Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 13 de 13
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Clin Genet ; 84(5): 482-8, 2013 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-22978668

RESUMEN

The 21-hydroxylase deficiency (21OHD) is caused by CYP21A2 mutations resulting in severe or moderate enzymatic impairments. 21OHD females carrying similar genotypes present different degrees of external genitalia virilization, suggesting the influence of other genetic factors. Single nucleotide variants (SNVs) in the CYP3A7 gene and in its transcription factors, related to fetal 19-carbon steroid metabolism, could modulate the genital phenotype. To evaluate the influence of the 21OHD genotypes and the CYP3A7, PXR and CAR SNVs on the genital phenotype in 21OHD females. Prader scores were evaluated in 183 patients. The CYP3A7, PXR and CAR SNVs were screened and the 21OHD genotypes were classified according to their severity: severe and moderate groups. Patients with severe genotype showed higher degree of genital virilization (Prader median III, IQR III-IV) than those with moderate genotype (III, IQR II-III) (p < 0.001). However, a great overlap was observed between genotype groups. Among all the SNVs tested, only the CAR rs2307424 variant correlated with Prader scores (r(2) = 0.253; p = 0.023). The CYP21A2 genotypes influence the severity of genital virilization in 21OHD females. We also suggest that the CAR variant, which results in a poor metabolizer phenotype, could account for a higher degree of external genitalia virilization.


Asunto(s)
Hiperplasia Suprarrenal Congénita/genética , Genitales/metabolismo , Polimorfismo de Nucleótido Simple , Receptores Citoplasmáticos y Nucleares/genética , Esteroide 21-Hidroxilasa/genética , Virilismo/genética , Hiperplasia Suprarrenal Congénita/complicaciones , Hiperplasia Suprarrenal Congénita/patología , Alelos , Hidrocarburo de Aril Hidroxilasas/genética , Niño , Preescolar , Receptor de Androstano Constitutivo , Citocromo P-450 CYP3A , Femenino , Frecuencia de los Genes , Genitales/patología , Genotipo , Humanos , Recién Nacido , Receptor X de Pregnano , Receptores de Esteroides/genética , Estudios Retrospectivos , Índice de Severidad de la Enfermedad , Virilismo/complicaciones , Virilismo/patología
2.
Horm Metab Res ; 45(4): 301-7, 2013 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-23322511

RESUMEN

There is a strong correlation between the severity of genotypes and 17OH-progesterone levels in patients with the nonclassical form of 21-hydroxylase deficiency (NC-CAH); however, there are few studies regarding the correlation with clinical signs. The aim of the study was to evaluate whether genotypes correlate with the severity of the hyperandrogenic phenotype. A cohort of 114 NC-CAH patients were diagnosed by stimulated-17OHP ≥10 ng/ml. CYP21A2 genotypes were divided into 2 groups according to the severity of enzymatic impairment; mild and severe. Clinical data and hormonal profiles were compared between the 2 groups. Age at onset of manifestations did not differ between children or adults carrying both mild and severe genotypes. Frequencies of precocious pubarche and hirsutism, with or without menstrual abnormalities, were similar between the 2 groups. There were no differences in basal testosterone levels of adult symptomatic females carrying both genotypes, but there were differences between adult females with (92.9±49.5 ng/dl) and without hirsutism (43.8±38 ng/dl) (p=0.0002). Similar frequencies of both genotypes were observed in asymptomatic females and in those with clitoromegaly. Nonclassical genotypes do not predict the severity of phenotype. Asymptomatic and virilized females carrying the same genotype suggest that there is a modulatory effect of genes involved in the androgen pathway on the phenotype.


