Effect of Cryopreservation on Semen Quality Parameters in Relation to Lipid Peroxidation and Antioxidant Profile in Indian Buffalo.

BACKGROUND: Lipid peroxidation (LPO) due to oxidative stress leads to structural and functional changes in spermatozoa. OBJECTIVE: To evaluate any association of various seminal characteristics at the pre- and post-cryopreservation stages with LPO and total antioxidant capacity (TAC) in Murrah buffalo semen samples. MATERIALS AND METHODS: Sixty-five ejaculates from seven bulls were processed for cryopreservation in liquid nitrogen. RESULTS: Only 31 (47.7%) samples were found satisfactory for inclusion in the further artificial insemination. A strong negative correlation was observed between LPO and individual progressive motility, TAC, viability, plasma membrane integrity as well as acrosome integrity of fresh spermatozoa. At the post-thaw stage, post-thaw motility, viability, plasma membrane integrity and acrosome integrity had strong positive correlation with TAC. CONCLUSION: The effort to minimize LPO and enhance TAC shall play a pivotal role in improving buffalo semen quality upon cryopreservation.

Epidemiology and whole genome sequencing of an ongoing point-source Salmonella Agona outbreak associated with sushi consumption in western Sydney, Australia 2015.

During May 2015, an increase in Salmonella Agona cases was reported from western Sydney, Australia. We examine the public health actions used to investigate and control this increase. A descriptive case-series investigation was conducted. Six outbreak cases were identified; all had consumed cooked tuna sushi rolls purchased within a western Sydney shopping complex. Onset of illness for outbreak cases occurred between 7 April and 24 May 2015. Salmonella was isolated from food samples collected from the implicated premise and a prohibition order issued. No further cases were identified following this action. Whole genome sequence (WGS) analysis was performed on isolates recovered during this investigation, with additional S. Agona isolates from sporadic-clinical cases and routine food sampling in New South Wales, January to July 2015. Clinical isolates of outbreak cases were indistinguishable from food isolates collected from the implicated sushi outlet. Five additional clinical isolates not originally considered to be linked to the outbreak were genomically similar to outbreak isolates, indicating the point-source contamination may have started before routine surveillance identified an increase. This investigation demonstrated the value of genomics-guided public health action, where near real-time WGS enhanced the resolution of the epidemiological investigation.

Expression dynamics of HSP90 and nitric oxide synthase (NOS) isoforms during heat stress acclimation in Tharparkar cattle.

Six male Tharparkar cattle of 2-3 years old were selected for the study. After 15-day acclimation at thermoneutral zone (TNZ) in psychrometric chamber, animals were exposed at 42 °C for 6 h up to 23 days followed by 12 days of recovery period. Blood samples were collected during control period at TNZ (days 1, 5, and 12), after heat stress exposure (day 1, immediate heat stress acclimation (IHSA); days 2 to 10, short-term heat stress acclimation (STHSA); days 15 to 23, long-term heat stress acclimation (LTHSA); days 7 and 12, recovery period), and peripheral blood mononuclear cells (PBMCs) were isolated for RNA and protein extraction. The messenger RNA (mRNA) and protein expression in PBMCs were determined by qPCR and western blot, respectively. Samples at TNZ were taken as control. The mRNA expression of HSP90, iNOS, and eNOS was significantly upregulated (P < 0.05) on day 1 (ISHA) as compared to control, remained consistent during STHSA, again increased during LTHSA, and finally reduced to basal level during recovery period. The protein expression of HSP90, iNOS, and eNOS were akin to their transcript pattern. PBMC culture study was conducted to study transcriptional abundance of HSP90, iNOS, and eNOS at different temperature-time combinations. The present findings indicate that HSP90, iNOS, and eNOS could possibly play an important role in mitigating thermal insults and confer thermotolerance during long-term heat stress exposure in Tharparkar cattle.

Expression dynamics of HSP70 during chronic heat stress in Tharparkar cattle.

