Cost-effective mitigation of nitrogen pollution from global croplands.

Cropland is a main source of global nitrogen pollution1,2. Mitigating nitrogen pollution from global croplands is a grand challenge because of the nature of non-point-source pollution from millions of farms and the constraints to implementing pollution-reduction measures, such as lack of financial resources and limited nitrogen-management knowledge of farmers3. Here we synthesize 1,521 field observations worldwide and identify 11 key measures that can reduce nitrogen losses from croplands to air and water by 30-70%, while increasing crop yield and nitrogen use efficiency (NUE) by 10-30% and 10-80%, respectively. Overall, adoption of this package of measures on global croplands would allow the production of 17 ± 3 Tg (1012 g) more crop nitrogen (20% increase) with 22 ± 4 Tg less nitrogen fertilizer used (21% reduction) and 26 ± 5 Tg less nitrogen pollution (32% reduction) to the environment for the considered base year of 2015. These changes could gain a global societal benefit of 476 ± 123 billion US dollars (USD) for food supply, human health, ecosystems and climate, with net mitigation costs of only 19 ± 5 billion USD, of which 15 ± 4 billion USD fertilizer saving offsets 44% of the gross mitigation cost. To mitigate nitrogen pollution from croplands in the future, innovative policies such as a nitrogen credit system (NCS) could be implemented to select, incentivize and, where necessary, subsidize the adoption of these measures.

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trebicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trebicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Predicting the Ratio of Nitrification to Immobilization to Reflect the Potential Risk of Nitrogen Loss Worldwide.

Nitrification and immobilization compete for soil ammonium (NH4+); the relative dominance of these two processes has been suggested to reflect the potential risk of nitrogen loss from soils. Here, we compiled a database and developed a stochastic gradient boosting model to predict the global potential risk of nitrogen loss based on the ratio of nitrification to immobilization (N/I). We then conducted a meta-analysis to evaluate the effects of common management practices on the N/I ratio. The results showed that the soil N/I ratio varied with climate zones and land use. Soil total carbon, total nitrogen, pH, fertilizer nitrogen application rate, mean annual temperature, and mean annual precipitation are important factors of soil N/I ratio. Meta-analysis indicated that biochar, straw, and nitrification inhibitor application reduced the soil N/I ratio by 67, 64, and 78%, respectively. Returning plantation to forest and cropland to grassland decreased the soil N/I ratio by 88 and 45%, respectively. However, fertilizer nitrogen application increased the soil N/I ratio by 92%. Our study showed that the soil N/I ratio and its associated risk level of nitrogen loss were highly related to long-term soil and environmental properties with high spatial heterogeneity.

Policy distortions, farm size, and the overuse of agricultural chemicals in China.

Understanding the reasons for overuse of agricultural chemicals is critical to the sustainable development of Chinese agriculture. Using a nationally representative rural household survey from China, we found that farm size is a strong factor that affects the use intensity of agricultural chemicals across farms in China. Statistically, a 1% increase in farm size is associated with a 0.3% and 0.5% decrease in fertilizer and pesticide use per hectare (P < 0.001), respectively, and an almost 1% increase in agricultural labor productivity, while it only leads to a statistically insignificant 0.02% decrease in crop yields. The same pattern was also found using other independently collected data sources from China and an international panel analysis of 74 countries from the 1960s to the 2000s. While economic growth has been associated with increasing farm size in many other countries, in China this relationship has been distorted by land and migration policies, leading to the persistence of small farm size in China. Removing these distortions would decrease agricultural chemical use by 30-50% and the environmental impact of those chemicals by 50% while doubling the total income of all farmers including those who move to urban areas. Removing policy distortions is also likely to complement other remedies to the overuse problem, such as easing farmer's access to modern technologies and knowledge, and improving environmental regulation and enforcement.

Simultaneous quantification of N2 , NH3 and N2 O emissions from a flooded paddy field under different N fertilization regimes.