Asunto(s)
Hiperplasia Suprarrenal Congénita/sangre , Hiperplasia Suprarrenal Congénita/genética , Genotipo , Hiperandrogenismo/sangre , Hiperandrogenismo/genética , Esteroide 21-Hidroxilasa/sangre , Esteroide 21-Hidroxilasa/genética , Adolescente , Hiperplasia Suprarrenal Congénita/complicaciones , Adulto , Edad de Inicio , Andrógenos/sangre , Niño , Preescolar , Estudios de Cohortes , Femenino , Hirsutismo/sangre , Hirsutismo/complicaciones , Hirsutismo/genética , Humanos , Hiperandrogenismo/complicaciones , Testosterona/sangre
3.
J Endocrinol Invest ; 34(8): 587-92, 2011 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-20924223

RESUMEN

INTRODUCTION: Although much is known about the increased levels of the 21-hydroxylase substrates 17-hydroxyprogesterone (17OHP) and 21-deoxycortisol (21DF) - the biochemical markers of all forms of 21-hydroxylase deficiency (21OHD), only limited information is available on the zona fasciculata (ZF) products distal to the enzymatic block: 11-deoxycortisol (S), 11-deoxycorticosterone (DOC), and corticosterone (B). OBJECTIVE: To investigate whether basal and post-ACTH levels of S, DOC, and B and the 21-hydroxylase precursor-to-product ratios determined by tandem mass spectrometry preceded by high-performance liquid chromatography separation (liquid chromatography-tandem mass spectrometry) could disclose distinct profiles in genotypically confirmed classic (no.=14) and non-classic (NC) (no.=18) patients, heterozygote carriers (no.=61) and wildtypes (WT) (no.=27) for 21OHD. RESULTS: Salt wasting (SW) and simple virilizing (SV) had higher basal levels of DOC with no further increase in response to ACTH. Stimulated DOC was similar in 21OHD patients and carriers but was reduced as compared to WT. ACTH-stimulated B increased gradually from SW and SV through WT. The post-ACTH 21DF/B ratio was able to detect 92% of the carriers among WT. All NC patients could be detected by post-ACTH 17OHP/DOC and 21DF/B, with no overlap with 21OHD carriers. CONCLUSION: Although 21-hydroxylase is a key enzymatic step in both 17-hydroxy and 17-deoxy pathways of ZF, the reaction is mostly affected in the latter pathway, leading to a significant impairment of B production, which may further characterize the 21OHD subtypes. Also, the precursor-to-product ratios, particularly 21DF/B, can demonstrate the distinctive outline of 21OHD subtypes, including carriers and normal subjects.


Asunto(s)
17-alfa-Hidroxiprogesterona/metabolismo , Hiperplasia Suprarrenal Congénita/genética , Hiperplasia Suprarrenal Congénita/metabolismo , Cortodoxona/metabolismo , Heterocigoto , Esteroide 21-Hidroxilasa/metabolismo , Zona Fascicular/metabolismo , Hiperplasia Suprarrenal Congénita/fisiopatología , Adulto , Portador Sano , Corticosterona/metabolismo , Femenino , Humanos , Masculino , Persona de Mediana Edad , Esteroide 21-Hidroxilasa/genética , Adulto Joven , Zona Fascicular/química
4.
Clin Genet ; 76(6): 503-10, 2009 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-19930153

RESUMEN

Neonatal screening for congenital adrenal hyperplasia (CAH) is useful in diagnosing salt wasting form (SW). However, there are difficulties in interpreting positive results in asymptomatic newborns. The main objective is to analyze genotyping as a confirmatory test in children with neonatal positive results. Patients comprised 23 CAH children and 19 asymptomatic infants with persistently elevated 17-hydroxyprogesterone (17OHP) levels. CYP21A2 gene was sequenced and genotypes were grouped according to the enzymatic activity of the less severe allele: A1 null, A2 < 2%, B 3-7%, C > 20%. Twenty-one children with neonatal symptoms and/or 17OHP levels > 80 ng/ml carried A genotypes, except two virilized girls (17OHP < 50 ng/ml) without CAH genotypes. Patients carrying SW genotypes (A1, A2) and low serum sodium levels presented with neonatal 17OHP > 200 ng/ml. Three asymptomatic boys carried simple virilizing genotypes (A2 and B): in two, the symptoms began at 18 months; another two asymptomatic boys had nonclassical genotypes (C). The remaining 14 patients did not present CAH genotypes, and their 17OHP levels were normalized by 14 months of age. Molecular analysis is useful as a confirmatory test of CAH, mainly in boys. It can predict clinical course, identify false-positives and help distinguish between clinical forms of CAH.


