondary structure bringing together both exon/intron junctions, nevertheless, this conformation does not resemble the form of self-splicing or tRNA introns. In the genes studied so far, frequent nonconventional introns insertions at new positions have been observed, whereas conventional introns have been either found at the conserved positions, or simply lost. In this work, we examined the order of intron removal from Euglena gracilis transcripts of the tubA and gapC genes, which contain two types of introns: nonconventional and spliceosomal. The relative order of intron excision was compared for pairs of introns belonging to different types. Furthermore, intermediate products of splicing were analyzed using the PacBio Next Generation Sequencing system. The analysis led to the main conclusion that nonconventional introns are removed in a rapid way but later than spliceosomal introns. Moreover, the observed accumulation of transcripts with conventional introns removed and nonconventional present may suggest the existence of a time gap between the two types of splicing.

Human exonization through differential nucleosome occupancy.

Nucleosomal modifications have been implicated in fundamental epigenetic regulation, but the roles of nucleosome occupancy in shaping changes through evolution remain to be addressed. Here we present high-resolution nucleosome occupancy profiles for multiple tissues derived from human, macaque, tree shrew, mouse, and pig. Genome-wide comparison reveals conserved nucleosome occupancy profiles across both different species and tissue types. Notably, we found significantly higher levels of nucleosome occupancy in exons than in introns, a pattern correlated with the different exon-intron GC content. We then determined whether this biased occupancy may play roles in the origination of new exons through evolution, rather than being a downstream effect of exonization, through a comparative approach to sequentially trace the order of the exonization and biased nucleosome binding. By identifying recently evolved exons in human but not in macaque using matched RNA sequencing, we found that higher exonic nucleosome occupancy also existed in macaque regions orthologous to these exons. Presumably, such biased nucleosome occupancy facilitates the origination of new exons by increasing the splice strength of the ancestral nonexonic regions through driving a local difference in GC content. These data thus support a model that sites bound by nucleosomes are more likely to evolve into exons, which we term the "nucleosome-first" model.

Arabidopsis Sucrose Transporter AtSuc1 introns act as strong enhancers of expression.

The expression of AtSUC1 is controlled by the promoter and intragenic sequences. AtSUC1 is expressed in roots, pollen and trichomes. However, AtSUC1 promoter-GUS transgenics only show expression in trichomes and pollen. Here, we show that the root expression of AtSUC1 is controlled by an interaction between the AtSUC1 promoter and two short introns. The deletion of either intron from whole-gene-GUS constructs results in no root expression, showing that both introns are required. The two introns in tandem, fused to GUS, produce high constitutive expression throughout the vegetative parts of the plant. When combined with the promoter, the expression driven by the introns is reduced and localized to the roots. In Arabidopsis seedlings, exogenously applied sucrose induces the expression of AtSUC1 in roots and causes anthocyanin accumulation. atsuc1 loss-of-function mutants are defective in sucrose-induced anthocyanin accumulation. We show that an AtSUC1 whole-gene-GUS construct expressing a nonfunctional AtSUC1 (D152N) mutant, that is transport inactive, is defective in sucrose-induced AtSUC1 expression when expressed in an atsuc1-null background. We also show that the transport-defective allele does not complement the loss of sucrose-induced anthocyanin accumulation in null atsuc1 mutants. The results indicate that sucrose uptake via AtSUC1 is required for sucrose-induced AtSUC1 expression and sucrose-induced anthocyanin accumulation and that the site for sucrose detection is intracellular.

PPR20 Is Required for the cis-Splicing of Mitochondrial nad2 Intron 3 and Seed Development in Maize.