Six male Tharparkar cattle aged 2-3 years were selected for the study. The animals were acclimatized in the psychrometric chamber at thermoneutral zone (TNZ) for 15 days and then exposed to 42 °C temperature up to 23 days followed by 12 days of recovery period. Physiological responses were estimated, and peripheral blood mononuclear cells (PBMCs) were isolated at TNZ on day 1, day 5, and day 12; after 6 h of heat stress exposure on day 16 to day 20, day 25, day 30, day 32, day 34, day 36, and day 38; and a recovery period on day 45 and day 50. The PBMCs were cultured to study the effect of thermal challenge on HSP70 messenger RNA (mRNA) expression pattern at different temperature-time combinations. The mRNA and protein expression of HSP70 in PBMCs along with serum extracellular HSP70 (eHSP70) was increased (P < 0.05) and showed two peaks on day 17 and day 32 (2nd and 17th days of thermal challenge, respectively). The HSP70 mRNA expression was increased (P < 0.05) in a temperature- and time-dependent manner in heat stress challenge treatment as compared to control in cultured PBMCs. HSP70 expression was found to be higher (P < 0.05) after 10 days of heat exposure (corresponds to chronic heat stress) as compared to the first 5 days of heat stress (corresponds to short-term heat stress) and control period at TNZ. The present findings indicate that HSP70 is possibly involved in heat stress adaptive response in Tharparkar cattle and the biphasic expression pattern may be providing a second window of protection during chronic heat stress.

Expression analysis of Toll like receptors and interleukins in Tharparkar cattle during acclimation to heat stress exposure.

Six male Tharparkar cattle of 2-3 years old were selected for the study. After 15 days acclimation at thermo neutral zone (TNZ) in psychrometric chamber, animals were exposed at 42°C for 6h up to 23 days followed by 12 days of recovery period. Blood samples were collected during control period at TNZ (day 1, 5 and 12), after heat stress exposure (day 1-10, Short Term Heat Stress Acclimation - STHSA; day 15-23, Long Term Heat Stress Acclimation - LTHSA) and recovery period (day 7 and 12) and peripheral blood mononuclear cells (PBMCs) were isolated for RNA and protein extraction. Serum cortisol concentration was assessed by RIA. The mRNA and protein expression in PBMCs were determined by qPCR and western blot respectively. Samples at TNZ were taken as control. Serum cortisol concentration was increased (P<0.05) during STHSA and gradually declined during LTHSA. Toll like receptor 2 (TLR 2) expression was up regulated (P<0.05) during STHSA and declined to basal level during LTHSA and recovery phase. However, toll like receptor 4 (TLR 4) expression was up regulated (P<0.05) during STHSA and LTHSA while declined in recovery phase. Interleukin 2 (IL2) and interleukin 6 (IL 6) were up regulated (P<0.05) during STHSA and reduced to basal level during LTHSA. PBMCs culture study was conducted to study transcriptional abundance of TLR2/4 and IL2/6 at different temperature-time combinations. The present findings indicate that TLR 2/4 and IL 2/6 could possibly play a vital role in thermo tolerance in Tharparkar cattle during short term and long term heat stress exposure.

Effects of low-density lipoproteins as additive on quality parameters and oxidative stress following cryopreservation of mithun (Bos frontalis) spermatozoa.

Artificial breeding of mithun poses several challenges including lack of standard protocol for cryopreservation of spermatozoa. This is further complicated by harmful effects of hen's egg yolk (EY) as additive in extender. Purified low-density lipoproteins (LDL) extracted from EY have been shown as beneficial over EY extender for long-term semen storage in several species. This investigation explored use of LDL versus EY on semen quality and oxidative stress following freezing-thawing of spermatozoa. A total of 25 of 50 ejaculates based on biophysical parameters were selected for the experiment. After diluting with the Tris-citrate-glycerol (TCG) extender, each sample was split into three equal aliquots: Group I, control, EY; Group II and Group III contained 8% and 10% purified LDL, respectively. Frozen-thawed samples were evaluated for motility parameters (progressive, and in the bovine cervical mucus penetration test [BCMPT]), viability, sperm and nuclear abnormality, acrosome integrity, and enzymatic (leakage of intracellular contents) and biochemical (oxidative stress) profiles and in vitro fertility (IVF) assay. Study revealed a significant (p < .05) improvement in viability, sperm and nuclear abnormality, acrosome integrity, motility (progressive and in cervical mucus), cholesterol content, and reduction in the leakage of intracellular enzymes in Group II. Moreover, intactness of acrosome and biochemical membranes was protected significantly (p < .05) in addition to significant (p < .05) improvement in binding per cent and binding index in IVF assay in extender containing 8% LDL. These results demonstrate that although cryopreservation of mithun's spermatozoa in EY was comparable with other species, addition of 8% LDL holds a clear advantage over EY or 10% LDL.

