EIN2-directed translational regulation of ethylene signaling in Arabidopsis.

Ethylene is a gaseous phytohormone that plays vital roles in plant growth and development. Previous studies uncovered EIN2 as an essential signal transducer linking ethylene perception on ER to transcriptional regulation in the nucleus through a "cleave and shuttle" model. In this study, we report another mechanism of EIN2-mediated ethylene signaling, whereby EIN2 imposes the translational repression of EBF1 and EBF2 mRNA. We find that the EBF1/2 3' UTRs mediate EIN2-directed translational repression and identify multiple poly-uridylates (PolyU) motifs as functional cis elements of 3' UTRs. Furthermore, we demonstrate that ethylene induces EIN2 to associate with 3' UTRs and target EBF1/2 mRNA to cytoplasmic processing-body (P-body) through interacting with multiple P-body factors, including EIN5 and PABs. Our study illustrates translational regulation as a key step in ethylene signaling and presents mRNA 3' UTR functioning as a "signal transducer" to sense and relay cellular signaling in plants. VIDEO ABSTRACT.

ASB13 inhibits breast cancer metastasis through promoting SNAI2 degradation and relieving its transcriptional repression of YAP.

Transcription factor SNAI2 plays key roles during development and has also been known to promote metastasis by inducing invasive phenotype and tumor-initiating activity of cancer cells. However, the post-translational regulation of SNAI2 is less well studied. We performed a dual-luciferase-based, genome-wide E3 ligase siRNA library screen and identified ASB13 as an E3 ubiquitin ligase that targets SNAI2 for ubiquitination and degradation. ASB13 knockout in breast cancer cells promoted cell migration and decreased F-actin polymerization, while overexpression of ASB13 suppressed lung metastasis. Furthermore, ASB13 knockout decreased YAP expression, and such regulation is dependent on an increased protein level of SNAI2, which in turn represses YAP transcription. YAP suppresses tumor progression in breast cancer, as YAP knockout increases tumorsphere formation, anchorage-independent colony formation, cell migration in vitro, and lung metastasis in vivo. Clinical data analysis reveals that ASB13 expression is positively correlated with improved overall survival in breast cancer patients. These findings establish ASB13 as a suppressor of breast cancer metastasis by promoting degradation of SNAI2 and relieving its transcriptional repression of YAP.

Deubiquitinase USP20 promotes breast cancer metastasis by stabilizing SNAI2.

SNAI2/SLUG, a metastasis-promoting transcription factor, is a labile protein that is degraded through the ubiquitin proteasome degradation system. Here, we conducted comprehensive gain- and loss-of-function screens using a human DUB cDNA library of 65 genes and an siRNA library of 98 genes, and identified USP20 as a deubiquitinase (DUB) that regulates SNAI2 ubiquitination and stability. Further investigation of USP20 demonstrated its function in promoting migration, invasion, and metastasis of breast cancer. USP20 positively correlates with SNAI2 protein level in breast tumor samples, and higher USP20 expression is associated with poor prognosis in ER- breast cancer patients.

FOXA2 activates HIF2α expression to promote tumor progression and is regulated by the E3 ubiquitin ligase VHL in renal cell carcinoma.

Renal cell carcinoma (RCC) is a frequent malignancy of the urinary system with high mortality and morbidity. However, the molecular mechanisms underlying RCC progression are still largely unknown. In this study, we identified FOXA2, a pioneer transcription factor, as a driver oncogene for RCC. We show that FOXA2 was commonly upregulated in human RCC samples and promoted RCC proliferation, as evidenced by assays of cell viability, colony formation, migratory and invasive capabilities, and stemness properties. Mechanistically, we found that FOXA2 promoted RCC cell proliferation by transcriptionally activating HIF2α expression in vitro and in vivo. Furthermore, we found that FOXA2 could interact with VHL (von Hippel‒Lindau), which ubiquitinated FOXA2 and controlled its protein stability in RCC cells. We showed that mutation of lysine at position 264 to arginine in FOXA2 could mostly abrogate its ubiquitination, augment its activation effect on HIF2α expression, and promote RCC proliferation in vitro and RCC progression in vivo. Importantly, elevated expression of FOXA2 in patients with RCC positively correlated with the expression of HIF2α and was associated with shorter overall and disease-free survival. Together, these findings reveal a novel role of FOXA2 in RCC development and provide insights into the underlying molecular mechanisms of FOXA2-driven pathological processes in RCC.