Asunto(s)
Hiperplasia Suprarrenal Congénita/diagnóstico , Hiperplasia Suprarrenal Congénita/enzimología , Tamizaje Neonatal , Esteroide 21-Hidroxilasa/genética , 17-alfa-Hidroxiprogesterona/sangre , Hiperplasia Suprarrenal Congénita/sangre , Niño , Preescolar , Femenino , Estudios de Seguimiento , Heterocigoto , Humanos , Lactante , Recién Nacido , Masculino
5.
J Clin Endocrinol Metab ; 91(9): 3451-6, 2006 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-16822826

RESUMEN

CONTEXT: Because many women with 21-hydroxylase (21-OH)-deficient nonclassic adrenal hyperplasia (NCAH) carry at least one allele affected by a severe mutation of CYP21, they are at risk for giving birth to infants with classic adrenal hyperplasia (CAH). OBJECTIVE: Our objective was to determine the frequency of CAH and NCAH infants born to mothers with 21-OH-deficient NCAH. DESIGN AND SETTING: We conducted an international multicenter retrospective/prospective study. PATIENTS AND METHODS: The outcome of 203 pregnancies among 101 women with 21-OH-deficient NCAH was reviewed. The diagnosis of 21-OH-deficient NCAH was established by a basal or post-ACTH-stimulation 17-hydroxyprogesterone level of more than 10 ng/ml (30.3 nmol/liter). When possible, genotype analyses were performed to confirm CAH or NCAH in the offspring. RESULTS: Of the 203 pregnancies, 138 (68%) occurred before the mother's diagnosis of NCAH and 65 (32%) after the diagnosis. Spontaneous miscarriages occurred in 35 of 138 pregnancies (25.4%) before the maternal diagnosis of NCAH, and in only four of 65 pregnancies (6.2%) after the diagnosis (P < 0.002). Four (2.5%; 95% confidence interval, 0.7-6.2%) of the 162 live births were diagnosed with CAH. To date, 24 (14.8%; 95% confidence interval, 9.0-20.6%) children, 13 girls and 11 boys, have been diagnosed with NCAH. The distribution of NCAH children and their mothers varied significantly by ethnicity (P < 0.0001, for both). CONCLUSIONS: The risk of a mother with 21-OH-deficient NCAH for giving birth to a child affected with CAH is 2.5%; at least 14.8% of children born to these mothers have NCAH.


Asunto(s)
Hiperplasia Suprarrenal Congénita/genética , Esteroide 21-Hidroxilasa/genética , Hiperplasia Suprarrenal Congénita/enzimología , Hiperplasia Suprarrenal Congénita/epidemiología , Adulto , Preescolar , Femenino , Genotipo , Humanos , Lactante , Recién Nacido , Masculino , Embarazo , Prevalencia , Estudios Prospectivos , Estudios Retrospectivos
6.
J Clin Endocrinol Metab ; 83(12): 4416-9, 1998 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-9851787

RESUMEN

The aim of our study was to determine, by allele-specific PCR, the frequency of point mutations in 130 Brazilian patients with the classical and nonclassical forms of 21-hydroxylase deficiency and to correlate genotype with phenotype. The most frequent mutations were 12 splice (41.8% in salt wasting), I172N (32.6% in simple virilizing), and V281L (40.2% in late onset form). The frequency of the 9 most common point mutations was similar to that reported for other countries, except for Del 8 nt and Cluster, which were less frequent in the classical form. Rarer mutations such as P453S, G291S, I7 splice, W405X, R483P, and R483-->frameshift were rarely found or were absent. The 93 fully genotyped patients were classified into 3 mutation groups, based on the degree of enzymatic activity (group A, <2%; group B, approximately 2%, and group C, >18%). In group A, 62% of the cases presented the salt wasting form; in group B, 96% the simple virilizing form; and in group C, 88% the late onset form. We diagnosed 80% of the affected alleles after screening for large rearrangements and 15 point mutations. The absence of previously described mutations in 20% of the affected alleles suggests the presence of new mutations in our population.


