Multicolor strategies for investigating clonal expansion and tissue plasticity.

Understanding the generation of complexity in living organisms requires the use of lineage tracing tools at a multicellular scale. In this review, we describe the different multicolor strategies focusing on mouse models expressing several fluorescent reporter proteins, generated by classical (MADM, Brainbow and its multiple derivatives) or acute (StarTrack, CLoNe, MAGIC Markers, iOn, viral vectors) transgenesis. After detailing the multi-reporter genetic strategies that serve as a basis for the establishment of these multicolor mouse models, we briefly mention other animal and cellular models (zebrafish, chicken, drosophila, iPSC) that also rely on these constructs. Then, we highlight practical applications of multicolor mouse models to better understand organogenesis at single progenitor scale (clonal analyses) in the brain and briefly in several other tissues (intestine, skin, vascular, hematopoietic and immune systems). In addition, we detail the critical contribution of multicolor fate mapping strategies in apprehending the fine cellular choreography underlying tissue morphogenesis in several models with a particular focus on brain cytoarchitecture in health and diseases. Finally, we present the latest technological advances in multichannel and in-depth imaging, and automated analyses that enable to better exploit the large amount of data generated from multicolored tissues.

Biological and Genetic Characterization of New and Known Necroviruses Causing an Emerging Systemic Necrosis Disease of Corn Salad (Valerianella locusta) in France.

An emerging systemic necrosis disease of corn salad was first observed in the Nantes region of France in the late 2000s. Classical virology and high-throughput sequencing approaches demonstrated that the disease is associated with four different necroviruses: tobacco necrosis virus A (TNVA), tobacco necrosis virus D (TNVD), olive mild mosaic virus (OMMV), and a novel recombinant Alphanecrovirus for which the name corn salad necrosis virus (CSNV) is proposed. Satellite tobacco necrosis virus was also frequently observed. Koch's postulates were completed for all four agents, each one alone being able to cause systemic necrosis of varying severity in corn salad. OMMV was the most frequently observed virus and causes the most severe symptoms. TNVA was the second, both in terms of prevalence and symptom severity while TNVD and CSNV were only rarely observed and caused the less severe symptoms. The emergence of this systemic disease may have been favored by the short and repeated cropping cycles used for corn salad, possibly allowing the selection of necrovirus isolates with an improved ability to systemically invade this specialty crop.

Complete Nucleotide Sequence of Artichoke latent virus Shows it to be a Member of the Genus Macluravirus in the Family Potyviridae.

Complete genomic sequences of Artichoke latent virus (ArLV) have been obtained by classical or high-throughput sequencing for an ArLV isolate from Italy (ITBr05) and for two isolates from France (FR37 and FR50). The genome is 8,278 to 8,291 nucleotides long and has a genomic organization comparable with that of Chinese yam necrotic mosaic virus (CYNMV), the only macluravirus fully sequenced to date. The cleavage sites of the viral polyprotein have been tentatively identified by comparison with CYNMV, confirming that macluraviruses are characterized by the absence of a P1 protein, a shorter and N-terminally truncated coat protein (CP). Sequence comparisons firmly place ArLV within the genus Macluravirus, and confirm previous results suggesting that Ranunculus latent virus (RALV), a previously described Macluravirus sp., is very closely related to ArLV. Serological relationships and comparisons of the CP gene and of the partial RaLV sequence available all indicate that RaLV should not be considered as a distinct species but as a strain of ArLV. The results obtained also suggest that the spectrum of currently used ArLV-specific molecular hybridization or polymerase chain reaction detection assays should be improved to cover all isolates and strains in the ArLV species.

First Report of the Presence of Plum pox virus Rec Strain in France.