Gaseous nitrogen (N) emissions, especially emissions of dinitrogen (N2 ) and ammonia (NH3 ), have long been considered as the major pathways of N loss from flooded rice paddies. However, no studies have simultaneously evaluated the overall response of gaseous N losses to improved N fertilization practices due to the difficulties to directly measure N2 emissions from paddy soils. We simultaneously quantified emissions of N2 (using membrane inlet mass spectrometry), NH3 and nitrous oxide (N2 O) from a flooded paddy field in southern China over an entire rice-growing season. Our field experiment included three treatments: a control treatment (no N addition) and two N fertilizer (220 kg N/ha) application methods, the traditional surface application of N fertilizer and the incorporation of N fertilizer into the soil. Our results show that over the rice-growing season, the cumulative gaseous N losses from the surface application treatment accounted for 13.5% (N2 ), 19.1% (NH3 ), 0.2% (N2 O) and 32.8% (total gaseous N loss) of the applied N fertilizer. Compared with the surface application treatment, the incorporation of N fertilizer into the soil decreased the emissions of NH3 , N2 and N2 O by 14.2%, 13.3% and 42.5%, respectively. Overall, the incorporation of N fertilizer into the soil significantly reduced the total gaseous N loss by 13.8%, improved the fertilizer N use efficiency by 14.4%, increased the rice yield by 13.9% and reduced the gaseous N loss intensity (gaseous N loss/rice yield) by 24.3%. Our results indicate that the incorporation of N fertilizer into the soil is an effective agricultural management practice in ensuring food security and environmental sustainability in flooded paddy ecosystems.

What are the social costs and benefits of lignite application to reduce ammonia emissions in intensive feedlot?

Recent studies demonstrated that lignite application in feedlot can mitigate ammonia (NH3) emission from intensive livestock production, which is an important source of environmental pollution. However, the use of lignite on feedlot requires mining and transport of lignite, which are themselves sources of greenhouse gas and other gaseous pollutants. There is a need for an integrated assessment on the gas emissions to determine the potential impact of those additions to the production chain. Using a case study in Victoria, Australia, carbon dioxide (CO2) and NH3 were identified as key emission changes compared to business as usual (BAU). Social costs and benefits analysis indicated that these changes in emissions translate to social benefits of AUD$11 - $151 and $18 - $256 per cattle per year at lignite application rate of 3 and 6 kg m-2 respectively, while the corresponding social costs of the additional gaseous emissions are AUD$2 - $19 and $3 - $28 per cattle per year per 200 km. Our results indicate that the use of lignite in feedlot to mitigate NH3 can be targeted at feedlots located in proximity to lignite source, population centre and/or vulnerable ecosystems to maximise social benefits and minimise social costs. More broadly, estimating the social costs and benefits of changing manure management practice to mitigate NH3 emission generates information that can be used to evaluate alternative policies for N management.

Changes in grain protein and amino acids composition of wheat and rice under short-term increased [CO2 ] and temperature of canopy air in a paddy from East China.

Projected global climate change is a potential threat for food security. Both rising atmospheric CO2 concentrations ([CO2 ]) and temperatures have significant impacts on crop productivity, but the combined effects on grain quality are not well understood. We conducted an open-air field experiment to determine the impacts of elevated [CO2 ] (E-[CO2 ], up to 500 µmol mol-1 ) and warming (+2°C) on grain yield, protein and amino acid (AAs, acid digests) in a rice-winter wheat rotation system for 2 yr. E-[CO2 ] increased grain yield by 11.3% for wheat and 5.9% for rice, but decreased grain protein concentration by 14.9% for wheat and by 7.0% for rice, although E-[CO2 ] slightly increased the ratio of essential to nonessential AAs. With a consistent decline in grain yield, warming decreased protein yield, notably in wheat, despite a smaller increase in protein concentration. These results indicate that warming could partially negate the negative impact by E-[CO2 ] on grain protein concentration at the expense of grain yield; this tradeoff could not fully offset the negative effects of climate change on crop production.

Toward a Generic Analytical Framework for Sustainable Nitrogen Management: Application for China.