Asunto(s)
Hiperplasia Suprarrenal Congénita , Hiperplasia Suprarrenal Congénita/genética , Alelos , Brasil , Estudios de Cohortes , Femenino , Frecuencia de los Genes , Genotipo , Humanos , Masculino , Fenotipo , Mutación Puntual/genética , Esteroide 21-Hidroxilasa/genética
7.
J Clin Endocrinol Metab ; 84(8): 2870-2, 1999 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-10443693

RESUMEN

A previous screening of 17 mutations in 130 Brazilian patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency did not identify mutations in 20% of the alleles. To diagnose these alleles we sequenced the entire CYP21 gene of one Mulatto patient with the simple virilizing form, who had only the R356W mutation in a heterozygous state. We identified a heterozygous G-A transition in codon 424. This mutation leads to a substitution of glycine by serine in a conserved region where glycine is conserved in at least 4 species. This novel mutation eliminates 1 of the restriction sites of the BanI enzyme, which made its screening possible for the whole series. The G424S mutation was found in a compound heterozygous state in 5 families; 4 presented the simple virilizing form, and 1 presented the nonclassical form. Interestingly, 3 of 5 families have a Mulatto origin. This mutation was not identified in 118 CYP21 alleles of normal individuals, ruling out the possibility of a polymorphism, or in 80 pseudogenes, indicating a casual mutagenic event and not a microconversion event. All patients with the G424S mutation presented CYP21P and C4A gene deletions and human leukocyte antigen DR17 on the same haplotype, suggesting a linkage disequilibrium and a probable founder effect. Search for the G424S mutation in other populations will reveal whether it is restricted to the Brazilian patients or if it has a wider ethnic distribution.


Asunto(s)
Hiperplasia Suprarrenal Congénita/genética , Mutación Missense , Esteroide 21-Hidroxilasa/genética , Femenino , Humanos , Desequilibrio de Ligamiento , Masculino , Reacción en Cadena de la Polimerasa
8.
Braz J Med Biol Res ; 33(10): 1211-6, 2000 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-11004722

RESUMEN

We determined the frequency of large rearrangements and point mutations in 130 Brazilian patients with 21-hydroxylase deficiency and correlated genotype with phenotype. The frequency of CYP21 deletions was lower (4.4%) than in most of the previous series described, whereas the frequency of large gene conversions was similar to the frequency reported in the literature (6.6%). The most frequent point mutations were I2 splice (41.8% in salt wasting - SW), I172N (32.6% in simple virilizing - SV) and V281L (40.2% in the late onset form - LO). The frequency of the nine most common point mutations was similar to that reported for other countries. The 93 fully genotyped patients were classified into 3 mutation groups based on the degree of enzymatic activity (A<2%, B approximately 2%, C>20%). In group A, 62% of cases presented the SW form; in group B, 96% the SV form, and in group C, 88% the LO form. We diagnosed 80% of the affected alleles after screening for large rearrangements and 15 point mutations. To diagnose these remaining alleles we sequenced the CYP21 gene of one patient with the SV form and identified a heterozygous G-->A transition in codon 424. This mutation leads to a substitution of glycine by serine in a conserved region and was also found in a compound heterozygous state in 4 other patients. The mutation G424S presented a linkage disequilibrium with CYP21P and C4A gene deletions and HLA DR17, suggesting a probable founder effect. Search for the G424S mutation in other populations will reveal if it is restricted to the Brazilian patients or if it has a wider ethnic distribution.