Plum pox virus (PPV) is the most detrimental virus in stone fruit crops (Prunus sp.). At least nine monophyletic PPV strains are recognized, three of which, PPV-D, PPV-M, and PPV-Rec, have broad distributions (2). PPV-Rec is characterized by a unique founding recombination event and has been reported mostly from Central and South-Central Europe (2). It is generally considered poorly adapted to peach, and the weak and transient symptoms it causes in the GF305 peach seedling indicator may complicate its biological detection (2). During surveys in the Alsace region of France in spring 2013, a plum orchard with trees (Prunus domestica cv. Quetsche d'Alsace 3066) showing dubious leaf symptoms possibly reminiscent of PPV infection was identified. Testing of material from this plant by ELISA (Bioreba AG, Switzerland) gave clear positive reactions, putting the overall infection rate of the orchard at 6.25%, while a second nearby orchard was found infected at a rate of 0.8%. The presence of PPV was confirmed by polymerase chain reaction (PCR) amplification using either the P1-P2 polyvalent primer pair or the P3M-P4b primer pair, which allows the specific amplification of isolates of the Rec and M strains (1). Sequencing of the 467-nt-long P3M-P4b PCR product (Genbank Accession No. KM035763), which spans the end of the NIb gene and the N-terminal hypervariable end of the coat protein gene, provided clear identification of the PPV isolate as belonging to the Rec strain, since it contained all the PPV-Rec specific mutations in the amplified region and showed 98.7 to 97.7% identity with a range of PPV Rec isolates mostly originating from the Balkans. Identification as a PPV-Rec isolate was also confirmed using a strain-specific reverse-transcription-PCR assay (3). This is, to our knowledge, the first report of the presence of PPV-Rec in France. This finding is worrisome given that PPV-Rec is considered well adapted to plum (2), the most important Prunus crop in Alsace. Further surveillance in Alsace during 2014 failed to provide evidence for the presence of PPV-Rec in other areas of the region away from the initial infection focus, which is currently undergoing eradication efforts. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) J. A. García et al. Mol. Plant Pathol. 15:226, 2014. (3) Z. Subr et al. Acta Virol. 48:173, 2004.

Key mutations in the cylindrical inclusion involved in lettuce mosaic virus adaptation to eIF4E-mediated resistance in lettuce.

We previously showed that allelic genes mol¹ and mo1² used to protect lettuce crops against Lettuce mosaic virus (LMV) correspond to mutant alleles of the gene encoding the eukaryotic translation initiation factor 4E. LMV resistance-breaking determinants map not only to the main potyvirus virulence determinant, a genome-linked viral protein, but also to the C-terminal region of the cylindrical inclusion (CI), with a key role of amino acid at position 621. Here, we show that the propagation of several non-lettuce isolates of LMV in mo1¹ plants is accompanied by a gain of virulence correlated with the presence in the CI C terminus of a serine at position 617 and the accumulation of mutations at positions 602 or 627. Whole-genome sequencing of native and evolved isolates showed that no other mutation could be associated with adaptation to mo1 resistance. Site-directed mutagenesis pinpointed the key role in the virulence of the combination of mutations at positions 602 and 617, in addition to position 621. The impact of these mutations on the fitness of the virus was evaluated, suggesting that the durability of mo1 resistance in the field relies on the fitness cost associated with the resistance-breaking mutations, the nature of the mutations, and their potential antagonistic effects.

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

Uncovering and engineering the mechanical properties of the adhesion GPCR ADGRG1 GAIN domain.

Key cellular functions depend on the transduction of extracellular mechanical signals by specialized membrane receptors including adhesion G-protein coupled receptors (aGPCRs). While recently solved structures support aGPCR activation through shedding of the extracellular GAIN domain, the molecular mechanisms underpinning receptor mechanosensing remain poorly understood. When probed using single-molecule atomic force spectroscopy and molecular simulations, ADGRG1 GAIN dissociated from its tethered agonist at forces significantly higher than other reported signaling mechanoreceptors. Strong mechanical resistance was achieved through specific structural deformations and force propagation pathways under mechanical load. ADGRG1 GAIN variants computationally designed to lock the alpha and beta subdomains and rewire mechanically-induced structural deformations were found to modulate the GPS-Stachel rupture forces. Our study provides unprecedented insights into the molecular underpinnings of GAIN mechanical stability and paves the way for engineering mechanosensors, better understanding aGPCR function, and informing drug-discovery efforts targeting this important receptor class.