Managing reactive nitrogen (Nr) to achieve a sustainable balance between production of food, feed and fiber, and environmental protection is a grand challenge in the context of an increasingly affluent society. Here, we propose a novel framework for national nitrogen (N) assessments enabling a more consistent comparison of the uses, losses and impacts of Nr between countries, and improvement of Nr management for sustainable development at national and regional scales. This framework includes four key components: national scale N budgets, validation of N fluxes, cost-benefit analysis and Nr management strategies. We identify four critical factors for Nr management to achieve the sustainable development goals: N use efficiency (NUE), Nr recycling ratio (e.g., ratio of livestock excretion applied to cropland), human dietary patterns and food waste ratio. This framework was partly adopted from the European Nitrogen Assessment and now is successfully applied to China, where it contributed to trigger policy interventions toward improvements for future sustainable use of Nr. We demonstrate how other countries can also benefit from the application our framework, in order to include sustainable Nr management under future challenges of growing population, hence contributing to the achievement of some key sustainable development goals (SDGs).

Effect of full substituting compound fertilizer with different organic manure on reactive nitrogen losses and crop productivity in intensive vegetable production system of China.

How substituting compound fertilizer with organic manure affects crop productivity and reactive nitrogen (Nr) losses from vegetable production system during the cradle-to-gate life cycle is not well understood. We thus investigated the impact of substituting compound fertilizer with various organic manures (stored solid manure and composted manure) on spinach productivity, Nr losses (e.g. NH3, N2O, NOx, N-leaching) and yield-based Nr losses in Changsha, Hunan, China. We found that the application of stored solid manure and composted manure decreased the total Nr losses by 58.1% and 75.0%, respectively, compared with compound fertilizer, but the spinach productivity was also decreased by 27.9% and 16.4%. Overall, substituting compound fertilizer with organic manure decreased yield-based Nr loss by 41.9-70.1%. These results highlight that substituting compound fertilizer with organic manure, particularly composted manure, may be beneficial to the environment at the expense of vegetable productivity. Strategies should be developed to decrease Nr losses from N input without compromising productivity in intensive vegetable production system.

Trade-offs between soil carbon sequestration and reactive nitrogen losses under straw return in global agroecosystems.

It is widely recommended that crop straw be returned to croplands to maintain or increase soil carbon (C) storage in arable soils. However, because C and nitrogen (N) biogeochemical cycles are closely coupled, straw return may also affect soil reactive N (Nr) losses, but these effects remain uncertain, especially in terms of the interactions between soil C sequestration and Nr losses under straw addition. Here, we conducted a global meta-analysis using 363 publications to assess the overall effects of straw return on soil Nr losses, C sequestration and crop productivity in agroecosystems. Our results show that on average, compared to mineral N fertilization, straw return with same amount of mineral N fertilizer significantly increased soil organic C (SOC) content (14.9%), crop yield (5.1%), and crop N uptake (10.9%). Moreover, Nr losses in the form of nitrous oxide (N2 O) emissions from rice paddies (17.3%), N leaching (8.7%), and runoff (25.6%) were significantly reduced, mainly due to enhanced microbial N immobilization. However, N2 O emissions from upland fields (21.5%) and ammonia (NH3 ) emissions (17.0%) significantly increased following straw return, mainly due to the stimulation of nitrification/denitrification and soil urease activity. The increase in NH3 and N2 O emissions was significantly and negatively correlated with straw C/N ratio and soil clay content. Regarding the interactions between C sequestration and Nr losses, the increase in SOC content following straw return was significantly and positively correlated with the decrease in N leaching and runoff. However, at a global scale, straw return increased net Nr losses from both rice and upland fields due to a greater stimulation of NH3 emissions than the reduction in N leaching and runoff. The trade-offs between increased net Nr losses and soil C sequestration highlight the importance of reasonably managing straw return to soils to limit NH3 emissions without decreasing associated C sequestration potential.

Using nitrification inhibitors to mitigate agricultural N2 O emission: a double-edged sword?

Nitrification inhibitors show promise in decreasing nitrous oxide (N2 O) emission from agricultural systems worldwide, but they may be much less effective than previously thought when both direct and indirect emissions are taken into account. Whilst nitrification inhibitors are effective at decreasing direct N2 O emission and nitrate (NO3- ) leaching, limited studies suggest that they may increase ammonia (NH3 ) volatilization and, subsequently, indirect N2 O emission. These dual effects are typically not considered when evaluating the inhibitors as a climate change mitigation tool. Here, we collate results from the literature that simultaneously examined the effects of nitrification inhibitors on N2 O and NH3 emissions. We found that nitrification inhibitors decreased direct N2 O emission by 0.2-4.5 kg N2 O-N ha-1 (8-57%), but generally increased NH3 emission by 0.2-18.7 kg NH3 -N ha-1 (3-65%). Taking into account the estimated indirect N2 O emission from deposited NH3 , the overall impact of nitrification inhibitors ranged from -4.5 (reduction) to +0.5 (increase) kg N2 O-N ha-1 . Our results suggest that the beneficial effect of nitrification inhibitors in decreasing direct N2 O emission can be undermined or even outweighed by an increase in NH3 volatilization.

Can knowledge-based N management produce more staple grain with lower greenhouse gas emission and reactive nitrogen pollution? A meta-analysis.

Knowledge-based nitrogen (N) management, which is designed for a better synchronization of crop N demand with N supply, is critical for global food security and environmental sustainability. Yet, a comprehensive assessment on how these N management practices affect food production, greenhouse gas emission (GHG), and N pollution in China is lacking. We compiled the results of 376 studies (1166 observations) to evaluate the overall effects of seven knowledge-based N management practices on crop productivity, nitrous oxide (N2 O) emission, and major reactive N (Nr) losses (ammonia, NH3 ; N leaching and runoff), for staple grain (rice, wheat, and corn) production in China. These practices included the application of controlled-release N fertilizer, nitrification inhibitor (NI) and urease inhibitor (UI), higher splitting frequency of fertilizer N application, lower basal N fertilizer (BF) proportion, deep placement of N fertilizer, and optimal N rate based on soil N test. Our results showed that, compared to traditional N management, these knowledge-based N practices significantly increased grain yields by 1.3-10.0%, which is attributed to the higher aboveground N uptake (5.1-12.1%) and N use efficiency in grain (8.0-48.2%). Moreover, these N management practices overall reduced GHG emission and Nr losses, by 5.4-39.8% for N2 O emission, 30.7-61.5% for NH3 emission (except for the NI application), 13.6-37.3% for N leaching, and 15.5-45.0% for N runoff. The use of NI increased NH3 emission by 27.5% (9.0-56.0%), which deserves extra-attention. The cost and benefit analysis indicated that the yield profit of these N management practices exceeded the corresponding input cost, which resulted in a significant increase of the net economic benefit by 2.9-12.6%. These results suggest that knowledge-based N management practice can be considered an effective way to ensure food security and improve environmental sustainability, while increasing economic return.

How Does Recycling of Livestock Manure in Agroecosystems Affect Crop Productivity, Reactive Nitrogen Losses, and Soil Carbon Balance?

Recycling of livestock manure in agroecosystems to partially substitute synthetic fertilizer nitrogen (N) input is recommended to alleviate the environmental degradation associated with synthetic N fertilization, which may also affect food security and soil greenhouse gas (GHG) emissions. However, how substituting livestock manure for synthetic N fertilizer affects crop productivity (crop yield; crop N uptake; N use efficiency), reactive N (Nr) losses (ammonia (NH3) emission, N leaching and runoff), GHG (methane, CH4; and nitrous oxide, N2O; carbon dioxide) emissions and soil organic carbon (SOC) sequestration in agroecosystems is not well understood. We conducted a global meta-analysis of 141 studies and found that substituting livestock manure for synthetic N fertilizer (with equivalent N rate) significantly increased crop yield by 4.4% and significantly decreased Nr losses via NH3 emission by 26.8%, N leaching by 28.9% and N runoff by 26.2%. Moreover, annual SOC sequestration was significantly increased by 699.6 and 401.4 kg C ha-1 yr-1 in upland and paddy fields, respectively; CH4 emission from paddy field was significantly increased by 41.2%, but no significant change of that was observed from upland field; N2O emission was not significantly affected by manure substitution in upland or paddy fields. In terms of net soil carbon balance, substituting manure for fertilizer increased carbon sink in upland field, but increased carbon source in paddy field. These results suggest that recycling of livestock manure in agroecosystems improves crop productivity, reduces Nr pollution and increases SOC storage. To attenuate the enhanced carbon source in paddy field, appropriate livestock manure management practices should be adopted.

Application of the denitrification-decomposition model to predict carbon dioxide emissions under alternative straw retention methods.

Straw retention has been shown to reduce carbon dioxide (CO2) emission from agricultural soils. But it remains a big challenge for models to effectively predict CO2 emission fluxes under different straw retention methods. We used maize season data in the Griffith region, Australia, to test whether the denitrification-decomposition (DNDC) model could simulate annual CO2 emission. We also identified driving factors of CO2 emission by correlation analysis and path analysis. We show that the DNDC model was able to simulate CO2 emission under alternative straw retention scenarios. The correlation coefficients between simulated and observed daily values for treatments of straw burn and straw incorporation were 0.74 and 0.82, respectively, in the straw retention period and 0.72 and 0.83, respectively, in the crop growth period. The results also show that simulated values of annual CO2 emission for straw burn and straw incorporation were 3.45 t C ha(-1) y(-1) and 2.13 t C ha(-1) y(-1), respectively. In addition the DNDC model was found to be more suitable in simulating CO2 mission fluxes under straw incorporation. Finally the standard multiple regression describing the relationship between CO2 emissions and factors found that soil mean temperature (SMT), daily mean temperature (T mean), and water-filled pore space (WFPS) were significant.

Changes in plant nutrient status following combined elevated [CO2] and canopy warming in winter wheat.

Projected global climate change is a potential threat to nutrient utilization in agroecosystems. However, the combined effects of elevated [CO2] and canopy warming on plant nutrient concentrations and translocations are not well understood. Here we conducted an open-air field experiment to investigate the impact of factorial elevated [CO2] (up to 500 µmol mol-1) and canopy air warming (+2°C) on nutrient (N, P, and K) status during the wheat growing season in a winter wheat field. Compared to ambient conditions, soil nutrient status was generally unchanged under elevated [CO2] and canopy warming. In contrast, elevated [CO2] decreased K concentrations by 11.0% and 11.5% in plant shoot and root, respectively, but had no impact on N or P concentration. Canopy warming increased shoot N, P and K concentrations by 8.9%, 7.5% and 15.0%, but decreased root N, P, and K concentrations by 12.3%, 9.0% and 31.6%, respectively. Accordingly, canopy warming rather than elevated [CO2] increased respectively N, P and K transfer coefficients (defined as the ratio of nutrient concentrations in the shoot to root) by 22.2%, 27.9% and 84.3%, which illustrated that canopy warming played a more important role in nutrient translocation from belowground to aboveground than elevated [CO2]. These results suggested that the response of nutrient dynamics was more sensitive in plants than in soil under climate change.

Trade-offs between wheat soil N2O emissions and C sequestration under straw return, elevated CO2 concentration, and elevated temperature.

The feedback between nitrous oxide (N2O) emissions, straw management and future climate scenarios is not well understood, especially in wheat ecosystems. In this study, the changes in N2O emissions, soil properties, enzymes, and functional genes involved in N cycling were measured with straw return (incorporation and mulching) and straw removal, under elevated [CO2] (+200 µmol mol-1 above ambient [CO2]), elevated temperature (+2 °C above ambient temperature), and their combination. The net global warming potential (NGWP) and greenhouse gas intensity (GHGI) were evaluated in combination with greenhouse gas emissions, yield, and soil organic carbon (C) sequestration. Compared with the ambient condition, elevated [CO2] and elevated temperature suppressed N2O emission by 41 %-46 %. Straw return significantly increased N2O emission by 31 %-109 % through increasing soil C and N substrates and denitrifying genes abundance, compared with straw removal. In addition, the impact of straw return on N2O emission was greater than that of elevated [CO2] or temperature. Straw return generally reduced NGWP by 166.2-3353.3 kg CO2-eq ha-1 and GHGI by 0.4-1.1 kg CO2-eq kg-1 through increasing soil organic C sequestration by 0.1-1.1 t C ha-1 and grain yield by 280.8 kg ha-1-1595.4 kg ha-1. Straw return would stimulate N2O emissions from this wheat cropping system under future warmer, elevated [CO2] climates, but simultaneously increase grain yield and soil organic C sequestration to a greater extent. Overall, straw return is beneficial to climate change mitigation; in particular, straw incorporation would be more effective than straw mulching.

The response of soil-atmosphere greenhouse gas exchange to changing plant litter inputs in terrestrial forest ecosystems.

Various global change factors (e.g. elevated CO2 concentrations, nitrogen deposition, etc.) can alter the amount of litterfall in terrestrial forests, which could subsequently lead to changes in the physical, chemical, and biological properties of forest soils. Yet, there is hitherto a lack of consensus on the role of litter in governing the soil-atmosphere exchange of greenhouse gases (GHGs) in forest ecosystems, which can significantly affect the overall climatic cooling impacts of forests as a net carbon sink. In this study, we carried out a meta-analysis of over 250 field observations to determine the response of soil GHG fluxes to in situ litter manipulation in global forests. Our results showed that overall, litter addition enhanced soil CO2 emissions from terrestrial forests by 26%, while litter removal reduced soil CO2 emissions from these forests by 26%. The negative response of soil CO2 emissions to litter removal was stronger in the tropical forests (-33%) than in the subtropical (-27%) and temperate (-21%) forests, and was significantly correlated with mean annual temperature and precipitation. Moreover, litter removal was observed to enhance soil CH4 uptake in tropical (+24%) and temperate (+9%) forests, but not in subtropical forests. Litter removal reduced N2O emissions from forest soils by 20% on average, with this negative effect increasing with mean annual precipitation. The duration of litter removal experiment was negatively correlated with the response of soil CO2 emissions but had no influence on the response of soil CH4 and N2O fluxes. We found that plant litter supply could alter soil GHG fluxes in forests by modulating the microclimate as well as the labile and recalcitrant soil carbon pools. Our findings highlighted the importance of considering the effects of changing plant litter inputs on soil-atmosphere GHG fluxes in terrestrial forests and their spatio-temporal variability in biogeochemical models.

An optimistic future of C4 crop broomcorn millet (Panicum miliaceum L.) for food security under increasing atmospheric CO2 concentrations.

Broomcorn millet, a C4 cereal, has better tolerance to environmental stresses. Although elevated atmospheric CO2 concentration has led to grain nutrition reduction in most staple crops, studies evaluating its effects on broomcorn millet are still scarce. The yield, nutritional quality and metabolites of broomcorn millet were investigated under ambient CO2 (aCO2, 400 µmol mol-1) and elevated CO2 (eCO2, aCO2+ 200 µmol mol-1) for three years using open-top chambers (OTC). The results showed that the yield of broomcorn millet was markedly increased under eCO2 compared with aCO2. On average, eCO2 significantly increased the concentration of Mg (27.3%), Mn (14.6%), and B (21.2%) over three years, whereas it did not affect the concentration of P, K, Fe, Ca, Cu or Zn. Protein content was significantly decreased, whereas starch and oil concentrations were not changed by eCO2. With the greater increase in grain yield, eCO2 induced increase in the grain accumulations of P (23.87%), K (29.5%), Mn (40.08%), Ca (22.58%), Mg (51.31%), Zn (40.95%), B (48.54%), starch (16.96%) and oil (28.37%) on average for three years. Flavonoids such as kaempferol, apigenin, eriodictyol, luteolin, and chrysoeriol were accumulated under eCO2. The reduction in L-glutamine and L-lysine metabolites, which were the most representative amino acid in grain proteins, led to a reduction of protein concentration under eCO2. Broomcorn millet has more desirable nutritional traits for combating hidden hunger. This may potentially be useful for breeding more nutritious plants in the era of climate change.