Conserved long noncoding RNA TILAM promotes liver fibrosis through interaction with PML in HSCs.

BACKGROUND AND AIMS: Fibrosis is the common end point for all forms of chronic liver injury, and the progression of fibrosis leads to the development of end-stage liver disease. Activation of HSCs and their transdifferentiation into myofibroblasts results in the accumulation of extracellular matrix proteins that form the fibrotic scar. Long noncoding RNAs regulate the activity of HSCs and provide targets for fibrotic therapies. APPROACH AND RESULTS: We identified long noncoding RNA TILAM located near COL1A1 , expressed in HSCs, and induced with liver fibrosis in humans and mice. Loss-of-function studies in human HSCs and human liver organoids revealed that TILAM regulates the expression of COL1A1 and other extracellular matrix genes. To determine the role of TILAM in vivo, we annotated the mouse ortholog ( Tilam ), generated Tilam- deficient green fluorescent protein-reporter mice, and challenged these mice in 2 different models of liver fibrosis. Single-cell data and analysis of single-data and analysis of Tilam-deficient reporter mice revealed that Tilam is induced in murine HSCs with the development of fibrosis in vivo. Tilam -deficient reporter mice revealed that Tilam is induced in murine HSCs with the development of fibrosis in vivo. Furthermore, loss of Tilam expression attenuated the development of fibrosis in the setting of in vivo liver injury. Finally, we found that TILAM interacts with promyelocytic leukemia nuclear body scaffold protein to regulate a feedback loop by which TGF-ß2 reinforces TILAM expression and nuclear localization of promyelocytic leukemia nuclear body scaffold protein to promote the fibrotic activity of HSCs. CONCLUSIONS: TILAM is activated in HSCs with liver injury and interacts with promyelocytic leukemia nuclear body scaffold protein to drive the development of fibrosis. Depletion of TILAM may serve as a therapeutic approach to combat the development of end-stage liver disease.

Arabidopsis EIN2 represses ABA responses during germination and early seedling growth by inactivating HLS1 protein independently of the canonical ethylene pathway.

The signaling pathways for the phytohormones ethylene and abscisic acid (ABA) have antagonistic effects on seed germination and early seedling establishment. However, the underlying molecular mechanisms remain unclear. In Arabidopsis thaliana, ETHYLENE INSENSITIVE 2 (EIN2) localizes to the endoplasmic reticulum (ER); although its biochemical function is unknown, it connects the ethylene signal with the key transcription factors EIN3 and EIN3-LIKE 1 (EIL1), leading to the transcriptional activation of ethylene-responsive genes. In this study, we uncovered an EIN3/EIL1-independent role for EIN2 in regulating the ABA response. Epistasis analysis demonstrated that this distinct role of EIN2 in the ABA response depends on HOOKLESS 1 (HLS1), the putative histone acetyltransferase acting as a positive regulator of ABA responses. Protein interaction assays supported a direct physical interaction between EIN2 and HLS1 in vitro and in vivo. Loss of EIN2 function resulted in an alteration of HLS1-mediated histone acetylation at the ABA-INSENSITIVE 3 (ABI3) and ABI5 loci, which promotes gene expression and the ABA response during seed germination and early seedling growth, indicating that the EIN2-HLS1 module contributes to ABA responses. Our study thus revealed that EIN2 modulates ABA responses by repressing HLS1 function, independently of the canonical ethylene pathway. These findings shed light on the intricate regulatory mechanisms underling the antagonistic interactions between ethylene and ABA signaling, with significant implications for our understanding of plant growth and development.

An alternative splicing variant of PtRD26 delays leaf senescence by regulating multiple NAC transcription factors in Populus.

During leaf senescence, the final stage of leaf development, nutrients are recycled from leaves to other organs, and therefore proper control of senescence is thus critical for plant fitness. Although substantial progress has been achieved in understanding leaf senescence in annual plants, the molecular factors that control leaf senescence in perennial woody plants are largely unknown. Using RNA sequencing, we obtained a high-resolution temporal profile of gene expression during autumn leaf senescence in poplar (Populus tomentosa). Identification of hub transcription factors (TFs) by co-expression network analysis of genes revealed that senescence-associated NAC family TFs (Sen-NAC TFs) regulate autumn leaf senescence. Age-dependent alternative splicing (AS) caused an intron retention (IR) event in the pre-mRNA encoding PtRD26, a NAC-TF. This produced a truncated protein PtRD26IR, which functions as a dominant-negative regulator of senescence by interacting with multiple hub Sen-NAC TFs, thereby repressing their DNA-binding activities. Functional analysis of senescence-associated splicing factors identified two U2 auxiliary factors that are involved in AS of PtRD26IR. Correspondingly, silencing of these factors decreased PtRD26IR transcript abundance and induced early senescence. We propose that an age-dependent increase of IR splice variants derived from Sen-NAC TFs is a regulatory program to fine tune the molecular mechanisms that regulate leaf senescence in trees.