Pentatricopeptide repeat (PPR) proteins are helical repeat RNA-binding proteins that function in RNA processing by conferring sequence-specific RNA-binding activity. Owing to the lethality of PPR mutants, functions of many PPR proteins remain obscure. In this study, we report the function of PPR20 in intron splicing in mitochondria and its role in maize seed development. PPR20 is a P-type PPR protein targeted to mitochondria. The ppr20 mutants display slow embryo and endosperm development. Null mutation of PPR20 severely reduces the cis-splicing of mitochondrial nad2 intron 3, resulting in reduction in the assembly and activity of mitochondrial complex I. The ppr20-35 allele with a Mu insertion in the N-terminal region shows a much weaker phenotype. Molecular analyses revealed that the mutant produces a truncated transcript, coding for PPR20ΔN120 lacking the N-terminal 120 amino acids. Subcellular localization revealed that PPR20ΔN120:GFP is able to target to mitochondria as well, suggesting the sequence diversity of the mitochondrial targeting peptides. Another mutant zm_mterf15 was also found to be impaired in the splicing of mitochondrial nad2 intron 3. Further analyses are required to identify the exact function of PPR20 and Zm_mTERF15 in the splicing of nad2 intron 3.

Maize Empty Pericarp602 Encodes a P-Type PPR Protein That Is Essential for Seed Development.

Pentatricopeptide repeat (PPR) proteins play crucial roles in intron splicing, which is important for RNA maturation. Identification of novel PPR protein with the function of intron splicing would help to understand the RNA splicing mechanism. In this study, we identified the maize empty pericarp602 (emp602) mutants, the mature kernels of which showed empty pericarp phenotype. We cloned the Emp602 gene from emp602 mutants and revealed that Emp602 encodes a mitochondrial-localized P-type PPR protein. We further revealed that Emp602 is specific for the cis-splicing of mitochondrial Nad4 intron 1 and intron 3, and mutation of Emp602 led to the loss of mature Nad4 transcripts. The loss of function of Emp602 nearly damaged the assembly and accumulation of complex I and arrested mitochondria formation, which arrested the seed development. The failed assembly of complex I triggers significant upregulation of Aox expression in emp602 mutants. Transcriptome analysis showed that the expression of mitochondrial-related genes, e.g. the genes associated with mitochondrial inner membrane presequence translocase complex and electron carrier activity, were extensively upregulated in emp602 mutant. These results demonstrate that EMP602 functions in the splicing of Nad4 intron 1 and intron 3, and the loss of function of Emp602 arrested maize seed development by disrupting the mitochondria complex I assembly.

Abiotic stress regulates expression of galactinol synthase genes post-transcriptionally through intron retention in rice.

MAIN CONCLUSION: Expression of the Galactinol synthase genes in rice is regulated through post-transcriptional intron retention in response to abiotic stress and may be linked to Raffinose Family Oligosaccharide synthesis in osmotic perturbation. Galactinol synthase (GolS) is the first committed enzyme in raffinose family oligosaccharide (RFO) synthesis pathway and synthesizes galactinol from UDP-galactose and inositol. Expression of GolS genes has long been implicated in abiotic stress, especially drought and salinity. A non-canonical regulation mechanism controlling the splicing and maturation of rice GolS genes was identified in rice photosynthetic tissue. We found that the two isoforms of Oryza sativa GolS (OsGolS) gene, located in chromosomes 3(OsGolS1) and 7(OsGolS2) are interspersed by conserved introns harboring characteristic premature termination codons (PTC). During abiotic stress, the premature and mature transcripts of both isoforms were found to accumulate in a rhythmic manner for very small time-windows interrupted by phases of complete absence. Reporter gene assay using GolS promoters under abiotic stress does not reflect this accumulation profile, suggesting that this regulation occurs post-transcriptionally. We suggest that this may be due to a surveillance mechanism triggering the degradation of the premature transcript preventing its accumulation in the cell. The suggested mechanism fits the paradigm of PTC-induced Nonsense-Mediated Decay (NMD). In support of our hypothesis, when we pharmacologically blocked NMD, the full-length pre-mRNAs were increasingly accumulated in cell. To this end, our work suggests that a combined transcriptional and post transcriptional control exists in rice to regulate GolS expression under stress. Concurrent detection and processing of prematurely terminating transcripts coupled to repressed splicing can be described as a form of Regulated Unproductive Splicing and Translation (RUST) and may be linked to the stress adaptation of the plant, which is an interesting future research possibility.

Intronic (TTTGA)n insertion in SAMD12 also causes familial cortical myoclonic tremor with epilepsy.