The determinant of potyvirus ability to overcome the RTM resistance of Arabidopsis thaliana maps to the N-terminal region of the coat protein.

In Arabidopsis thaliana Columbia (Col-0) plants, the restriction of Tobacco etch virus (TEV) long-distance movement involves at least three dominant RTM (restricted TEV movement) genes named RTM1, RTM2, and RTM3. Previous work has established that, while the RTM-mediated resistance is also effective against other potyviruses, such as Plum pox virus (PPV) and Lettuce mosaic virus (LMV), some isolates of these viruses are able to overcome the RTM mechanism. In order to identify the viral determinant of this RTM-resistance breaking, the biological properties of recombinants between PPV-R, which systemically infects Col-0, and PPV-PSes, restricted by the RTM resistance, were evaluated. Recombinants that contain the PPV-R coat protein (CP) sequence in an RTM-restricted background are able to systemically infect Col-0. The use of recombinants carrying chimeric CP genes indicated that one or more PPV resistance-breaking determinants map to the 5' half of the CP gene. In the case of LMV, sequencing of independent RTM-breaking variants recovered after serial passages of the LMV AF199 isolate on Col-0 plants revealed, in each case, amino acid changes in the CP N-terminal region, close to the DAG motif. Taken together, these findings demonstrate that the potyvirus CP N-terminal region determines the outcome of the interaction with the RTM-mediated resistance.

Skull vibration induced nystagmus in patients with superior semicircular canal dehiscence.

OBJECTIVE: To establish optimum stimulus frequency and location of bone conducted vibration provoking a skull vibration induced nystagmus (SVIN) in superior semi-circular canal dehiscences. METHODS: SVIN 3D components in 40 patients with semi-circular canal dehiscence (27 unilateral and 13 bilateral) were compared with a group of 18 patients with severe unilateral vestibular loss and a control group of 11 volunteers. RESULTS: In unilateral semi-circular canal dehiscences, SVIN torsional and horizontal components observed on vertex location in 88% beat toward the lesion side in 95%, and can be obtained up to 800Hz (around 500Hz being optimal). SVIN slow-phase-velocity was significantly higher on vertex stimulation at 100 and 300Hz (P=0.04) than on mastoids. SVIN vertical component is more often upbeating than downbeating. A SVIN was significantly more often observed in unilateral than bilateral semi-circular-canal dehiscences (P=0.009) and with a higher slow phase velocity (P=0.008). In severe unilateral vestibular lesions the optimal frequency was 100Hz and SVIN beat toward the intact side. The mastoid stimulation was significantly more efficient than vertex stimulation at 60 and 100Hz (P<0.01). CONCLUSION: SVIN reveals instantaneously in unilateral semi-circular canal dehiscences a characteristic nystagmus beating, for the torsional and horizontal components, toward the lesion side and with a greater sensitivity toward high frequencies on vertex stimulation. SVIN three components analysis suggests a stimulation of both superior semi-circular canal and utricle. SVIN acts as a vestibular Weber test, assessing a vestibular asymmetrical function and is a useful indicator for unilateral semi-circular canal dehiscence.

First Report of Cherry virus A in Prunus mume in China.

Natural infections of Cherry virus A (CVA) have been reported in sweet (Prunus avium) and sour cherry (P. cerasus) from a number of European countries, North America, and Japan. CVA has been detected occasionally in other Prunus hosts such as peach, plum, and apricot (1). In the spring of 2007, samples from four Japanese apricot (Prunus mume) trees from the Jiangsu Province of China were analyzed by a polyvalent reverse transcriptase-PCR assay that amplifies a short region of the polymerase gene of viruses from several genera in the family Flexiviridae (2). Sequencing of the amplified products identified CVA in three samples. Two isolates (GenBank Accession Nos. EU730949 and EU730950) were closely related and highly homologous (97.5 to 99.3% identity) to noncherry isolates of CVA (GenBank Accession Nos AY792509 and DQ445275 to DQ445292). The third isolate (GenBank Accession No. EU730951) was approximately 90% identical to the other P. mume isolates and showed the highest identity (92.3%) to a cherry isolate (GenBank Accession No AF413923). CVA infection of the P. mume samples was confirmed by two CVA-specific primer pairs targeting genomic regions corresponding to the movement or coat protein genes. Since the samples showed mixed infections with Plum pox virus (PPV) or Asian Prunus virus 1 (APV1), potential CVA symptomatology could not be evaluated. To our knowledge, these results are the first identification of CVA in China and in P. mume, extending the geographical distribution and natural host range of this virus. Additional work is needed to evaluate whether CVA poses a threat to P. mume production or whether, as in other identified hosts, CVA is largely latent. References: (1) M. Barone et al. Plant Dis. 90:1459, 2006. (2) X. Foissac et al. Phytopathology 95:617, 2005.

[Lipoma widened to both lobes of the parotide gland: an exceptional entity. Case report]. / Lipome étendu aux deux lobes de la glande parotide: à propos d'un cas exceptionnel.

The authors report a very rare case of lipome extended to the superficial and deep lobes of parotid gland. MRI remains the best complementary examination to direct the diagnosis; however only the surgery will bring a histological proof formal.

Saccharomyces cerevisiae CDC8 gene and its product.

The product of the Saccharomyces cerevisiae CDC8 gene is essential for normal cellular DNA replication; the determination of the structure of the gene and the identification of its product would facilitate the examination of its role in this process. We have cloned a 1,000-base-pair fragment of the S. cerevisiae genome carrying the functional gene. The nucleotide sequence includes one long open reading frame; it is flanked by sequences typical of other S. cerevisiae genes. This sequence predicts a polypeptide chain product of 216 amino acids with a molecular weight of 24,600. A polyadenylated RNA transcript of this sequence was identified by hybridization; in vitro translation of RNA samples enriched for this transcript produced a specific polypeptide chain of apparent molecular weight between 24,000 and 25,000. Thus the reading frame identified represents the authentic CDC8 gene, and the amino acid sequence of its product has been deduced. Our observations differ from two previous reports of the identification of the putative CDC8 protein based upon in vitro complementation assays.

First Report of the Presence of Plum pox virus Rec Strain in Turkey.

Plum pox virus (PPV) is a detrimental virus in stone fruit crops. Six strains of PPV are recognized, one of which, PPV-Rec, represents a group of isolates sharing a unique founding recombination event (2). This strain has been reported only from central and south-central Europe. Its distribution is of interest because PPV-Rec is reported to induce only weak and transient symptoms in GF305 peach seedlings, which may complicate its detection using this widely used indicator (2). During a field trip in May 2006, a Japanese plum (Prunus salicina) tree showing leaf symptoms reminiscent of PPV infection was identified in Isparta, Turkey. A leaf sample tested by a serological lateral flow PPV Pocket Diagnostic (Central Science Laboratory, Sand Hutton, UK) gave a weak positive reaction. The presence of PPV was confirmed by grafting onto GF305 peach and by PCR amplification and sequencing of a short P3M-P4b PCR product (1; positions 8446 to 8912 on PPV-BOR3; GenBank Accession No. AY028309) spanning the end of the NIb gene and the N-terminal hypervariable end of the coat protein gene. Comparison of the sequence obtained (GenBank Accession No. EF051630) with databases unambiguously identified the isolate as belonging to the Rec strain because it contained all the PPV-Rec specific mutations in the amplified region. In keeping with this identification, the symptoms observed in GF305 were very weak, consisting only of slight vein clearing on a few leaves. This is, to our knowledge, the first report of the presence of PPV-Rec in Turkey. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) M. Glasa et al. J. Gen. Virol. 85:2671, 2004.

Frequent Occurrence of Lettuce mosaic virus in Cape Daisy (Osteospermum sp.) in Tunisia.

The potyvirus Lettuce mosaic virus (LMV) is a common pathogen of lettuce crops worldwide, but it also infects other Asteraceae spp. including ornamentals (2,3,4). Cape daisies (Osteospermum sp.) are widely grown perennial ornamentals reported to be natural hosts of LMV (2,4), which causes faint leaf mosaic and sometimes mild flower breaking. A preliminary observation of mosaic symptoms prompted a large-scale survey during the spring of 2005 in Cape daisies grown in the Tunis metropolitan area and the south of Tunisia (Djerba, Medenine). Two hundred seventy-one samples (Tunis: 14 sites, 219 samples; South: 9 sites, 52 samples) were randomly collected from nurseries, roadway plantings, and home gardens and analyzed. Ninety-three samples (Tunis: 40%, South: 12%; overall: 34%) showed distinct mosaic symptoms. LMV infection was verified by immuno-tissue printing on all collected samples (1), providing evidence for even higher infection levels (Tunis: 60%; South: 25%; overall: 56%). This technique, therefore, allowed the detection of symptomless infection in a significant proportion of samples. It should however, be stressed that symptoms can be very difficult to observe in water-stressed plants, a situation frequently observed in Tunisia. Subsequent PCR analysis with LMV-specific primers (1) of a subset of 24 symptomatic and tissue-print-positive samples confirmed LMV infection in all cases. This is to our knowledge, the first report of LMV infection in Cape daisies in Tunisia. The very high rate of infection observed suggests that these popular ornamentals might constitute a reservoir of LMV as previously reported in the United States (4). References: (1) H. Fakhfakh et al. J. Plant Pathol. 83:3, 2001. (2) R. Jordan and M. Guaragna. (Abstr.) Phytopathology 96(suppl.):S56, 2006. (3) O. Le Gall. No. 399 in: Description of Plant Viruses. A. T. Jones et al., eds. CMI/AAB, Kew, Surrey, UK, 2003. (4) D. C. Opgenorth et al. Plant Dis. 75:751, 1991.

Asian prunus viruses: New related members of the family Flexiviridae in Prunus germplasm of Asian origin.

Serological reactivity to Plum pox virus (PPV) antisera has been described in several Prunus sources of Asian origin that are free of PPV infection. Using polyvalent or specific PCR assays, the presence of three closely related agents in two of these sources, Prunus mume cv. Bungo and P. persica cv. Ku Chu'a Hung, was demonstrated. Similarities in genome organization and sequence comparisons indicate that these agents should be regarded as members of the genus Foveavirus, their only singular trait being a very large (>800 nt) 3' non-coding region (NCR), as compared to the ca. 130-180 nt 3' NCR observed in other Foveaviruses. The three agents are very divergent from known Foveaviruses but are also significantly removed one from the others, with overall nucleotide sequence identity levels in the sequenced region of ca. 74-76% and of only 60.8-67.5% in their complete CP gene (61.9-71.3% amino acid sequence identity). Given the species discrimination criteria in the family Flexiviridae, these three agents should be regarded as three related yet distinct new viruses belonging to the Foveavirus genus, for which the names Asian prunus virus 1, 2 and 3 are proposed. Evidence is provided for the presence of variants of these new viruses in other Prunus germplasm of Asian origin.

Paciente afectado de psoriasis, quien desarrolla una enfermedad ampollar intercurrente: a propósito de un caso

RESUMEN La asociación y coexistencia de psoriasis en placas y penfigoide ampollar (Psoriasis-PA) es una variante clínica poco frecuente. Predomina en el sexo masculino, después de los 60 años de edad. En general, los pacientes ya cuentan con el antecedente de psoriasis y posteriormente se agrega la enfermedad ampollar, con un intervalo promedio de 20 años. Aunque la etiopatogenia aún no se encuentra del todo establecida, se identifican factores desencadenantes tales comoPUVA, fármacos e infecciones. Las opciones terapéuticas consisten en esquemas de monoterapia obiterapia con asociación de corticoesteroides orales e inmunosupresores como el metotrexato (MTX) con evolución favorable en la mayoría de los casos. Se presenta el caso de un paciente masculino, de 52 años de edad con psoriasis vulgar de tres años de evolución y lareciente aparición de penfigoide ampollar.

ABSTRACT The association and coexistence of plaque psoriasis and bullous pemphigoid is a rare clinical variant. It predominates in the male sex, after 60 years old. In general, patients already have a history of psoriasis and then bullous disease is added, with an average interval of 20 years. Although the pathogenesis is not yet fully established, it identifies triggers such as PUVA, drugs, and infections. Therapeutic options consist of monotherapy or combination regimens of systemic corticosteroids and other immunosuppressants such as methotrexate, with favorable evolution in most cases. We present the case of a 52-year-old male patient with 3-year history of vulgar psoriasis and recent appearance of bullous pemphigoid.

Complete Nucleotide Sequence of a French Isolate of Maize rough dwarf virus, a Fijivirus Member in the Family Reoviridae.

The complete nucleotide sequence of a French isolate of Maize rough dwarf virus (MRDV) was determined by next-generation sequencing and compared with the single available complete sequence and with the partial sequences of two additional isolates available in online databases.

Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

First Report on the Natural Occurrence of Cherry virus A in Mirabelle Plum (Prunus domestica var. insititia).

Cherry virus A (CVA) is a member of the Capillovirus genus (2). It was discovered serendipitously during cloning of the little cherry agent (2) and has since been shown to be relatively widespread in sweet and sour cherry (Prunus cerasus and P. avium) (2,3). It is currently unclear whether CVA is associated with any specific symptoms in these hosts. Although it can be transmitted by grafting and thus propagated in peach, it has not been reported to naturally infect any host other than cherry. Using a degenerate reverse transcription-polymerase chain reaction (RT-PCR) technique targeting a conserved region of the RNA-dependent RNA polymerase (RdRp) and allowing the amplification of members of the Trichovirus, Capillovirus, and Foveavirus genera of filamentous plant viruses (1), a number of symptomatic Prunus spp. germplasm were evaluated. Among these, a cv. Mirabelle dorée accession (Prunus domestica var. insititia P332) of French origin exhibited severe symptoms of rosetting, severe leaf and fruit deformation, and yellow mosaic occasionally turning necrotic. RT-PCR conducted on symptomatic samples produced an amplification product of the expected size (362 bp) in several independent experiments. Sequencing of these products yielded a single sequence (GenBank Accession No. AY792509) with 88.1% nucleotide identity and 93.2% amino acid identity with the type strain of CVA (2). Presence of a CVA isolate was independently confirmed using a CVA-specific PCR assay directly on the original plum material or following experimental transmission by grafting on several new hosts including apricot (P. armeniaca cv. Priana) and plum (P. domestica cv. Prune d'Ente). To our knowledge, this is the first report of natural infection of CVA in plum. The symptoms observed in the infected plum are reminiscent of those caused by severe Prune dwarf virus (PDV) strains. Infection by PDV was confirmed using a PDV-specific PCR assay. The contribution, if any, of CVA to the symptoms observed remains to be evaluated. These findings suggest that the possible presence of CVA in noncherry Prunus spp. hosts should be taken into consideration by quarantine and certification programs. References: (1) X. Foissac et al. Acta Hortic. 550:3743, 2001. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995. (3) M. J. Kirby et al. Plant Pathol. 50:6, 2001.