First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Whitefly-Mediated Transmission and Subsequent Acquisition of Highly Similar and Naturally Occurring Tomato Yellow Leaf Curl Virus Variants.

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids, resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (variant #2 and variant #4) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants' concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than that of variant #2 in tomato plants. Despite differences in variants' accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Low Frequency of Horizontal and Vertical Transmission of Cucurbit Leaf Crumple Virus in Whitefly Bemisia tabaci Gennadius.

Cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus, is transmitted by whiteflies in a persistent and circulative manner. Like other begomoviruses, CuLCrV transmission via feeding is well understood; however, whether and how CuLCrV is transmitted by horizontal and vertical modes in its vector, Bemisia tabaci, remains unexplored. We studied transovarial and mating transmission of CuLCrV, and comparatively analyzed virus accumulation in whiteflies through feeding and nonfeeding modes. Furthermore, we quantified CuLCrV DNA A accumulation at different time points to determine whether this virus propagates in whiteflies. CuLCrV DNA A was transmitted vertically and horizontally by B. tabaci, with low frequency in each case. Transovarial transmission of CuLCrV DNA A was only 3.93% in nymphs and 3.09% in adults. Similarly, only a single viruliferous male was able to transmit CuLCrV DNA A to its nonviruliferous female counterparts via mating. In contrast, viruliferous females were unable to transmit CuLCrV DNA A to nonviruliferous males. Additionally, the recipient adults that presumably acquired CuLCrV transovarially and via mating were not able to transmit the virus to squash plants. We further report that the CuLCrV DNA A viral copy numbers were significantly lower in nonfeeding modes of transmission than in feeding ones. The viral copy numbers significantly decreased at succeeding time points throughout adulthood, suggesting no CuLCrV propagation in B. tabaci. Altogether, the low frequency of nonfeeding transmission, reduced virus accumulation in whiteflies, and absence of plant infectivity through nonfeeding transmission suggest that transovarial and mating CuLCrV transmission might not substantially contribute to CuLCrV epidemics.

Polyphenols in combination with ß-cyclodextrin can inhibit and disaggregate α-synuclein amyloids under cell mimicking conditions: A promising therapeutic alternative.

Parkinson's disease is characterized by the presence of insoluble and neurotoxic aggregates (amyloid fibrils) of an intrinsically disordered protein α-synuclein. In this study we have examined the effects of four naturally occurring polyphenols in combination with ß-cyclodextrin (ß-CD) on the aggregation of α-synuclein in the presence of macromolecular crowding agents. Our results reveal that even at sub-stoichiometric concentrations of the individual components, the polyphenol-ß-CD combination(s) not only inhibited the aggregation of the proteins but was also effective in disaggregating preformed fibrils. Curcumin was found to be the most efficient, followed by baicalein with (-)-epigallocatechin gallate and resveratrol coming in next, the latter two exhibiting very similar effects. Our results suggest that the efficiency of curcumin results from a balanced composition of the phenolic OH groups, benzene rings and flexibility. The latter ensures proper positioning of the functional groups to maximize the underlying interactions with both the monomeric form of α-synuclein and its aggregates. The uniqueness of ß-CD was reinforced by the observation that none of the other cyclodextrin variants [α-CD and HP-ß-CD] used was as effective, in spite of these possessing better water solubility. Moreover, the fact that the combinations remained effective under conditions of macromolecular crowding suggests that these have the potential to be developed into viable drug compositions in the near future. MTT assays on cell viability independently confirmed this hypothesis wherein these combinations (and the polyphenols alone too) appreciably impeded the toxicity of the prefibrillar α-synuclein aggregates on the mouse neuroblastoma cell lines (N2a cells).

ß-cyclodextrin and curcumin, a potent cocktail for disaggregating and/or inhibiting amyloids: a case study with α-synuclein.

Aggregation of α-synuclein has been implicated in Parkinson's disease (PD). While many compounds are known to inhibit α-synuclein aggregation, dissolution of aggregates into their constituent monomers cannot be readily achieved. In this study, using a range of techniques, we have shown that an optimized cocktail of curcumin and ß-cyclodextrin, at appreciably low concentrations, not only inhibited aggregation but also broke up the preformed aggregates almost completely. We propose that these compounds exhibit synergy in their action and thus provide us with the exciting prospect of working toward the development of a suitable drug candidate for prevention and treatment of PD.

Tri-trophic studies using Cry1Ac-resistant Plutella xylostella demonstrate no adverse effects of Cry1Ac on the entomopathogenic nematode, Heterorhabditis bacteriophora.

The potential impacts on natural enemies of crops that produce insecticidal Cry proteins from Bacillus thuringiensis (Bt) are an important part of an environmental risk assessment. Entomopathogenic nematodes are important natural enemies of lepidopteran pests, and the effects of Bt crops on these nontarget organisms should be investigated to avoid disruption of their biological control function. The objective of this study was to investigate the effects of Cry1Ac-expressing transgenic Bt broccoli on the entomopathogenic nematode, Heterorhabditis bacteriophora Poinar (Rhabditida: Heterorhabditidae), under tri-trophic conditions. Using CrylAc-resistant Plutella xylostella L. (Lepidoptera: Plutellidae) larvae as hosts, we evaluated the potential impact of Cry1Ac-expressing Bt broccoli on several fitness parameters of H. bacteriophora. Virulence, reproductive potential, time of emergence, and preference of H. bacteriophora for the host (P. xylostella) were not significantly affected when CrylAc-resistant P. xylostella larvae were reared on leaves of Cry1Ac or non-Bt broccoli. Also the aforementioned parameters of the subsequent generation of H. bacteriophora did not differ between nematodes obtained from P. xylostella reared on CrylAc broccoli compared with those obtained from P. xylostella reared on non-Bt broccoli. To the best of our knowledge, the current study provides the first clear evidence that Cry1Ac does not affect important fitness parameters of H. bacteriophora.

NMR insights into ß-Lactamase activity of UVI31+ Protein from Chlamydomonas reinhardtii.

ß-Lactamases (EC 3.5.2.6) confer resistance against ß-lactam group-containing antibiotics in bacteria and higher eukaryotes, including humans. Pathogenic bacterial resistance against ß-lactam antibiotics is a primary concern for potential therapeutic developments and drug targets. Here, we report putative ß-lactamase activity, sulbactam binding (a ß-lactam analogue) in the low µM affinity range, and site-specific interaction studies of a 14 kDa UV- and dark-inducible protein (abbreviated as UVI31+, a BolA homologue) from Chlamydomonas reinhartii. Intriguingly, the solution NMR structure of UVI31 + bears no resemblance to other known ß-lactamases; however, the sulbactam binding is found at two sites rich in positively charged residues, mainly at the L2 loop regions and the N-terminus. Using NMR spectroscopy, ITC and MD simulations, we map the ligand binding sites in UVI31 + providing atomic-level insights into its ß-lactamase activity. Current study is the first report on ß-lactamase activity of UVI31+, a BolA analogue, from C. reinhartii. Furthermore, our mutation studies reveal that the active site serine-55 is crucial for ß-lactamase activity.

WITHDRAWN: Smart polymer-coated microplate wells: Applications in protein purification, protein refolding, and sensing of analytes.

This article has been withdrawn at the request of the author(s) and/or editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at http://www.elsevier.com/locate/withdrawalpolicy.