BACKGROUND: Intronic (TTTCA)n insertions in the SAMD12, TNRC6A, and RAPGEF2 genes have been identified as causes of familial cortical myoclonic tremor with epilepsy. OBJECTIVE: To identify the cause of familial cortical myoclonic tremor with epilepsy pedigrees without (TTTCA)n insertions in SAMD12, TNRC6A, and RAPGEF2. METHODS: Repeat-primed polymerase chain reaction, long-range polymerase chain reaction, and Sanger sequencing were performed to identify the existence of a novel (TTTGA)n insertion. Targeted long-read sequencing was performed to confirm the accurate structure of the (TTTGA)n insertion. RESULTS: We identified a novel expanded intronic (TTTGA)n insertion at the same site as the previously reported (TTTCA)n insertion in SAMD12. This insertion cosegregated with familial cortical myoclonic tremor with epilepsy in 1 Chinese pedigree with no (TTTCA)n insertion. In the targeted long-read sequencing of 2 patients and 1 asymptomatic carrier in this pedigree, with 1 previously reported (TTTCA)n -insertion-carrying patient as a positive control, a respective total of 302, 159, 207, and 50 on-target subreads (predicated accuracy: ≥90%) spanning the target repeat expansion region were generated. These sequencing data revealed the accurate repeat expansion structures as (TTTTA)114-123 (TTTGA)108-116 in the pedigree and (TTTTA)38 (TTTCA)479 in (TTTCA)n -insertion-carrying patient. CONCLUSION: The targeted long-read sequencing helped us to elucidate the accurate structures of the (TTTGA)n and (TTTCA)n insertions. Our finding offers a novel possible cause for familial cortical myoclonic tremor with epilepsy and might shed light on the identification of genetic causes of this disease in pedigrees with no detected (TTTCA)n insertion in the reported causative genes. © 2019 International Parkinson and Movement Disorder Society.

A Novel Regulatory Mechanism of Type II Collagen Expression via a SOX9-dependent Enhancer in Intron 6.

Type II collagen α1 is specific for cartilaginous tissues, and mutations in its gene are associated with skeletal diseases. Its expression has been shown to be dependent on SOX9, a master transcription factor required for chondrogenesis that binds to an enhancer region in intron 1. However, ChIP sequencing revealed that SOX9 does not strongly bind to intron 1, but rather it binds to intron 6 and a site 30 kb upstream of the transcription start site. Here, we aimed to determine the role of the novel SOX9-binding site in intron 6. We prepared reporter constructs that contain a Col2a1 promoter, intron 1 with or without intron 6, and the luciferase gene. Although the reporter constructs were not activated by SOX9 alone, the construct that contained both introns 1 and 6 was activated 5-10-fold by the SOX9/SOX5 or the SOX9/SOX6 combination in transient-transfection assays in 293T cells. This enhancement was also observed in rat chondrosarcoma cells that stably expressed the construct. CRISPR/Cas9-induced deletion of intron 6 in RCS cells revealed that a 10-bp region of intron 6 is necessary both for Col2a1 expression and SOX9 binding. Furthermore, SOX9, but not SOX5, binds to this region as demonstrated in an electrophoretic mobility shift assay, although both SOX9 and SOX5 bind to a larger 325-bp fragment of intron 6 containing this small sequence. These findings suggest a novel mechanism of action of SOX5/6; namely, the SOX9/5/6 combination enhances Col2a1 transcription through a novel enhancer in intron 6 together with the enhancer in intron 1.

Structural studies of the spliceosome: past, present and future perspectives.

The spliceosome is a multi-subunit RNA-protein complex involved in the removal of non-coding segments (introns) from between the coding regions (exons) in precursors of messenger RNAs (pre-mRNAs). Intron removal proceeds via two transesterification reactions, occurring between conserved sequences at intron-exon junctions. A tightly regulated, hierarchical assembly with a multitude of structural and compositional rearrangements posed a great challenge for structural studies of the spliceosome. Over the years, X-ray crystallography dominated the field, providing valuable high-resolution structural information that was mostly limited to individual proteins and smaller sub-complexes. Recent developments in the field of cryo-electron microscopy allowed the visualisation of fully assembled yeast and human spliceosomes, providing unprecedented insights into substrate recognition, catalysis, and active site formation. This has advanced our mechanistic understanding of pre-mRNA splicing enormously.

Intron retention as a component of regulated gene expression programs.