Asunto(s)
Hiperplasia Suprarrenal Congénita/genética , Alelos , Southern Blotting , Brasil , Femenino , Frecuencia de los Genes , Genes/genética , Genotipo , Humanos , Masculino , Fenotipo , Mutación Puntual , Reacción en Cadena de la Polimerasa
9.
J Pediatr Endocrinol Metab ; 15(9): 1515-23, 2002.
Artículo en Inglés | MEDLINE | ID: mdl-12503859

RESUMEN

UNLABELLED: An increase in plasma 17OHP found in infants requiring differential diagnosis between septic shock and adrenal failure led us to look for adrenal steroids pattern during infection. INFANTS AND METHODS: 56 infants, 1-6 months old, were studied during infection of different degrees of severity. Plasma cortisol, 17OHP, androstenedione, DHEA, DHEA-S and testosterone were measured. RESULTS: 24 patients showed an expected cortisol elevation. One child had a low cortisol level. The concentration of 17OHP was above 6.0 nmol/l (200 ng/dl) in 41 patients and above 30.2 nmol/l (1,000 ng/dl) in 10. Higher 17OHP levels and more severe diseases correlated positively. CONCLUSIONS: During infectious diseases some patients demonstrated not only cortisol elevation but also 17OHP as high as that observed in NC-CAH. We suggest that if 17OHP elevation is not characteristic of SL-CAH, glucocorticoid therapy should be started and an ACTH test should be performed after recovery before ruling out this pathology.


Asunto(s)
17-alfa-Hidroxiprogesterona/sangre , Glándulas Suprarrenales/metabolismo , Infecciones/metabolismo , Enfermedad Aguda , Androstenodiona/sangre , Sulfato de Deshidroepiandrosterona/sangre , Femenino , Humanos , Hidrocortisona/sangre , Sistema Hipotálamo-Hipofisario/fisiología , Lactante , Masculino , Testosterona/sangre
10.
J Pediatr Endocrinol Metab ; 14(4): 415-9, 2001 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-11327375

RESUMEN

Adrenal nodules have been described in patients with 21-hydroxylase deficiency (21OHD). These nodules are usually considered to be ACTH-dependent, as is the commonly seen diffuse cortical hyperplasia. We evaluated the presence and behavior of adrenal nodules in patients with 21OHD. Based upon hormonal status and treatment compliance, the patients were classified into three categories: poor, regular and good control. Out of the 26 patients, eight had the non-classic, four salt-wasting and 14 simple virilizing forms. All patients underwent initial adrenal morphological studies, either by CT or MRI. Those with nodules were reevaluated after 12 months of adequate replacement therapy. Nodules were found in four of eight untreated patients and two of three patients with poor hormonal control, but not in the 15 patients with regular or good control. Adrenal nodules in these six patients demonstrated a considerable size reduction and even disappearance after adequate replacement therapy, showing that these nodules were ACTH-dependent. Thus, six out of 26 patients with 21OHD presented adrenal nodules, which were more frequent in the untreated or poorly-controlled patients, and all regressed in size after adequate therapy.


Asunto(s)
Glándulas Suprarrenales/patología , Hiperplasia Suprarrenal Congénita , Hiperplasia Suprarrenal Congénita/patología , Glucocorticoides/administración & dosificación , Adolescente , Hiperplasia Suprarrenal Congénita/tratamiento farmacológico , Hormona Adrenocorticotrópica/farmacología , Adulto , Niño , Preescolar , Cortisona/administración & dosificación , Cortisona/análogos & derivados , Cortisona/uso terapéutico , Dexametasona/administración & dosificación , Dexametasona/uso terapéutico , Femenino , Glucocorticoides/uso terapéutico , Humanos , Imagen por Resonancia Magnética , Masculino , Persona de Mediana Edad , Tomografía Computarizada por Rayos X
11.
Clin Endocrinol (Oxf) ; 52(5): 601-7, 2000 May.
Artículo en Inglés | MEDLINE | ID: mdl-10792340