Novel strains of a pandemic plant virus, tomato spotted wilt orthotospovirus, increase vector fitness and modulate virus transmission in a resistant host.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single-gene resistant cultivars of tomato ("Sw-5b" gene) and pepper ("Tsw" gene) deployed worldwide. However, the emergence of resistance-breaking strains (RB) in recent years has compounded the threat of TSWV to agricultural production worldwide. Despite this, an extensive study on the thrips transmission biology of RB strains is currently lacking. It is also unclear whether mutualistic TSWV-thrips interactions vary across different novel strains with disparate geographical origins. To address both critical questions, we studied whether and how four novel RB strains of TSWV (two sympatric and two allopatric), along with a non-RB strain, impact western flower thrips (WFT) fitness and whether this leads to differences in TSWV incidence, symptom severity (virulence), and virus accumulation in two differentially resistant tomato cultivars. Our findings show that all RB strains increased WFT fitness by prolonging the adult period and increasing fecundity compared to non-RB and non-viruliferous controls, regardless of the geographical origin of strains or the TSWV titers in individual thrips, which were substantially low in allopatric strains. TSWV accumulation in thrips varied at different developmental stages and was unrelated to the infected tissues from which thrips acquired the virus. However, it was significantly positively correlated to that in WFT-inoculated susceptible plants, but not the resistant ones. The TSW incidences were high in tomato plants infected with all RB strains, ranging from 80% to 90% and 100% in resistant and susceptible plants, respectively. However, TSW incidence in the non-RB-infected susceptible tomato plants was 80%. Our findings provide new insights into how novel strains of TSWV, by selectively offering substantial fitness benefits to vectors, modulate transmission and gain a potential epidemiological advantage over non-RB strains. This study presents the first direct evidence of how vector-imposed selection pressure, besides the one imposed by resistant cultivars, may contribute to the worldwide emergence of RB strains.

Seed Transmission of Wheat Streak Mosaic Virus and Triticum Mosaic Virus in Differentially Resistant Wheat Cultivars.

Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are important viral pathogens of wheat in the Great Plains. These viruses individually or in mixed infections with High Plains wheat mosaic virus cause a devastating wheat streak mosaic (WSM) disease. Although seed transmission of WSMV has been studied, no information is currently available on that of TriMV. Furthermore, no study has explored the implications of mixed infections of WSMV and TriMV on seed transmission of one or both viruses. To study both aspects, seeds from differentially resistant field-grown wheat plants (cv. TAM 304 (susceptible), Joe (WSMV resistant, Wsm2 gene), and Breakthrough (BT) (WSMV and TriMV resistant, Wsm1 gene)) showing characteristic WSM symptoms were collected and analyzed to quantify both viruses using qRT-PCR. The percentage of seeds tested positive for WSMV or TriMV individually and in mixed infection varied with cultivar and virus combinations; 13% of TAM 304 seeds tested positive for WSMV, followed by 8% of BT and 4% of Joe seeds. Similarly, TriMV was detected in 12% of BT seeds, followed by 11% of TAM 304 and 8% of Joe seeds. Lastly, mixed infection was detected in 7% of TAM 304 seeds, followed by 4% in BT, and 2% in Joe. Dissection of field-collected seeds into three parts, embryo, endosperm, and seed coat, revealed both WSMV and TriMV accumulated only in the seed coat. Consistent with seeds, percent infection of WSMV or TriMV in the plants that emerged from infected seeds in each treatment varied with cultivar and virus combinations (WSMV: BT 3%; Joe 2%; TAM 304 9%; TriMV: BT 7%; Joe 8%; and TAM 304 10%). Plants infected with mixed viruses showed more pronounced WSM symptoms compared to individual infections. However, both viruses were present only in a few plants (BT: 2%, Joe: 1%, and TAM 304: 4%). Taken together, this study showed that TriMV was transmitted vertically at a higher frequency than WSMV in resistant cultivars, and the seed transmission of TriMV with WSMV increased the virulence of both pathogens (measured via WSM symptom severity) in the emerged plants. Furthermore, Wsm1 and Wsm2 genes considerably reduced WSMV transmission via infected seeds. However, no such effects were observed on TriMV, especially in progeny plants. These results reiterated the importance of planting clean seeds and highlighted the immediate need to identify/develop new sources of TriMV resistance to effectively manage the recurring WSM epidemic.

Sida Golden Mosaic Virus, an Emerging Pathogen of Snap Bean (Phaseolus vulgaris L.) in the Southeastern United States.