Intron retention has long been an exemplar of regulated splicing with case studies of individual events serving as models that provided key mechanistic insights into the process of splicing control. In organisms such as plants and budding yeast, intron retention is well understood as a major mechanism of gene expression regulation. In contrast, in mammalian systems, the extent and functional significance of intron retention have, until recently, remained greatly underappreciated. Technical challenges to the global detection and quantitation of transcripts with retained introns have often led to intron retention being overlooked or dismissed as "noise". Now, however, with the wealth of information available from high-throughput deep sequencing, combined with focused computational and statistical analyses, we are able to distinguish clear intron retention patterns in various physiological and pathological contexts. Several recent studies have demonstrated intron retention as a central component of gene expression programs during normal development as well as in response to stress and disease. Furthermore, these studies revealed various ways in which intron retention regulates protein isoform production, RNA stability and translation efficiency, and rapid induction of expression via post-transcriptional splicing of retained introns. In this review, we highlight critical findings from these transcriptomic studies and discuss commonalties in the patterns prevalent in intron retention networks at the functional and regulatory levels.

Intron retention and rhythmic diel pattern regulation of carotenoid cleavage dioxygenase 2 during crocetin biosynthesis in saffron.

The carotenoid cleavage dioxygenase 2, a new member of the CCD family, catalyzes the conversion of zeaxanthin into crocetin-dialdehyde in Crocus. CCD2 is expressed in flowers, being responsible for the yellow, orange and red colorations displayed by tepals and stigma. Three CsCCD2 genes were identified in Crocus sativus, the longest contains ten exons and the shorter is a truncated copy with no introns and which lacks one exon sequence. Analysis of RNA-seq datasets of three developmental stages of saffron stigma allowed the determination of alternative splicing in CsCCD2, being intron retention (IR) the prevalent form of alternative splicing in CsCCD2. Further, high IR was observed in tissues that do not accumulate crocetin. The analysis of one CsCCD2 promoter showed cis-regulatory motifs involved in the response to light, temperature, and circadian regulation. The light and circadian regulation are common elements shared with the previously characterized CsLycB2a promoter, and these shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation of these genes during the development of the stigma in saffron. A daily coordinated rhythmic regulation for CsCCD2 and CsLycB2a was observed, with higher levels of mRNA occurring at low temperatures during darkness, confirming the results obtained in the in silico promoter analysis. In addition, to the light and temperature dependent regulation of CsCCD2 expression, the apocarotenoid ß-cyclocitral up-regulated CsCCD2 expression and could acts as a mediator of chromoplast-to-nucleus signalling, coordinating the expression of CsCCD2 with the developmental state of the chromoplast in the developing stigma.

Albino Leaf 2 is involved in the splicing of chloroplast group I and II introns in rice.

Chloroplasts play an essential role in plant growth and development through manipulating photosynthesis and the production of hormones and metabolites. Although many genes or regulators involved in chloroplast biogenesis and development have been isolated and characterized, identification of novel components is still lacking. We isolated a rice (Oryza sativa) mutant, termed albino leaf 2 (al2), using genetic screening. Phenotypic analysis revealed that the al2 mutation caused obvious albino leaves at the early developmental stage, eventually leading to al2 seedling death. Electron microscopy investigations indicated that the chloroplast structure was disrupted in the al2 mutants at an early developmental stage and subsequently resulted in the breakdown of the entire chloroplast. Molecular cloning illustrated that AL2 encodes a chloroplast group IIA intron splicing facilitator (CRS1) in rice, which was confirmed by a genetic complementation experiment. Moreover, our results demonstrated that AL2 was constitutively expressed in various tissues, including green and non-green tissues. Interestingly, we found that the expression levels of a subset of chloroplast genes that contain group IIA and IIB introns were significantly reduced in the al2 mutant compared to that in the wild type, suggesting that AL2 is a functional CRS1 in rice. Differing from the orthologous CRS1 in maize and Arabidopsis that only regulates splicing of the chloroplast group II intron, our results demonstrated that the AL2 gene is also likely to be involved in the splicing of the chloroplast group I intron. They also showed that disruption of AL2 results in the altered expression of chloroplast-associated genes, including chlorophyll biosynthetic genes, plastid-encoded polymerases and nuclear-encoded chloroplast genes. Taken together, these findings shed new light on the function of nuclear-encoded chloroplast group I and II intron splicing factors in rice.