A BODIPY-luminol chemiluminescent resonance energy-transfer (CRET) cassette for imaging of cellular superoxide.

Spectroscopic and in cellulo studies are here reported on the very first BODIPY-luminol chemiluminescent resonance energy-transfer (CRET) cassette where the luminol CL agent is covalently linked to the BODIPY energy-transfer acceptor in a molecular dyad. The efficiency of intramolecular CRET investigated for the BODIPY-luminol dyad was found to be 64% resulting in a dual emissive response. Successful in cellulo biochemiluminescence via CRET was achieved in PMA activated splenocytes.

Exploration of 2, 4-diaminopyrimidine and 2, 4-diamino-s-triazine derivatives as potential antifilarial agents.

In view of the mandate from the World Health Organization (WHO) for developing novel drug candidates against human lymphatic filariasis, dihydrofolate reductase (DHFR) inhibitors are explored as potential antifilarial agents. The in vitro biological evaluation of an in-house library of 12 diverse antifolate compounds with 2,4-diaminopyrimidine and 2,4-diamino-s-triazine structural features against Brugia malayi is reported. To confirm the DHFR inhibitory potential of these compounds, reversal studies using folic acid and folinic acid were undertaken. Inhibition of DHFR can induce apoptosis; in this light, preliminary evidence of apoptosis by test compounds was detected using ethidium bromide-acridine orange staining and the poly(adenosine diphosphate-ribose) polymerase (PARP) inhibition assay. Among the evaluated compounds, 3 showed significant activity against both microfilariae and adult worms. The effects of 2 of these compounds were mostly reversed by folic acid, validating DHFR inhibitory activity. Partial reversal of the effect of 2 compounds by folinic acid and non-reversal of the effect of the third compound both by folic and folinic acids are discussed. This study opens new avenues for the discovery of lead molecules by exploiting the folate pathway against one of the major neglected tropical diseases, filariasis.

Expression and localization of vascular endothelial growth factor and its receptors in the corpus luteum during oestrous cycle in water buffaloes (Bubalus bubalis).

The aim of this study was to document the expression and localization of VEGF system comprising of VEGF isoforms (VEGF 120, VEGF 164 and VEGF 188) and their receptors (VEGFR1 and VEGFR2) in buffalo corpus luteum (CL) obtained from different stages of the oestrous cycle. Real-time RT-PCR (qPCR), Western blot and immunohistochemistry were applied to investigate mRNA expression, protein expression and localization of examined factors. In general, all the components of VEGF system (the VEGF isoforms and their receptors) were found in the water buffalo CL during the oestrous cycle. The mRNA as well as protein expression of VEGF system was highest during the early and mid-luteal phase, which later steadily decreased (p < 0.05) after day 10 to reach the lowest level in regressed CL. As demonstrated by immunohistochemistry, VEGF protein was localized predominantly in luteal cells; however, VEGFR1 and VEGFR2 were localized in luteal cells as well as in endothelial cells. In conclusion, the dynamics of expression and localization of VEGF system in buffalo corpora lutea during the luteal phase were demonstrated in this study, indicating the possible role of VEGF system in the regulation of luteal angiogenesis and proliferation of luteal as well as endothelial cells through their non-angiogenic function.

First Report of Iris yellow spot virus Infecting Onion in Pakistan.

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

Use of human urine in phytoplankton production as a tool for ecological sanitation.

Measurements of primary productivity of phytoplankton and enumeration of the counts of coliform and heterotrophic bacteria (HB) were made in the water of 12 experimental tanks used for 3 treatments and control in triplicate as follows: (a) fresh human urine (0.02%), (b) stored human urine (0.02%), (c) mixed urine of fresh and stored human urine (0.02%) and (d) control without input of urine. The gross primary productivity of phytoplankton was highest in the stored urine treated tanks (508 mg C m(-2) h(-1)) followed by fresh urine (353 mg C m(-2) h(-1)), mixed urine (303 mg C m(-2) h(-1)) and control (215 mg C m(-2) h(-1)). Similar was the response of net primary production of phytoplankton. The mean count of HB observed in stored urine fed tanks was significantly higher (59-184%) than the remaining urine fed treatments. The mean count of Escherichia coli did not differ from urine treated tanks to control implying the good quality of water. The concentration of dissolved oxygen of water (7.6 to 12.8 mg L(-1)) in these tanks remained satisfactory for aquaculture. The mean concentration of ammonium-N observed in fresh urine treated tanks was more than 10 times higher than the remaining treatments employed. In contrast, the level of phosphate and electrical conductivity in the stored urine treated tanks were significantly higher than the remaining treatments. It is proposed that stored urine with a significantly reduced load of E. coli might be an effective low cost liquid fertilizer for algal biomass production.

Susceptibility of Onion Relatives (Allium spp.) to Iris yellow spot virus.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is becoming an increasingly important constraint to the production of bulb and seed onions (Allium cepa L.) in many onion-growing regions of the continental United States and the world (4). During an evaluation of onion germplasm for susceptibility to IYSV, six other Allium species (A. altaicum, A. galanthum, A. roylei, A. schoenoprasum, A. tuberosum, and A. vavilovii) were also evaluated under natural field conditions. In July 2010, symptoms suggestive of IYSV infection (straw-colored necrotic lesions) were observed on leaves of these Allium spp. in experimental plots in Las Cruces, NM. IYSV was detected in symptomatic leaves of A. altaicum, A. vavilovii, A. tuberosum, A. schoenoprasum and A. roylei with a commercially available ELISA kit (Agdia Inc., Elkhart, IN). IYSV infection was confirmed by reverse transcription (RT)-PCR with forward and complementary primers 5'-CTCTTAAACACATTTAACAAGCAC-3' and 5'-TAAAACAAACATTCAAACAA-3' flanking the nucleocapsid (N) gene encoded by the small RNA of IYSV as previously described (1,3). Amplicons, approximately 1.1 kb long, were obtained from all symptomatic Allium spp. samples but not from healthy samples or water controls. Sequencing of selected amplicons confirmed IYSV infection. The highest nucleotide identity of 98% was shared with IYSV isolates from Japan (GenBank Accession No. AB180921). A. altaicum, A. vavilovii, and A. pskemense were previously reported from Washington to be susceptible to IYSV (2). Current findings expand the list of Allium spp. that are susceptible to IYSV and underscores the need for continued screening of other members of the genus to find sources of resistance to IYSV. References: (1) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (2) H. R. Pappu et al. Plant Dis. 90:378, 2006. (3) H. R. Pappu et al. Plant Dis. 92:588, 2008. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

Expression and functional role of IGFs during early pregnancy in placenta of water buffalo.

Adequate vascularisation is a key factor for successful fetal development. We hypothesized that Insulin-Like Growth Factor (IGF) family members regulate angiogenesis along with promoting fetal development and growth. In this experiment, we determined the expression and functional role of IGF family in placental compartments (caruncle; CAR, cotyledon; COT) during different stages of early pregnancy in the water buffalo (Bubalus bubalis). Samples were collected from early pregnancy 1 (EP1, 28-45 days), early pregnancy 2 (EP2, 45-90 days), and third stage of estrous cycle (11-16 days), which was taken as control. In addition, the role of IGF1 on mRNA expression of vWF, StAR, CYP11A1, 3ßHSD, PCNA, and BAX were elucidated in cultured trophoblast cells (TCC) obtained from EP2. Quantitative real-time PCR (q-PCR), westernblot, and immunohistochemistry were done to investigate the gene expression, protein expression, and localization of examined factors, and RIA was also done to assess progesterone (P4) concentration. Expression of IGFs, its receptors and binding proteins were found to be significantly higher (p < 0.05) in both CAR and COT as compared to control during early pregnancy, except binding proteins IGFBP1, 3 and 4 which were significantly (p < 0.05) downregulated in COT with advancement of pregnancy. mRNA expression was consistent with the findings of immunoblotting and immunolocalization experiments. Trophoblasts cell culture (TCC) study showed a significant time and dose-dependent effect of IGF1 onsteroidogenic transcript, which was found to be maximum at 100 ng/ml that paralleled with P4 accretion in the media (p < 0.05). Further, IGF1 upregulated the transcripts of vWF, PCNA, and downregulated BAX at the same concentration (p < 0.05). Overall, our results demonstrated that the expression of IGFs is a site-specific phenomenon in placentome, which indicates autocrine/paracrine and endocrine function. Our in-vitro finding support that IGF1 plays a critical role in placental development by promoting angiogenesis, steroid synthesis, and cell proliferation during early pregnancy.

Expression and functional role of fibroblast growth factors (FGF) in placenta during different stages of pregnancy in water buffalo (Bubalus bubalis).

The present study documented the expression and functional role of Fibroblast growth factors (FGFs) family and their receptors (Fibroblast growth factor receptor, FGFRs) in placenta (Cotyledon; COT, Caruncle; CAR) during different stages of pregnancy in water buffalo. Samples were collected from Early pregnancy 1 (EP1); Early pregnancy 2 (EP2); Mid pregnancy (MP) and Late pregnancy (LP) while diestrus stage of oestrus cycle (NP) was taken as control. In addition, modulatory role of FGF2 on mRNA expression of von Willebrand factor (vWF), Proliferating cell nuclear antigen (PCNA), steroidogenic acute regulatory protein (StAR), cytochrome P450 cholesterol side-chain cleavage (CYP11A1), 3ß-hydroxysteroid dehydrogenase (3ßHSD) and BCL2 Associated X (BAX) were studied in cultured trophoblast cells (TCC), obtained from EP2. Real-time PCR (qPCR), Western blot, and immunohistochemistry were applied to investigate mRNA and protein expressions, and the localization of examined factors whereas, P4 secretion was assessed by RIA. The mRNA and protein expression of FGFs and its receptors were maximum (P < 0.05) during EP (EP1 and EP2) in COT. However, FGFR1 and FGFR4 were upregulated (P < 0.05) during EP2 and MP in COT. Similarly, the mRNA and protein expression of FGFs and its receptors were upregulated (P < 0.05) during all stages of pregnancy in CAR. FGF family members were localized in the cytoplasm of trophoblast cells as well as in fetal blood vessels. At 100 ng/ml dosage, FGF2 stimulated the transcript of vWF maximally (P < 0.05). P4 secretion in trophoblast cells treated with FGF2 was maximum with the highest dose at 72 h. These findings corroborate that FGF acts locally in the trophoblast cells to modulate steroid hormone viz. progesterone synthesis, promote angiogenesis and favors cell survivability indicating that this factor may play an essential role in the regulation of placental formation and function in buffalo.

Nucleotide sequence and genome organization of the medium RNA of Iris yellow spot virus from the United States.

Iris yellow spot tospovirus (IYSV) of the family Bunyaviridae causes a serious disease in onion in the USA and other parts of the world. Inspite of its economic importance, the complete genomic sequence of IYSV from the USA is not available. The genome structure and organization of the medium (M) RNA of a Washington (WA) isolate of IYSV were determined and compared to the corresponding region of two isolates previously described from Brazil and The Netherlands. Sequence analysis showed that the M-RNA was 4,817 nucleotides long and potentially coded for the movement protein (NSm) in the viral sense and the glycoprotein precursor (Gn and Gc) in the viral complementary sense. The predicted sizes of NSm and Gn/Gc precursor were 34.7 and 128.84 kDa, respectively. The two open reading frames are separated by a 380 nucleotide intergenic region. Phylogenetic analysis of the NSm and Gn/Gc genes from the WA isolate showed grouping that reflected their respective serogroups. The WA isolate formed a close cluster with the two previously reported IYSV isolates and the IYSV cluster was distinguishable from other tospovirus species. This is the first report of complete genomic sequence of the M-RNA of IYSV from the US.

First Report of Natural Infection of Garlic with Iris yellow spot virus in the United States.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to onion bulb and seed production in several onion-growing regions of the United States (1,3). While garlic (Allium sativum) was reported to be infected with IYSV in Réunion Island (4), there have been no confirmed reports of natural infection of garlic in the United States. Garlic plants showing near-diamond-shaped lesions were found in August of 2008 in Marion County, Oregon. The 0.4046-ha (1-acre) field plot consisted of various true-seeded garlic varieties and was adjacent to three onion fields that showed IYSV symptoms. Symptoms were observed on 5% of the garlic plants with most of the symptomatic plants displaying small and diffuse straw-colored spots. Seven of these symptomatic plants were selected for testing. Of these, two showed characteristic diamond-shaped, elongated, straw-colored lesions on garlic scapes. However, the lesions were more diffuse with less-defined edges compared with the characteristic diamond-shaped lesions that are often associated with IYSV infection (1). All symptomatic plants were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). To verify IYSV infection, total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV by reverse transcription (RT)-PCR with primers 5'-TAAAACAAACATTCAAACAA-3' and 5'-CTCTTAAACACATTTAACAAGCAC-3', which flank the nucleocapsid (N) gene coded by the small RNA of IYSV (2). An approximate 1.1-kb amplicon was obtained from all symptomatic plants and cloned and sequenced. Nucleotide sequence comparisons using BLAST showed that a consensus of three clones derived from the amplicon from garlic (No. FJ514257) was 85 to 99% identical with IYSV sequences available in GenBank (Nos. AF001387, AB180918, and AB286063), confirming the identity of IYSV. To our knowledge, this is the first report of natural infection of IYSV infection of garlic in the United States. Additional surveys and testing are needed to obtain a better understanding of IYSV incidence in garlic to evaluate its impact on garlic production. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Iris yellow spot virus in Onion in Nevada and Northern California.

The disease caused by thrips-transmitted Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) has become a major constraint to bulb and seed onion crops in several parts of the country and the world (1,3). As part of an ongoing survey for IYSV incidence in onion in the western United States, commercial fields in Lyon County, Nevada and several commercial fields in the northern Californian counties of Colusa, San Benito, Sutter, and Yolo were surveyed during the summer of 2008. Symptomatic plants were found widespread in northern California, especially in seed-production fields. In Lyon County, NV, symptoms were observed only on volunteer onions in one commercial field. Symptoms on leaves and scapes included characteristic diamond-shaped lesions with or without green islands. Four samples from Nevada and fourteen from northern California were tested by double-antibody sandwich (DAS)-ELISA using a commercially available kit (Agdia Inc., Elkhart, IN). All tested samples were found positive in ELISA. IYSV infection was verified by reverse transcription (RT)-PCR. Total nucleic acids were prepared from symptomatic tissue, and primers specific to the small (S) RNA of IYSV were used to amplify an approximate 1.2-kb region of the S-RNA. This region included the complete nucleoprotein (N) gene (2). The amplicons from one sample each from Nevada and northern California were sequenced (GenBank Accession Nos. FJ713699 and FJ713700, respectively). Sequence analysis showed that the amplicons contained a single open reading frame of 822 bp, coding for a 273-amino acid N protein, and the gene shared 96 to 98% identity with known IYSV N gene sequences. To our knowledge, this is the first report of IYSV in onion in Nevada. In California, outbreaks of IYSV had been reported earlier in Imperial Valley and Antelope Valley in southern California (4), and the disease has been increasing in incidence in bulb and seed crops in northern California, as well. California and Nevada are major onion-producing states in the United States and regular surveys to determine the incidence and impact on yield are needed to develop an integrated disease management program. References: (1) D. H. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu and M. E. Matheron. Online publication. doi:10.1094/PHP-2008-0711-01-BR. Plant Health Progress, 2008. (4) G. J. Poole et al. Online publication. doi:10.1094/PHP-2007-0508-01-BR. Plant Health Progress, 2007.

Natural Infection of Iris yellow spot virus in Twoscale Saltbush (Atriplex micrantha) Growing in Utah.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) continues to be an economically important pathogen affecting onion bulb and seed production in several parts of the world and the United States (1). Several weeds were reported naturally infected with IYSV (1,2,4). Leaves of Atriplex micrantha Ledeb. (synonym A. heterosperma Bunge) were collected from naturally occurring plants in a weed trial conducted in commercial onions grown in Box Elder County, UT on 24 September 2008. Leaves displayed a range of symptoms including spotting, chlorosis, and necrosis. Symptomatic leaves were preferentially selected for subsequent diagnostic analyses. Samples were positive for IYSV when tested by double-antibody sandwich-ELISA using a commercially available kit (Agdia Inc., Elkhart, IN). For further confirmation, total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV by reverse transcription-PCR with primers specific to the nucleocapsid (N) gene coded by the small (S)-RNA of IYSV. The forward and reverse primer pair, 5'-TCAGAAATCGAGAAACTT-3' and 5'-CACCAATGTCTTCAACAATCTT-3', respectively, amplifies a 751-nt fragment of the N gene (3). An amplicon of expected size was obtained, cloned, and sequenced. The nucleotide sequence analysis and comparison with known IYSV S-RNA sequences showed that the sequence of the amplicon from A. micrantha (GenBank Accession No. FJ493541) shared more than 84% nt sequence identity with the corresponding region of IYSV isolates available in GenBank, confirming the IYSV infection of the new host weed. The highest sequence identity (98%) was with an IYSV isolate from Jefferson County, OR (GenBank Accession No. DQ233479). To our knowledge, this is the first report of IYSV infection of A. micrantha under natural conditions. The role of A. micrantha and other weeds in IYSV epidemiology needs further investigation. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) C. Nischwitz et al. Plant Dis. 91:1518, 2007. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) R. Sampangi et al. Plant Dis. 91:1683, 2007.

Green Foxtail (Setaria viridis), A Naturally Infected Grass Host of Iris yellow spot virus in Utah.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is a serious virus pathogen in onion bulb and seed crops in the United States and several parts of the world (1). The virus is exclusively transmitted by onion thrips (Thrips tabaci). Besides onion and other susceptible crops such as garlic, leek, chives, and several ornamentals, weeds could be serving as potential reservoir sources of virus inoculum. There are reports of several weeds found naturally infected with IYSV (1,2,4). However, there is no report of IYSV infection of a grass species. Leaves of green foxtail (Setaria viridis (L.) Beauv.) were collected from two naturally occurring plants approximately 30 m apart in a weed trial conducted in commercial onions grown in Box Elder County, UT on 24 September 2008. Notes of IYSV symptoms on green foxtail were made only on the two grass plants sampled. Density of green foxtail in the weed trial was low and was not recorded. Leaves on both plants displayed a range of symptoms that included streaking, purpling, and chlorotic and necrotic lesions along leaf margins oriented along the axis of longitudinal venation. Samples were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). ELISA values of the grass samples were 2.64 and 2.23 for each plant sampled. Negative and positive control readings were 0.24 and 4.33, respectively. All absorbance readings were made at 405 nm. To provide a contrast of the grass data in context to the onion field where the weed trial was located, final visual assessments of onions in the field were made on 4 September 2009. Approximately 300 onion plants were assessed for incidence and severity of disease. Incidence of the disease among onions was 100% and the severity of iris yellow spot on leaves was 20 lesions per leaf. The average ELISA value over 30 individual onions arbitrarily sampled from the field on the same day was 3.50, and the ELISA values among the samples ranged from 1.37 to 4.38. The negative and positive controls were 0.19 and 4.40, respectively. To further verify the presence of IYSV in the grass specimen, reverse transcription-PCR was performed on total nucleic acid extracts obtained from the symptomatic parts of the leaves. Primers specific to the nucleocapsid (N) gene coded by the small (S)-RNA of IYSV were used (3). The forward and reverse primer pairs, 5'-TCAGAAATCGAGAAACTT-3' and 5'-CACCAATGTCTTCAACAATCTT-3', respectively, amplify a 751-nt fragment of the N gene (3). An amplicon of expected size was obtained, cloned, and sequenced. The nucleotide sequence analysis and comparison with known IYSV S-RNA sequences showed that the amplicon from foxtail (GenBank Accession No. FJ652594) samples had the highest nucleotide sequence identity (98%) with the corresponding region of an IYSV isolate from Jefferson County, OR (GenBank Accession No. DQ233479). To our knowledge, this is the first report of natural infection of a grass species by IYSV and the first report of a Tospovirus infecting a grass species. The data suggests grasses may serve as a new host reservoir for IYSV. The increasing number of weed hosts of IYSV warrants further study on the role of these weeds as hosts for onion thrips and in IYSV epidemiology. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) C. Nischwitz et al. Plant Dis. 91:1518, 2007. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) R. Sampangi et al. Plant Dis. 91:1683, 2007.

Flaxseed oil modulates semen production and its quality profiles, freezability, testicular biometrics and endocrinological profiles in mithun.

Mithun (Bos frontalis) is a unique domestic free range bovine species of North Eastern Hilly (NEH) regions of India. Effect of feed supplementation of Flaxseed oil (FSO) on semen production and its quality profiles, freezability, oxidative stress, apoptotic sperm percentage and subsequently on endocrinological profiles & scrotal and testicular biometrics in different seasons was studied in mithun. The experimental animals were divided into two groups, Gr I: Control (n = 3) and Gr II: Treatment (n = 3; Flaxseed oil @ 150 mL/day). FSO was supplemented through oral drench in the morning hours just before concentrate feeding. A total of 80 semen samples (n = 80; 20 semen samples from each season; each 10 semen samples from control and treatment groups per season) were collected, not more than twice per week in winter, spring, autumn and summer seasons. Semen quality profiles (SQPs) such as volume, sperm concentration, motility (forward progressive and total), motility & velocity profiles by computer assisted sperm analyser (CASA), viability, total sperm abnormality, acrosome integrity, plasma membrane & nuclear abnormality and apoptotic sperm percentage were estimated in fresh semen. Along with SQPs measured in fresh semen, motility in estrus bovine cervical mucus (bovine cervical mucus penetration test; BCMPT) and mitochondrial membrane potential (MMP) by JC-1 stain were determined in the post-thawed semen samples. Biochemical profiles (aspartate aminotransferase; AST, alanine aminotransferase; ALT, total cholesterol; CHO), antioxidant profiles (superoxide dismutase; SOD, catalase; CAT, glutathione; GSH, total antioxidant capacity; TAC) and oxidative stress profile (malondialdehyde; MDA) were estimated in fresh semen whereas AST, ALT, lactate dehydrogenase (LDH), TAC and MDA were estimated in the frozen thawed semen samples. Endocrinological profiles such as follicle stimulating hormone (FSH), luteinizing hormone (LH), testosterone, cortisol and thyroxin and scrotal circumference (SC) & testicular biometrics were measured in both groups in different seasons. Result revealed a significant (p < 0.05) improvement in motility (total & forward progressive, motility & velocity by CASA and vanguard distance in cervical mucus), viability, intactness of acrosome & plasma membrane, MMP, antioxidant profiles and reduction in total sperm and nuclear abnormalities, reduction in leakage of intracellular enzymes and reduction in oxidative stress profile and reduction of apoptotic sperm percentage were observed in FSO supplemented than in un-supplemented control group accordingly in fresh and post thawed semen samples. Blood FSH, LH, testosterone and thyroxin concentration were significantly (p < 0.05) increased and cortisol concentration was significantly (p < 0.05) decreased in FSO supplemented group than in unsupplemented control group. Similarly, SC and testicular biometrics were increased significantly (p < 0.05) in supplemented than unsupplemented group for different seasons and significantly (p < 0.05) higher in winter and spring than in summer season in the experimental groups. It can be concluded from the study that supplementation of FSO can effectively be utilized to improve the antioxidant profiles, reduction of oxidative stress with cascading beneficial effects on SQPs and fertility status of the mithun bull.