Sida golden mosaic virus (SiGMV) was first detected from snap bean (Phaseolus vulgaris L.) in Florida in 2006 and recently in Georgia in 2018. Since 2018, it has caused significant economic losses to snap bean growers in Georgia. This study, using a SiGMV isolate field-collected from prickly sida (Sida spinosa L.), examined the putative host range, vector-mediated transmission, and SiGMV-modulated effects on host-vector interactions. In addition, this study analyzed the phylogenetic relationships of SiGMV with other begomoviruses reported from Sida spp. Host range studies confirmed that SiGMV can infect seasonal crops and perennial weed species such as snap bean, hollyhock (Alcea rosea L.), marsh mallow (Althaea officinalis L.), okra (Abelmoschus esculentus (L.) Moench), country mallow (Sida cordifolia L.), prickly sida (S. spinosa), and tobacco (Nicotiana tabacum L.). The incidence of infection ranged from 70 to 100%. SiGMV-induced symptoms and virus accumulation varied between hosts. The vector, Bemisia tabaci Gennadius, was able to complete its life cycle on all plant species, irrespective of SiGMV infection status. However, SiGMV infection in prickly sida and country mallow positively increased the fitness of whiteflies, whereas SiGMV infection in okra negatively influenced whitefly fitness. Whiteflies efficiently back-transmitted SiGMV from infected prickly sida, hollyhock, marsh mallow, and okra to snap bean, and the incidence of infection ranged from 27 to 80%. Complete DNA-A sequence from this study shared 97% identity with SiGMV sequences reported from Florida and it was determined to be closely related with sida viruses reported from the New World. These results suggest that SiGMV, a New World begomovirus, has a broad host range that would allow its establishment in the farmscapes/landscapes of the southeastern United States and is an emerging threat to snap bean and possibly other crops.

Effects of Host Plants and Their Infection Status on Acquisition and Inoculation of A Plant Virus by Its Hemipteran Vector.

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

The AAA+ chaperone VCP disaggregates Tau fibrils and generates aggregate seeds in a cellular system.

Amyloid-like aggregates of the microtubule-associated protein Tau are associated with several neurodegenerative disorders including Alzheimer's disease. The existence of cellular machinery for the removal of such aggregates has remained unclear, as specialized disaggregase chaperones are thought to be absent in mammalian cells. Here we show in cell culture and in neurons that the hexameric ATPase valosin-containing protein (VCP) is recruited to ubiquitylated Tau fibrils, resulting in their efficient disaggregation. Aggregate clearance depends on the functional cooperation of VCP with heat shock 70 kDa protein (Hsp70) and the ubiquitin-proteasome machinery. While inhibition of VCP activity stabilizes large Tau aggregates, disaggregation by VCP generates seeding-active Tau species as byproduct. These findings identify VCP as a core component of the machinery for the removal of neurodegenerative disease aggregates and suggest that its activity can be associated with enhanced aggregate spreading in tauopathies.

Simultaneous refolding and purification of recombinant proteins by macro-(affinity ligand) facilitated three-phase partitioning.

A strategy called macro-(affinity ligand) facilitated three-phase partitioning (MLFTPP) is described for refolding of a diverse set of recombinant proteins starting from the solubilized inclusion bodies. It essentially consists of: (i) binding of the protein with a suitable smart polymer and (ii) precipitating the polymer-protein complex as an interfacial layer by mixing in a suitable amount of ammonium sulfate and t-butanol. Smart polymers are stimuli-responsive polymers that become insoluble on the application of a suitable stimulus (e.g., a change in the temperature, pH, or concentration of a chemical species such as Ca(2+) or K(+)). The MLFTPP process required approximately 10min, and the refolded proteins were found to be homogeneous on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The folded proteins were characterized by fluorescence emission spectroscopy, circular dichroism spectroscopy, biological activity, melting temperature, and surface hydrophobicity measurements by 8-anilino-1-naphthalenesulfonate fluorescence. Two refolded antibody fragments were also characterized by measuring K(D) by Biacore by using immobilized HIV-1 gp120. The data demonstrate that MLFTPP is a rapid and convenient procedure for refolding a variety of proteins from inclusion bodies at high concentration. Although establishing the generic nature of the approach would require wider trials by different groups, its success with the diverse kinds of proteins tried so far appears to be promising.

Single-step rapid chromatographic purification and characterization of clinical stage oncolytic VSV-GP.

Purification of viruses, especially for therapeutic purposes, is a tedious and challenging task. The challenges arise due to the size and surface complexity of the virus particles. VSV-GP is a promising oncolytic virus, which has been approved for phase I clinical trials by the Food and Drug Administration (FDA) of United States and Paul Ehrlich Institute (PEI) of Germany. The virus particles of VSV-GP are larger in size than vectors commonly used for gene therapy (e.g., adenovirus, adeno-associated virus, etc.). The current established proprietary clinical-grade manufacturing process for the purification of VSV-GP encompasses several chromatographic and non-chromatographic steps. In this study, we describe a new single-step purification process for the purification of VSV-GP virus, using cation exchange convective flow column with relatively higher yields. The purified virus was characterized for its quality attributes using TCID50 assay (for viral infectivity), host cell protein contaminant ELISA, SDS-PAGE, size exclusion chromatography (SEC), and cryo-electron microscopy. Furthermore, the purified viral therapeutic material was tested in vivo for its efficacy and safety. All these characterization methods demonstrated a therapeutic virus preparation of high purity and yield, which can be readily used for various studies.

Differential Transmission of Old and New World Begomoviruses by Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) Cryptic Species of Bemisia tabaci.

Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) are two of the most invasive members of the sweetpotato whitefly, Bemisia tabaci, cryptic species complexes and are efficient vectors of begomoviruses. Bemisia tabaci MEAM1 is the predominant vector of begomoviruses in open-field vegetable crops in the southeastern United States. However, recently B. tabaci MED also has been detected in the landscape outside of greenhouses in Florida and Georgia. This study compared the transmission efficiency of one Old-World (OW) and two New-World (NW) begomoviruses prevalent in the southeastern United States, viz., tomato yellow leaf curl virus (TYLCV), cucurbit leaf crumple virus (CuLCrV), and sida golden mosaic virus (SiGMV) between B. tabaci MEAM1 and B. tabaci MED. Bemisia tabaci MEAM1 efficiently transmitted TYLCV, CuLCrV, or SiGMV, whereas B. tabaci MED only transmitted TYLCV. Percent acquisition and retention of OW TYLCV following a 72 h acquisition access period was significantly higher for B. tabaci MED than B. tabaci MEAM1. In contrast, B. tabaci MEAM1 acquired and retained significantly more NW bipartite begomoviruses, CuLCrV or SiGMV, than B. tabaci MED. Quantitative analysis (qPCR) of virus DNA in whitefly internal tissues revealed reduced accumulation of CuLCrV or SiGMV in B. tabaci MED than in B. tabaci MEAM1. Fluorescent in situ hybridization (FISH) showed localization of CuLCrV or SiGMV in the midgut of B. tabaci MED and B. tabaci MEAM1. However, localization of CuLCrV or SiGMV was only observed in the primary salivary glands of B. tabaci MEAM1 and not B. tabaci MED. TYLCV localization was observed in all internal tissues of B. tabaci MEAM1 and B. tabaci MED. Overall, results demonstrate that both B. tabaci MEAM1 and B. tabaci MED are efficient vectors of OW TYLCV. However, for the NW begomoviruses, CuLCrV and SiGMV, B. tabaci MEAM1 seems to a better vector.

Differential Transcriptional Responses in Two Old World Bemisia tabaci Cryptic Species Post Acquisition of Old and New World Begomoviruses.

Begomoviruses are transmitted by several cryptic species of the sweetpotato whitefly, Bemisia tabaci (Gennadius), in a persistent and circulative manner. Upon virus acquisition and circulative translocation within the whitefly, a multitude of molecular interactions occur. This study investigated the differentially expressed transcript profiles associated with the acquisition of the Old World monopartite begomovirus, tomato yellow leaf curl virus (TYLCV), and two New World bipartite begomoviruses, sida golden mosaic virus (SiGMV) and cucurbit leaf crumple virus (CuLCrV), in two invasive B. tabaci cryptic species, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED). A total of 881 and 559 genes were differentially expressed in viruliferous MEAM1 and MED whiteflies, respectively, compared with their non-viruliferous counterparts, of which 146 genes were common between the two cryptic species. For both cryptic species, the number of differentially expressed genes (DEGs) associated with TYLCV and SiGMV acquisition were higher compared with DEGs associated with CuLCrV acquisition. Pathway analysis indicated that the acquisition of begomoviruses induced differential changes in pathways associated with metabolism and organismal systems. Contrasting expression patterns of major genes associated with virus infection and immune systems were observed. These genes were generally overexpressed and underexpressed in B. tabaci MEAM1 and MED adults, respectively. Further, no specific expression pattern was observed among genes associated with fitness (egg production, spermatogenesis, and aging) in viruliferous whiteflies. The weighted gene correlation network analysis of viruliferous B. tabaci MEAM1 and MED adults identified different hub genes potentially implicated in the vector competence and circulative tropism of viruses. Taken together, the results indicate that both vector cryptic species and the acquired virus species could differentially affect gene expression.

Field Screen and Genotyping of Phaseolus vulgaris against Two Begomoviruses in Georgia, USA.

The production and quality of Phaseolus vulgaris (snap bean) have been negatively impacted by leaf crumple disease caused by two whitefly-transmitted begomoviruses: cucurbit leaf crumple virus (CuLCrV) and sida golden mosaic Florida virus (SiGMFV), which often appear as a mixed infection in Georgia. Host resistance is the most economical management strategy against whitefly-transmitted viruses. Currently, information is not available with respect to resistance to these two viruses in commercial cultivars. In two field seasons (2018 and 2019), we screened Phaseolus spp. genotypes (n = 84 in 2018; n = 80 in 2019; most of the genotypes were common in both years with a few exceptions) for resistance against CuLCrV and/or SiGMFV. We also included two commonly grown Lima bean (Phaseolus lunatus) varieties in our field screening. Twenty Phaseolus spp. genotypes with high to moderate-levels of resistance (disease severity ranging from 5%-50%) to CuLCrV and/or SiGMFV were identified. Twenty-one Phaseolus spp. genotypes were found to be highly susceptible with a disease severity of ≥66%. Furthermore, based on the greenhouse evaluation with two genotypes-each (two susceptible and two resistant; identified in field screen) exposed to viruliferous whiteflies infected with CuLCrV and SiGMFV, we observed that the susceptible genotypes accumulated higher copy numbers of both viruses and displayed severe crumple severity compared to the resistant genotypes, indicating that resistance might potentially be against the virus complex rather than against the whiteflies. Adult whitefly counts differed significantly among Phaseolus genotypes in both years. The whole genome of these Phaseolus spp. [snap bean (n = 82); Lima bean (n = 2)] genotypes was sequenced and genetic variability among them was identified. Over 900 giga-base (Gb) of filtered data were generated and >88% of the resulting data were mapped to the reference genome, and SNP and Indel variants in Phaseolus spp. genotypes were obtained. A total of 645,729 SNPs and 68,713 Indels, including 30,169 insertions and 38,543 deletions, were identified, which were distributed in 11 chromosomes with chromosome 02 harboring the maximum number of variants. This phenotypic and genotypic information will be helpful in genome-wide association studies that will aid in identifying the genetic basis of resistance to these begomoviruses in Phaseolus spp.

The Hsc70 disaggregation machinery removes monomer units directly from α-synuclein fibril ends.

Molecular chaperones contribute to the maintenance of cellular protein homoeostasis through assisting de novo protein folding and preventing amyloid formation. Chaperones of the Hsp70 family can further disaggregate otherwise irreversible aggregate species such as α-synuclein fibrils, which accumulate in Parkinson's disease. However, the mechanisms and kinetics of this key functionality are only partially understood. Here, we combine microfluidic measurements with chemical kinetics to study α-synuclein disaggregation. We show that Hsc70 together with its co-chaperones DnaJB1 and Apg2 can completely reverse α-synuclein aggregation back to its soluble monomeric state. This reaction proceeds through first-order kinetics where monomer units are removed directly from the fibril ends with little contribution from intermediate fibril fragmentation steps. These findings extend our mechanistic understanding of the role of chaperones in the suppression of amyloid proliferation and in aggregate clearance, and inform on possibilities and limitations of this strategy in the development of therapeutics against synucleinopathies.