Coupling between alternative polyadenylation and alternative splicing is limited to terminal introns.

Alternative polyadenylation has been implicated as an important regulator of gene expression. In some cases, alternative polyadenylation is known to couple with alternative splicing to influence last intron removal. However, it is unknown whether alternative polyadenylation events influence alternative splicing decisions at upstream exons. Knockdown of the polyadenylation factors CFIm25 or CstF64 in HeLa cells was used as an approach in identifying alternative polyadenylation and alternative splicing events on a genome-wide scale. Although hundreds of alternative splicing events were found to be differentially spliced in the knockdown of CstF64, genes associated with alternative polyadenylation did not exhibit an increased incidence of alternative splicing. These results demonstrate that the coupling between alternative polyadenylation and alternative splicing is usually limited to defining the last exon. The striking influence of CstF64 knockdown on alternative splicing can be explained through its effects on UTR selection of known splicing regulators such as hnRNP A2/B1, thereby indirectly influencing splice site selection. We conclude that changes in the expression of the polyadenylation factor CstF64 influences alternative splicing through indirect effects.

The splicing factor FUBP1 is required for the efficient splicing of oncogene MDM2 pre-mRNA.

Alternative splicing of the oncogene MDM2 is a phenomenon that occurs in cells in response to genotoxic stress and is also a hallmark of several cancer types with important implications in carcinogenesis. However, the mechanisms regulating this splicing event remain unclear. Previously, we uncovered the importance of intron 11 in MDM2 that affects the splicing of a damage-responsive MDM2 minigene. Here, we have identified discrete cis regulatory elements within intron 11 and report the binding of FUBP1 (Far Upstream element-Binding Protein 1) to these elements and the role it plays in MDM2 splicing. Best known for its oncogenic role as a transcription factor in the context of c-MYC, FUBP1 was recently described as a splicing regulator with splicing repressive functions. In the case of MDM2, we describe FUBP1 as a positive splicing regulatory factor. We observed that blocking the function of FUBP1 in in vitro splicing reactions caused a decrease in splicing efficiency of the introns of the MDM2 minigene. Moreover, knockdown of FUBP1 in cells induced the formation of MDM2-ALT1, a stress-induced splice variant of MDM2, even under normal conditions. These results indicate that FUBP1 is also a strong positive splicing regulator that facilitates efficient splicing of the MDM2 pre-mRNA by binding its introns. These findings are the first report describing the regulation of alternative splicing of MDM2 mediated by the oncogenic factor FUBP1.

Changes in exon-intron structure during vertebrate evolution affect the splicing pattern of exons.

Exon-intron architecture is one of the major features directing the splicing machinery to the short exons that are located within long flanking introns. However, the evolutionary dynamics of exon-intron architecture and its impact on splicing is largely unknown. Using a comparative genomic approach, we analyzed 17 vertebrate genomes and reconstructed the ancestral motifs of both 3' and 5' splice sites, as also the ancestral length of exons and introns. Our analyses suggest that vertebrate introns increased in length from the shortest ancestral introns to the longest primate introns. An evolutionary analysis of splice sites revealed that weak splice sites act as a restrictive force keeping introns short. In contrast, strong splice sites allow recognition of exons flanked by long introns. Reconstruction of the ancestral state suggests these phenomena were not prevalent in the vertebrate ancestor, but appeared during vertebrate evolution. By calculating evolutionary rate shifts in exons, we identified cis-acting regulatory sequences that became fixed during the transition from early vertebrates to mammals. Experimental validations performed on a selection of these hexamers confirmed their regulatory function. We additionally revealed many features of exons that can discriminate alternative from constitutive exons. These features were integrated into a machine-learning approach to predict whether an exon is alternative. Our algorithm obtains very high predictive power (AUC of 0.91), and using these predictions we have identified and successfully validated novel alternatively spliced exons. Overall, we provide novel insights regarding the evolutionary constraints acting upon exons and their recognition by the splicing machinery.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

UNLABELLED: Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE: Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.