Cel-CS1K: A Celastrol-Chitosan Conjugate for Treating Diet-Induced Obesity.

Celastrol (Cel), extracted from Tripterygium wilfordii Hook, is a potential antiobesity drug, except for its adverse reactions in clinic. In the present study, we synthesized a promising celastrol-chitosan conjugate (Cel-CS1K) and evaluated its antiobesity effect and biological safety in diet-induced obese mice. Cel-CS1K showed higher drug loading (over 10 wt %), good solubility (18-19 mg/mL) in water, slower peak time (Tmax = 4 h), and clearance (T1/2 = 8.97 h) in rats. Cel-CS1K effectively attenuated the cytotoxicity, celastrol-induced apoptosis, and fat accumulation of hepatocytes. Cel-CS1K reduced body weight and dietary amount same as the free Cel but with lower toxicity in blood, liver, and testis. Cel-CS1K improved the glucose homeostasis, HDL-C level, insulin sensitivity, and leptin sensitivity, while it significantly reduced the gene expression levels of LDL-C, TG, and TC in obese mice. Furthermore, the adipose-related gene expression levels provided evidence in support of a role for Cel-CS1K in losing weight by the multimode regulation. Overall, Cel-CS1K provides a translatable therapeutic strategy for the treatment of diet-induced obese humans.

Endoribonuclease DNE1 Promotes Ethylene Response by Modulating EBF1/2 mRNA Processing in Arabidopsis.

The gaseous phytohormone ethylene plays a crucial role in plant growth, development, and stress responses. In the ethylene signal transduction cascade, the F-box proteins EIN3-BINDING F-BOX 1 (EBF1) and EBF2 are identified as key negative regulators governing ethylene sensitivity. The translation and processing of EBF1/2 mRNAs are tightly controlled, and their 3' untranslated regions (UTRs) are critical in these regulations. However, despite their significance, the exact mechanisms modulating the processing of EBF1/2 mRNAs remain poorly understood. In this work, we identified the gene DCP1-ASSOCIATED NYN ENDORIBONUCLEASE 1 (DNE1), which encodes an endoribonuclease and is induced by ethylene treatment, as a positive regulator of ethylene response. The loss of function mutant dne1-2 showed mild ethylene insensitivity, highlighting the importance of DNE1 in ethylene signaling. We also found that DNE1 colocalizes with ETHYLENE INSENSITIVE 2 (EIN2), the core factor manipulating the translation of EBF1/2, and targets the P-body in response to ethylene. Further analysis revealed that DNE1 negatively regulates the abundance of EBF1/2 mRNAs by recognizing and cleaving their 3'UTRs, and it also represses their translation. Moreover, the dne1 mutant displays hypersensitivity to 1,4-dithiothreitol (DTT)-induced ER stress and oxidative stress, indicating the function of DNE1 in stress responses. This study sheds light on the essential role of DNE1 as a modulator of ethylene signaling through regulation of EBF1/2 mRNA processing. Our findings contribute to the understanding of the intricate regulatory process of ethylene signaling and provide insights into the significance of ribonuclease in stress responses.

Arabidopsis NPF2.13 functions as a critical transporter of bacterial natural compound tunicamycin in plant-microbe interaction.

Metabolites including antibiotics, enzymes, and volatiles produced by plant-associated bacteria are key factors in plant-microbiota interaction that regulates various plant biological processes. There should be crucial mediators responsible for their entry into host plants. However, less is known about the identities of these plant transporters. We report that the Arabidopsis Nitrate Transporter1 (NRT1)/NPF protein NPF2.13 functions in plant uptake of tunicamycin (TM), a natural antibiotic produced by several Streptomyces spp., which inhibits protein N-glycosylation. Loss of NPF2.13 function resulted in enhanced TM tolerance, whereas NPF2.13 overexpression led to TM hypersensitivity. Transport assays confirmed that NPF2.13 is a H+ /TM symporter and the transport is not affected by other substrates like nitrate. NPF2.13 exclusively showed TM transport activity among tested NPFs. Tunicamycin uptake from TM-producing Streptomyces upregulated the expression of nitrate-related genes including NPF2.13. Moreover, nitrate allocation to younger leaves was promoted by TM in host plants. Tunicamycin could also benefit plant defense against the pathogen. Notably, the TM effects were significantly repressed in npf2.13 mutant. Overall, this study identifies NPF2.13 protein as an important TM transporter in plant-microbe interaction and provides insights into multiple facets of NPF proteins in modulating plant nutrition and defense by transporting exterior bacterial metabolites.

A novel 22-bp InDel within FGF7 gene is significantly associated with growth traits in goat.

Fibroblast growth factor 7 (FGF7) is involved in lipid metabolism, which is considered as a candidate gene with close relation with muscle development by eGWAs and RNA-Seq analyses. To date, limited research has been conducted on the relationship between FGF7 gene and growth traits. The main objective of this work was to further investigate the association between novel InDel within FGF7 gene and growth traits in goat. Herein, FGF7 mRNA expression levels were investigated in various Fuqing goat tissues. We found that FGF7 gene was expressed in six adult goat tissues with the highest mRNA levels in adipose tissue. This result suggested that FGF7 gene might play a critical role in fat deposition. We also detected potential polymorphisms in Fuqing, Nubian and Jianyang Daer breeds. A 22-bp InDel polymorphism in FGF7 gene was detected in 396 goats and the three genotypes were designated as II, ID, and DD. Correlation analysis revealed that InDel polymorphism was significantly associated with growth traits (P < 0.05). Goats with genotypes ID and/or II had superior growth traits compared to those with genotype DD. In summary, our findings suggested that the 22-bp InDel within FGF7 gene could act as a molecular marker to improve the growth traits of goats in breeding programs.

A novel splice variant of goat CPT1a gene and their diverse mRNA expression profiles.

The Alternative splicing (AS) of Carnitine palmitoyltransferase 1a (CPT1a) and their expression profiles had never been illuminated in goats until now. Herein, a novel splice transcript in the CPT1a gene that is predicted to result in the skipping of exons 6-19 (CPT1a-sv1) has been isolated in addition to the full-length transcript in goats. The result of RT-PCR showed that CPT1a-sv1 is 606 bp in length and consists of 6 exons. A novel exon 6 was consisted of partial exon 5 and partial exon 19, compared to that in CPT1a. RT-qPCR analysis showed that the expression patterns of CPT1a and CPT1a-sv1 are spatially different. In both kid and adult goats, the CPT1a transcript is strongly expressed in the liver, spleen, lung, kidney, and brain tissues. However, CPT1a-sv1 has a strong tissue-specific expression pattern, with moderate RNA levels in the liver and brain of kids, while highly expressed in the liver and minimally expressed in the brain of adults. We observed two transcripts to be involved in brain development. These findings improve our understanding of the function of the CPT1a gene in goats and provide information on the molecular mechanism of AS events.

Transcriptome expression profiles associated with diabetic nephropathy development.

The objective of this study was to identify different transcriptome expression profiles involved in the pathogenesis of diabetic nephropathy (DN) and to illustrate the diagnostic and therapeutic potential of mRNAs, long noncoding RNAs (lncRNAs), and circular RNAs (circRNAs) in DN progression. The participants were divided into four groups: normoalbuminuria (group DM), microalbuminuria (group A2), macroalbuminuria (group A3) and healthy controls (group N). There were three individuals in each group for sequencing. Transcriptome sequencing analysis was performed on the peripheral blood of all the participants to identify the differential expression of mRNAs, lncRNAs, and circRNAs between intervention groups and controls. The functional enrichment analysis, the short time-series expression miner (STEM) program, and the miRNA-circRNA-mRNA network were further conducted. To verify the reproducibility of transcriptome sequencing, 10 and 30 blood samples were collected from the control and diseased groups, respectively. Four candidate biomarkers were selected from differentially expressed circRNAs (circ_0005379, circ_0002024, and circ_0000567, and circ_0001017) and their concentrations in the blood were measured using quantitative PCR (qPCR). In the comparison of A2 with N, 549 mRNAs, 1259 lncRNAs, and 12 circRNAs were screened. In the comparison of A3 with N, 1217 mRNAs, 1613 lncRNAs, and 24 circRNAs were screened. Moreover, in the comparison of diabetes mellitus (DM) with N, 948 mRNAs, 1495 lncRNAs, and 25 circRNAs were screened. Functional enrichment analysis showed that differentially expressed mRNAs were related to insulin secretion, insulin resistance, and inflammation, while differentially expressed lncRNAs were mainly associated with crossover junction endodeoxyribonuclease activity. In STEM analysis, a total of 481 mRNAs and 152 differential expression circRNAs showed a significant tendency. The key relationships in the miRNA-circRNA-mRNA network were identified, such as hsa-miR-103a-3p-circ_0005379-PTEN, hsa-miR-497-5p-circ_0002024-IGF1R and hsa-miR-1269a-circ_0000567-SOX6. In addition, qPCR showed consistent results with RNA sequencing. We found that differentially expressed mRNAs, lncRNAs, and circRNAs participated in DN development. Circ_0005379, circ_0002024, and circ_0000567 could be adopted as potential biomarkers for DN.

Transcriptomics revealed the effect of astaxanthin on apoptosis and immunity of the adult prawn of Exopalaemon carinicauda.

Astaxanthin (Axn), a common aquatic feed additive, can enhance immunity, improve the antioxidant capacity of the crustacean and then improve the anti-stress ability of crustaceans. Exopalaemon carinicauda (E. carinicauda) is an economically important fishery species in China that has been found that dietary Axn can significantly increase ACP and AKP compared to a control diet for shrimp hepatopancreas in this study. RNA-sequencing and comparative transcriptomic analyses were utilized to explore changes in E. carinicauda gene expression following Axn feeding. Differential gene expression analyses comparing the control and Axn groups identified 631 transcripts that were differentially expressed following Axn feeding, of which 314 and 317 were respectively upregulated and downregulated. Functional enrichment analyses of these genes revealed their enrichment in 22 Gene Ontology categories and 11 KEGG pathways. In the GO and KEGG enrichment analysis, it was found that dietary astaxanthin can regulate the gene expression level of adult E. carinicauda. Many of the signal pathways enriched by these genes are related to immunity, apoptosis and anti-stress. In addition, through KEGG enrichment analysis, it was found that dietary Axn could also regulate the amino acid metabolism of hepatopancreas of adult E. carinicauda. The comprehensive comparative transcriptomic analysis showed that Axn could improve the hepatopancreatic immunity and anti-apoptosis ability of adult E. carinicauda.

Nanostructured transition-metal phthalocyanine complexes for catalytic oxygen reduction reaction.

Oxygen reduction reaction (ORR) plays a key role in the field of fuel cells. Efficient electrocatalysts for the ORR are important for fuel cells commercialization. Pt and its alloys are main active materials for ORR. However, their high cost and susceptibility to time-dependent drift hinders their applicability. Satisfactory catalytic activity of nanostructured transition metal phthalocyanine complexes (MPc) in ORR through the occurrence of molecular catalysis on the surface of MPc indicates their potential as a replacement material for precious-metal catalysts. Problems of MPc are analyzed on the basis of chemical structure and microstructure characteristics used in oxygen reduction catalysis, and the strategy for controlling the structure of MPc is proposed to improve the catalytic performance of ORR in this review.

Discriminant models for the prediction of postponed viral shedding time and disease progression in COVID-19.

BACKGROUND: COVID-19 infection can cause life-threatening respiratory disease. This study aimed to fully characterize the clinical features associated with postponed viral shedding time and disease progression, then develop and validate two prognostic discriminant models. METHODS: This study included 125 hospitalized patients with COVID-19, for whom 44 parameters were recorded, including age, gender, underlying comorbidities, epidemiological features, laboratory indexes, imaging characteristics and therapeutic regimen, et al. Fisher's exact test and Mann-Whitney test were used for feature selection. All models were developed with fourfold cross-validation, and the final performances of each model were compared by the Area Under Receiving Operating Curve (AUROC). After optimizing the parameters via L2 regularization, prognostic discriminant models were built to predict postponed viral shedding time and disease progression of COVID-19 infection. The test set was then used to detect the predictive values via assessing models' sensitivity and specificity. RESULTS: Sixty-nine patients had a postponed viral shedding time (> 14 days), and 28 of 125 patients progressed into severe cases. Six and eleven demographic, clinical features and therapeutic regimen were significantly associated with postponed viral shedding time and disease progressing, respectively (p < 0.05). The optimal discriminant models are: y1 (postponed viral shedding time) = - 0.244 + 0.2829x1 (the interval from the onset of symptoms to antiviral treatment) + 0.2306x4 (age) + 0.234x28 (Urea) - 0.2847x34 (Dual-antiviral therapy) + 0.3084x38 (Treatment with antibiotics) + 0.3025x21 (Treatment with Methylprednisolone); y2 (disease progression) = - 0.348-0.099x2 (interval from Jan 1st,2020 to individualized onset of symptoms) + 0.0945x4 (age) + 0.1176x5 (imaging characteristics) + 0.0398x8 (short-term exposure to Wuhan) - 0.1646x19 (lymphocyte counts) + 0.0914x20 (Neutrophil counts) + 0.1254x21 (Neutrphil/lymphocyte ratio) + 0.1397x22 (C-Reactive Protein) + 0.0814x23 (Procalcitonin) + 0.1294x24 (Lactic dehydrogenase) + 0.1099x29 (Creatine kinase).The output ≥ 0 predicted postponed viral shedding time or disease progressing to severe/critical state. These two models yielded the maximum AUROC and faired best in terms of prognostic performance (sensitivity of78.6%, 75%, and specificity of 66.7%, 88.9% for prediction of postponed viral shedding time and disease severity, respectively). CONCLUSION: The two discriminant models could effectively predict the postponed viral shedding time and disease severity and could be used as early-warning tools for COVID-19.

Evaluation of a non-contact ultra-wideband bio-radar sleep monitoring device for screening of sleep breathing disease.

PURPOSE: Ultra-wideband bio-radar (UWB) is a new non-contact technology that can be used to screen for obstructive sleep apnea (OSA). However, little information is available regarding its reliability. This study aimed to evaluate the effectiveness of UWB and to determine if UWB could provide a novel and reliable method for the primary screening of sleep-related breathing disorders. METHOD: Subjects with suspected OSA from the sleep center of the First Hospital of the China Medical University were assessed over the period of September 2018 to April 2019 for enrollment in the study. Three detection methods were simultaneously used, including the STOP-Bang questionnaire (SBQ), UWB, and standard polysomnography (PSG). The data were analyzed using a fourfold table, receiver operating characteristic curves, Spearman rank correlation coefficients, Bland-Altman plots, and epoch-by-epoch analysis. RESULT: Of 67 patients, 56 were men, mean age was 43 ± 11 years, mean body mass index was 27.8 ± 4.8 kg/m2, and mean SBQ score was 4.8 ± 1.6. The apnea-hypopnea index (AHI) (r = 0.82, p < 0.01) and minimum arterial oxygen saturation (r = 0.80, p < 0.01) of the UWB were positively correlated with those obtained from the PSG. UWB performed better than SBQ, as indicated by the larger area under the curve (0.85 vs. 0.632). The sensitivity and specificity of the UWB-AHI were good (100%, 70%, respectively). CONCLUSIONS: UWB performs well in the screening of OSA and can provide reliable outcomes for the screening of OSA at the primary level.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

First record of Aphelenchoides besseyi on foxtail millet (Setaria italica) in Henan Province of China.

Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027″ and E113° 39' 059″) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.

Growth asymmetry precedes differential auxin response during apical hook initiation in Arabidopsis.

The development of a hook-like structure at the apical part of the soil-emerging organs has fascinated botanists for centuries, but how it is initiated remains unclear. Here, we demonstrate with high-throughput infrared imaging and 2-D clinostat treatment that, when gravity-induced root bending is absent, apical hook formation still takes place. In such scenarios, hook formation begins with a de novo growth asymmetry at the apical part of a straightly elongating hypocotyl. Remarkably, such de novo asymmetric growth, but not the following hook enlargement, precedes the establishment of a detectable auxin response asymmetry, and is largely independent of auxin biosynthesis, transport and signaling. Moreover, we found that functional cortical microtubule array is essential for the following enlargement of hook curvature. When microtubule array was disrupted by oryzalin, the polar localization of PIN proteins and the formation of an auxin maximum became impaired at the to-be-hook region. Taken together, we propose a more comprehensive model for apical hook initiation, in which the microtubule-dependent polar localization of PINs may mediate the instruction of growth asymmetry that is either stochastically taking place, induced by gravitropic response, or both, to generate a significant auxin gradient that drives the full development of the apical hook.