RESUMEN

OBJECTIVE: The diagnosis of the nonclassical form of 21-hydroxylase (NC-21OH) deficiency, established before molecular studies, is based on basal 17OH-progesterone (17OH-P) values > 15 nmol/l or ACTH-stimulated 17OH-P values > 30 nmol/l. This disease is caused by mutations in the structural gene that can be grouped into three categories: A, B and C, according to the predicted level of enzymatic activity. So, the genotype of the nonclassical form is a combination of mutations that cause moderate impairment of enzymatic activity in one allele and mutations which cause total (A), severe (B: 3%) or moderate (C: 20-60%) impairment of enzymatic activity in the other allele. DESIGN: We analysed the influence of the different genotypes on 17OH-P levels in 58 patients with the nonclassical form of 21OH deficiency. RESULTS: After screening for 18 mutations through Southern blotting, allele-specific polymerase chain reaction (PCR) and enzyme restriction, mutations were identified in 73% of the alleles. Patients with mutations identified in both alleles were divided into groups A/C (n = 18), B/C (n = 3) and C/C (n = 15). The basal and ACTH-stimulated 17OH-P levels in patients with A/C genotype ranged from 1.2 to 153 and 72-363 nmol/l, and in C/C genotype ranged from 0.9 to 72 and 51-363 nmol/l, respectively (P < 0.05 for stimulated levels). The lowest value of ACTH-stimulated 17OH-P levels in fully genotyped patients was 51 nmol/l. Patients with the A/C genotype presented androgen excess symptoms earlier than patients with the C/C genotype. CONCLUSIONS: These data suggest an influence of genotype on phenotype and on 17OH-P levels. The high frequency of unidentified mutant alleles in nonclassical 21-hydroxylase deficiency suggests that ACTH-stimulated values of 17OH-P between 30 and 51 nmol/l have overestimated this diagnosis. Genotyping more patients with nonclassical 21-hydroxylase deficiency will help to redefine the cut-off value for ACTH-stimulated 17OH-P for correct diagnosis of this disease.


Asunto(s)
17-alfa-Hidroxiprogesterona/sangre , Hiperplasia Suprarrenal Congénita/sangre , Hiperplasia Suprarrenal Congénita/genética , Esteroide 21-Hidroxilasa/genética , Adolescente , Hiperplasia Suprarrenal Congénita/diagnóstico , Hormona Adrenocorticotrópica , Adulto , Alelos , Niño , Preescolar , Femenino , Genotipo , Humanos , Hidrocortisona/sangre , Masculino , Persona de Mediana Edad , Mutación , Estadísticas no Paramétricas
12.
Artículo en Inglés | MEDLINE | ID: mdl-9699359

RESUMEN

Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.


Asunto(s)
Muestra de la Vellosidad Coriónica , ADN/análisis , Amplificación de Genes , Reacción en Cadena de la Polimerasa , Diagnóstico Prenatal , Análisis para Determinación del Sexo/métodos , ADN/genética , Femenino , Humanos , Cariotipificación , Masculino , Factores de Tiempo , Cromosoma Y/genética
13.
Hum Hered ; 49(1): 9-14, 1999 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-10189236

RESUMEN

The frequency of large mutations was determined in 131 Brazilian patients with different clinical forms of 21-hydroxylase deficiency, belonging to 116 families. DNA samples were examined by Southern blotting hybridization with genomic CYP21 and C4cDNA probes after Taql and Bg/II restriction. Large gene conversions were found in 6.6% and CYP21B deletions in 4.4% of the alleles. The breakpoint in these hybrid genes occurred after exon 3 in 92% of the alleles. All rearrangements involving CYP21B gene occurred in the heterozygous form, except in a patient with simple virilizing form who presented homozygous CYP21B deletion. Our data showed that in these Brazilian patients, CYP21B deletions were less frequent than in most of the large series previously reported.


Asunto(s)
Hiperplasia Suprarrenal Congénita/genética , Eliminación de Gen , Esteroide 21-Hidroxilasa/genética , Hiperplasia Suprarrenal Congénita/enzimología , Adulto , Alelos , Southern Blotting , Brasil , Niño , Femenino , Humanos , Masculino , Mutación , Reacción en Cadena de la Polimerasa/métodos , Mapeo Restrictivo
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA