Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 55
Filtrar
1.
Bioorg Chem ; 147: 107392, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38723423

RESUMEN

Diabetes mellitus is a metabolic disease characterized by hyperglycemia, which can be counteracted by the inhibition of α-glucosidase (α-Glu) and α-amylase (α-Amy), enzymes responsible for the hydrolysis of carbohydrates. In recent decades, many natural compounds and their bioinspired analogues have been studied as α-Glu and α-Amy inhibitors. However, no studies have been devoted to the evaluation of α-Glu and α-Amy inhibition by the neolignan obovatol (1). In this work, we report the synthesis of 1 and a library of new analogues. The synthesis of these compounds was achieved by implementing methodologies based on: phenol allylation, Claisen/Cope rearrangements, methylation, Ullmann coupling, demethylation, phenol oxidation and Michael-type addition. Obovatol (1) and ten analogues were evaluated for their in vitro inhibitory activity towards α-Glu and α-Amy. Our investigation highlighted that the naturally occurring 1 and four neolignan analogues (11, 22, 26 and 27) were more effective inhibitors than the hypoglycemic drug acarbose (α-Amy: 34.6 µM; α-Glu: 248.3 µM) with IC5O value of 6.2-23.6 µM toward α-Amy and 39.8-124.6 µM toward α-Glu. Docking investigations validated the inhibition outcomes, highlighting optimal compatibility between synthesized neolignans and both the enzymes. Concurrently circular dichroism spectroscopy detected the conformational changes in α-Glu induced by its interaction with the studied neolignans. Detailed studies through fluorescence measurements and kinetics of α-Glu and α-Amy inhibition also indicated that 1, 11, 22, 26 and 27 have the greatest affinity for α-Glu and 1, 11 and 27 for α-Amy. Surface plasmon resonance imaging (SPRI) measurements confirmed that among the compounds studied, the neolignan 27 has the greater affinity for both enzymes, thus corroborating the results obtained by kinetics and fluorescence quenching. Finally, in vitro cytotoxicity of the investigated compounds was tested on human colon cancer cell line (HCT-116). All these results demonstrate that these obovatol-based neolignan analogues constitute promising candidates in the pursuit of developing novel hypoglycemic drugs.


Asunto(s)
Inhibidores de Glicósido Hidrolasas , Lignanos , alfa-Amilasas , alfa-Glucosidasas , alfa-Amilasas/antagonistas & inhibidores , alfa-Amilasas/metabolismo , alfa-Glucosidasas/metabolismo , Inhibidores de Glicósido Hidrolasas/síntesis química , Inhibidores de Glicósido Hidrolasas/farmacología , Inhibidores de Glicósido Hidrolasas/química , Lignanos/farmacología , Lignanos/química , Lignanos/síntesis química , Relación Estructura-Actividad , Humanos , Estructura Molecular , Relación Dosis-Respuesta a Droga , Simulación del Acoplamiento Molecular , Hipoglucemiantes/farmacología , Hipoglucemiantes/síntesis química , Hipoglucemiantes/química , Inhibidores Enzimáticos/farmacología , Inhibidores Enzimáticos/síntesis química , Inhibidores Enzimáticos/química
2.
Chirality ; 36(6): e23695, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38890151

RESUMEN

Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA. Spectroscopic analysis reveals chiral transfer from DOPA enantiomers to porphyrin hetero-aggregates, followed by the disruption of these latter and subsequent generation of chiral melanin structures in solution. Quartz substrates inserted into these solutions spontaneously accumulate homogeneous melanin-like films over days, demonstrating the feasibility of self-assembly. The resulting films exhibit characteristic UV/Vis and CD spectra, with distinct signals indicating successful chiral induction. Interestingly, the AFM characterizations reveal a distinct surface morphology, and in addition, some thermal and mechanical properties have been taken into account. Overall, this study sheds light on the formation, stability, and chiroptical properties of melanin-based films, paving the way for their application in various fields.

3.
Chemistry ; 29(7): e202202337, 2023 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-36224099

RESUMEN

Protonated achiral H2 TPPS4 spontaneously self-arranges at acids pH and high ionic strength to build mesoscopic J-aggregates that are intrinsically chiral. According to the symmetry rule aggregation leads to a racemate that, however, can be unbalanced by chemical (chiral pollutants) or physical stimuli (as vortexing the solution). Vortexing the title racemate, in principle, might either induce chiral separation or chiral enrichment. Indeed, herein it is shown that vortices enable the resolution of this racemic solution exploiting the tendency to deposit, onto the quartz cuvette walls, of the enantiomer favored by the stirring sense. Simultaneously, over time, it was found that the opposite chiral conformation becomes prevalent in solution realizing a significant enantiomeric resolution. Therefore, after removing all stirring-favored chiral J-aggregate from the solution, the recovering and isolating of the desired enantiomers from the cuvette walls was successfully obtained without complex procedures. In this sense, it has been demonstrated that the stirring forces are executively able to fulfil the chiral separation in H2 TPPS4 J-aggregates, employed as model of a self-assembled system in aqueous solution.

4.
Anal Bioanal Chem ; 415(10): 1829-1840, 2023 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-36808276

RESUMEN

The possibility to monitor peptide and protein aggregation is of paramount importance in the so-called conformational diseases, as the understanding of many physiological pathways, as well as pathological processes involved in the development of such diseases, depends very much on the actual possibility to monitor biomolecule oligomeric distribution and aggregation. In this work, we report a novel experimental method to monitor protein aggregation, based on the change of the fluorescent properties of carbon dots upon protein binding. The results obtained in the case of insulin with this newly proposed experimental approach are compared with those obtained with other common experimental techniques normally used for the same purpose (circular dichroism, DLS, PICUP and ThT fluorescence). The greatest advantage of the hereby presented methodology over all the other experimental methods considered is the possibility to monitor the initial stages of insulin aggregation under the different experimental conditions sampled and the absence of possible disturbances and/or molecular probes during the aggregation process.


Asunto(s)
Insulina , Puntos Cuánticos , Insulina/química , Carbono/química , Agregado de Proteínas , Puntos Cuánticos/química , Dicroismo Circular , Colorantes Fluorescentes/química
5.
Molecules ; 26(3)2021 Jan 29.
Artículo en Inglés | MEDLINE | ID: mdl-33572895

RESUMEN

The pivotal role played by potassium ions in the noncovalent synthesis of discrete porphyrin-calixarene nanostructures has been examined. The flattened-cone conformation adopted by the two cavities of octa-cationic calix[4]tube C4T was found to prevent the formation of complexes with well-defined stoichiometry between this novel water-soluble calixarene and the tetra-anionic phenylsulfonate porphyrin CuTPPS. Conversely, preorganization of C4T into a C4v-symmetrical scaffold, triggered by potassium ion encapsulation (C4T@K+), allowed us to carry out an efficient hierarchical self-assembly process leading to 2D and 3D nanostructures. The stepwise formation of discrete CuTPPS/C4T@K+ noncovalent assemblies, containing up to 33 molecular elements, was conveniently monitored by UV/vis spectroscopy by following the absorbance of the porphyrin Soret band.


Asunto(s)
Calixarenos/química , Ferroquelatasa/química , Nanoestructuras/química , Porfirinas/química , Complejos de Coordinación/química , Iones/química , Metaloporfirinas/química , Conformación Molecular , Estructura Molecular , Potasio/química , Ésteres del Ácido Sulfúrico/química
6.
Chemistry ; 26(16): 3515-3518, 2020 Mar 18.
Artículo en Inglés | MEDLINE | ID: mdl-31990096

RESUMEN

The hierarchical assembly, in aqueous solution, of a new multi-metalloporphyrin/calixarene aggregate has been accomplished. In this supramolecular system transfer of chirality, from the outermost components to the central porphyrin reporter, takes place as a result of favorable and fully noncovalent long-range electronic communication.

7.
Chirality ; 32(10): 1243-1249, 2020 10.
Artículo en Inglés | MEDLINE | ID: mdl-32794305

RESUMEN

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC)2 in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC)2 . Whilst when the Z form of the poly (dG-dC)2 is induced, a slight intercalation of the porphyrin between the basis has been detected.


Asunto(s)
ADN/química , Porfirinas/química , Espermina/química , Dicroismo Circular , Conformación de Ácido Nucleico , Espectrofotometría Ultravioleta
8.
Nucleic Acids Res ; 46(D1): D558-D566, 2018 01 04.
Artículo en Inglés | MEDLINE | ID: mdl-29140462

RESUMEN

The Library of Integrated Network-based Cellular Signatures (LINCS) program is a national consortium funded by the NIH to generate a diverse and extensive reference library of cell-based perturbation-response signatures, along with novel data analytics tools to improve our understanding of human diseases at the systems level. In contrast to other large-scale data generation efforts, LINCS Data and Signature Generation Centers (DSGCs) employ a wide range of assay technologies cataloging diverse cellular responses. Integration of, and unified access to LINCS data has therefore been particularly challenging. The Big Data to Knowledge (BD2K) LINCS Data Coordination and Integration Center (DCIC) has developed data standards specifications, data processing pipelines, and a suite of end-user software tools to integrate and annotate LINCS-generated data, to make LINCS signatures searchable and usable for different types of users. Here, we describe the LINCS Data Portal (LDP) (http://lincsportal.ccs.miami.edu/), a unified web interface to access datasets generated by the LINCS DSGCs, and its underlying database, LINCS Data Registry (LDR). LINCS data served on the LDP contains extensive metadata and curated annotations. We highlight the features of the LDP user interface that is designed to enable search, browsing, exploration, download and analysis of LINCS data and related curated content.


Asunto(s)
Bases de Datos Factuales , Biología Celular , Biología Computacional , Curaduría de Datos , Bases de Datos Genéticas , Epigenómica , Humanos , Metadatos , Proteómica , Programas Informáticos , Biología de Sistemas , Interfaz Usuario-Computador
9.
Int J Mol Sci ; 21(11)2020 May 27.
Artículo en Inglés | MEDLINE | ID: mdl-32471075

RESUMEN

Antibiotics represent essential drugs to contrast the insurgence of bacterial infections in humans and animals. Their extensive use in livestock farming, including aquaculture, has improved production performances and food safety. However, their overuse can implicate a risk of water pollution and related antimicrobial resistance. Consequently, innovative strategies for successfully removing antibiotic contaminants have to be advanced to protect human health. Among them, photodegradation TiO2-driven under solar irradiation appears not only as a promising method, but also a sustainable pathway. Hence, we evaluated several composite TiO2 powders with H2TCPP, CuTCPP, ZnTCPP, and SnT4 porphyrin for this scope in order to explore the effect of porphyrins sensitization on titanium dioxide. The synthesis was realized through a fully non-covalent functionalization in water at room conditions. The efficacy of obtained composite materials was also tested in photodegrading oxolinic acid and oxytetracycline in aqueous solution at micromolar concentrations. Under simulated solar irradiation, TiO2 functionalized with CuTCPP has shown encouraging results in the removal of oxytetracycline from water, by opening the way as new approaches to struggle against antibiotic's pollution and, finally, to represent a new valuable tool of public health.


Asunto(s)
Antibacterianos/química , Farmacorresistencia Bacteriana , Fotólisis , Porfirinas/química , Gestión de Riesgos , Titanio/química , Agua/química , Adsorción , Ácido Oxolínico/química , Oxitetraciclina/química , Espectrofotometría Ultravioleta
10.
Int J Mol Sci ; 21(19)2020 Sep 29.
Artículo en Inglés | MEDLINE | ID: mdl-33003385

RESUMEN

The present study provides new evidence that cationic porphyrins may be considered as tunable platforms to interfere with the structural "key code" present on the 20S proteasome α-rings and, by consequence, with its catalytic activity. Here, we describe the functional and conformational effects on the 20S proteasome induced by the cooperative binding of the tri-cationic 5-(phenyl)-10,15,20-(tri N-methyl-4-pyridyl) porphyrin (Tris-T4). Our integrated kinetic, NMR, and in silico analysis allowed us to disclose a complex effect on the 20S catalytic activity depending on substrate/porphyrin concentration. The analysis of the kinetic data shows that Tris-T4 shifts the relative populations of the multiple interconverting 20S proteasome conformations leading to an increase in substrate hydrolysis by an allosteric pathway. Based on our Tris-T4/h20S interaction model, Tris-T4 is able to affect gating dynamics and substrate hydrolysis by binding to an array of negatively charged and hydrophobic residues present on the protein surface involved in the 20S molecular activation by the regulatory proteins (RPs). Accordingly, despite the fact that Tris-T4 also binds to the α3ΔN mutant, allosteric modulation is not observed since the molecular mechanism connecting gate dynamics with substrate hydrolysis is impaired. We envisage that the dynamic view of the 20S conformational equilibria, activated through cooperative Tris-T4 binding, may work as a simplified model for a better understanding of the intricate network of 20S conformational/functional states that may be mobilized by exogenous ligands, paving the way for the development of a new generation of proteasome allosteric modulators.


Asunto(s)
Regulación Alostérica/genética , Cationes/metabolismo , Porfirinas/metabolismo , Complejo de la Endopetidasa Proteasomal/metabolismo , Catálisis , Cationes/farmacología , Citoplasma/genética , Humanos , Cinética , Resonancia Magnética Nuclear Biomolecular , Porfirinas/farmacología , Complejo de la Endopetidasa Proteasomal/genética , Unión Proteica/efectos de los fármacos
11.
Molecules ; 25(7)2020 Apr 07.
Artículo en Inglés | MEDLINE | ID: mdl-32272751

RESUMEN

Zinc oxide (ZnO) nanorods grown by chemical bath deposition (CBD) on the surface of polyetheresulfone (PES) electrospun fibers confer antimicrobial properties to the obtained hybrid inorganic-polymeric PES/ZnO mats. In particular, a decrement of bacteria colony forming units (CFU) is observed for both negative (Escherichia coli) and positive (Staphylococcus aureus and Staphylococcus epidermidis) Grams. Since antimicrobial action is strictly related to the quantity of ZnO present on surface, a CBD process optimization is performed to achieve the best results in terms of coverage uniformity and reproducibility. Scanning electron microscopy (SEM) and X-ray photoelectron spectroscopy (XPS) provide morphological and compositional analysis of PES/ZnO mats while thermogravimetric analysis (TGA) is useful to assess the best process conditions to guarantee the higher amount of ZnO with respect to PES scaffold. Biocidal action is associated to Zn2+ ion leaching in solution, easily indicated by UV-Vis measurement of metallation of free porphyrin layers deposited on glass.


Asunto(s)
Antibacterianos/química , Nanotubos/química , Polímeros/química , Sulfonas/química , Óxido de Zinc/química , Antibacterianos/farmacología , Escherichia coli/efectos de los fármacos , Microscopía Electrónica de Rastreo/métodos , Nanofibras/química , Reproducibilidad de los Resultados , Infecciones Estafilocócicas/tratamiento farmacológico , Staphylococcus aureus/efectos de los fármacos , Staphylococcus epidermidis/efectos de los fármacos
12.
Molecules ; 24(18)2019 Sep 14.
Artículo en Inglés | MEDLINE | ID: mdl-31540076

RESUMEN

The dispersion of para-nitroaniline (p-NA) in water poses a threat to the environment and human health. Therefore, the development of functional adsorbents to remove this harmful compound is crucial to the implementation of wastewater purification strategies, and electrospun mats represent a versatile and cost-effective class of materials that are useful for this application. In the present study, we tested the ability of some polyethersulfone (PES) nanofibers containing adsorbed porphyrin molecules to remove p-NA from water. The functional mats in this study were obtained by two different approaches based on fiber impregnation or doping. In particular, meso-tetraphenyl porphyrin (H2TPP) or zinc(II) meso-tetraphenyl porphyrin (ZnTPP) were immobilized on the surface of PES fiber mats by dip-coating or added to the PES electrospun solution to obtain porphyrin-doped PES mats. The presence of porphyrins on the fiber surfaces was confirmed by UV-Vis spectroscopy, fluorescence measurements, and XPS analysis. p-NA removal from water solutions was spectrophotometrically detected and evaluated.


Asunto(s)
Compuestos de Anilina/química , Nanofibras/química , Polímeros/química , Sulfonas/química , Aguas Residuales/química , Purificación del Agua , Porfirinas/química
13.
Int J Mol Sci ; 19(11)2018 Nov 21.
Artículo en Inglés | MEDLINE | ID: mdl-30469358

RESUMEN

G-rich DNA sequences have the potential to fold into non-canonical G-Quadruplex (GQ) structures implicated in aging and human diseases, notably cancers. Because stabilization of GQs at telomeres and oncogene promoters may prevent cancer, there is an interest in developing small molecules that selectively target GQs. Herein, we investigate the interactions of meso-tetrakis-(4-carboxysperminephenyl)porphyrin (TCPPSpm4) and its Zn(II) derivative (ZnTCPPSpm4) with human telomeric DNA (Tel22) via UV-Vis, circular dichroism (CD), and fluorescence spectroscopies, resonance light scattering (RLS), and fluorescence resonance energy transfer (FRET) assays. UV-Vis titrations reveal binding constants of 4.7 × 106 and 1.4 × 107 M-1 and binding stoichiometry of 2⁻4:1 and 10⁻12:1 for TCPPSpm4 and ZnTCPPSpm4, respectively. High stoichiometry is supported by the Job plot data, CD titrations, and RLS data. FRET melting indicates that TCPPSpm4 stabilizes Tel22 by 36 ± 2 °C at 7.5 eq., and that ZnTCPPSpm4 stabilizes Tel22 by 33 ± 2 °C at ~20 eq.; at least 8 eq. of ZnTCPPSpm4 are required to achieve significant stabilization of Tel22, in agreement with its high binding stoichiometry. FRET competition studies show that both porphyrins are mildly selective for human telomeric GQ vs duplex DNA. Spectroscopic studies, combined, point to end-stacking and porphyrin self-association as major binding modes. This work advances our understanding of ligand interactions with GQ DNA.


Asunto(s)
ADN/química , G-Cuádruplex , Sustancias Intercalantes/química , Porfirinas/química , Telómero/química , ADN/efectos de los fármacos , Humanos , Sustancias Intercalantes/farmacología , Porfirinas/farmacología , Espermina/química , Telómero/efectos de los fármacos
14.
Molecules ; 24(1)2018 Dec 27.
Artículo en Inglés | MEDLINE | ID: mdl-30591641

RESUMEN

We report of the interactions between four amino acids lysine (Lys), arginine (Arg), histidine (His), and phenylalanine (Phe) with the J-aggregates of the protonated 5,10,15,20-tetrakis(4-sulfonatophenyl)-porphyrin H4TPPS. Several aspects of these self-assembled systems have been analyzed: (i) the chiral transfer process; (ii) the hierarchical effects leading to the aggregates formation; and, (iii) the influence of the amino acid concentrations on both transferring and storing chiral information. We have demonstrated that the efficient control on the J-aggregates chirality is obtained when all amino acids are tested and that the chirality transfer process is under hierarchical control. Finally, the chiral porphyrin aggregates obtained exhibit strong chiral inertia.


Asunto(s)
Aminoácidos/química , Porfirinas/química , Dicroismo Circular , Punto Isoeléctrico , Espectrofotometría Ultravioleta , Estereoisomerismo
15.
Angew Chem Int Ed Engl ; 57(33): 10656-10660, 2018 08 13.
Artículo en Inglés | MEDLINE | ID: mdl-29939459

RESUMEN

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.

16.
J Phys Chem A ; 119(21): 5396-404, 2015 May 28.
Artículo en Inglés | MEDLINE | ID: mdl-25568940

RESUMEN

In this paper, we extend an integrated QM/MM/polarizable continuum model (PCM) method, which combines a fluctuating charge (FQ) approach to the MM polarization with the PCM, to describe electronic circular dichroism (ECD) spectra of systems in aqueous solution. The main features of the approach are presented, and then applications to the UV and ECD spectra of neutral (S)-nicotine in aqueous solution are reported. The performance of the QM/FQ/PCM is compared with that of the PCM against newly measured UV ECD spectra, which are in agreement with previous findings. The inclusion of specific solvation effects via the QM/FQ/PCM method leads to an improvement in the calculated spectra compared to the experimental findings, though the pure PCM results are still qualitatively correct and are a useful tool for the characterization of the states.

17.
Chirality ; 27(11): 773-8, 2015 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-26365889

RESUMEN

In this study we show the outstanding agreement between simulation and experimental data concerning the efficient stabilization effect by NaCl of Z conformation. We demonstrate by circular dichroism (CD) experiments that Na(+) not only is able to induce a B to Z form transition in a short (GC)3 alternated portion of a sequence having 17 basis, but also is the best stabilizer in comparison with other Z inducers used (spermine and NiCl2). This result was confirmed by free energy calculations.


Asunto(s)
ADN/química , Dicroismo Circular , Conformación de Ácido Nucleico , Estereoisomerismo
18.
Bioorg Med Chem ; 22(3): 960-6, 2014 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-24433967

RESUMEN

Novel conjugated G-quadruplex-forming d(TG3AG) oligonucleotides, linked to hydrophobic groups through phosphodiester bonds at 5'-end, have been synthesized as potential anti-HIV aptamers, via a fully automated, online phosphoramidite-based solid-phase strategy. Conjugated quadruplexes showed pronounced anti-HIV activity with some preference for HIV-1, with inhibitory activity invariably in the low micromolar range. The CD and DSC monitored thermal denaturation studies on the resulting quadruplexes, indicated the insertion of lipophilic residue at the 5'-end, conferring always improved stability to the quadruplex complex (20<ΔTm<40°C). The data suggest no direct functional relationship between the thermal stability and anti-HIV activity of the folded conjugated G-quartets. It would appear that the nature of the residue at 5' end of the d(TG3AG) quadruplexes plays an important role in the thermodynamic stabilization but a minor influence on the anti-HIV activity. Moreover, a detailed CD and DSC analyses indicate a monophasic behaviour for sequences I and V, while for ODNs (II-IV) clearly show that these quadruplex structures deviate from simple two-state melting, supporting the hypothesis that intermediate states along the dissociation pathway may exist.


Asunto(s)
Fármacos Anti-VIH/química , Fármacos Anti-VIH/farmacología , G-Cuádruplex , Fármacos Anti-VIH/síntesis química , Fármacos Anti-VIH/metabolismo , Aptámeros de Nucleótidos/química , Rastreo Diferencial de Calorimetría , Células Cultivadas/virología , Dicroismo Circular , Relación Dosis-Respuesta a Droga , Evaluación Preclínica de Medicamentos/métodos , Proteína gp120 de Envoltorio del VIH/metabolismo , Proteína gp41 de Envoltorio del VIH/metabolismo , Transcriptasa Inversa del VIH/antagonistas & inhibidores , VIH-1/efectos de los fármacos , VIH-1/patogenicidad , VIH-2/efectos de los fármacos , VIH-2/patogenicidad , Humanos , Interacciones Hidrofóbicas e Hidrofílicas , Oligonucleótidos/química , Oligonucleótidos/farmacología , Albúmina Sérica/metabolismo , Técnicas de Síntesis en Fase Sólida , Relación Estructura-Actividad , Resonancia por Plasmón de Superficie , Termodinámica
19.
Nanoscale ; 16(10): 5137-5148, 2024 Mar 07.
Artículo en Inglés | MEDLINE | ID: mdl-38305723

RESUMEN

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.


Asunto(s)
MicroARNs , Porfirinas , Humanos , Porfirinas/química , Zinc , Oligonucleótidos , Dicroismo Circular
20.
Int J Biol Macromol ; 268(Pt 2): 131801, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38670185

RESUMEN

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.


Asunto(s)
G-Cuádruplex , Porfirinas , Porfirinas/química , Ligandos , ADN/química , Modelos Moleculares , Dicroismo Circular
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA