RESUMEN
RAS is a signaling protein associated with the cell membrane that is mutated in up to 30% of human cancers. RAS signaling has been proposed to be regulated by dynamic heterogeneity of the cell membrane. Investigating such a mechanism requires near-atomistic detail at macroscopic temporal and spatial scales, which is not possible with conventional computational or experimental techniques. We demonstrate here a multiscale simulation infrastructure that uses machine learning to create a scale-bridging ensemble of over 100,000 simulations of active wild-type KRAS on a complex, asymmetric membrane. Initialized and validated with experimental data (including a new structure of active wild-type KRAS), these simulations represent a substantial advance in the ability to characterize RAS-membrane biology. We report distinctive patterns of local lipid composition that correlate with interfacially promiscuous RAS multimerization. These lipid fingerprints are coupled to RAS dynamics, predicted to influence effector binding, and therefore may be a mechanism for regulating cell signaling cascades.
Asunto(s)
Membrana Celular/enzimología , Lípidos/química , Aprendizaje Automático , Simulación de Dinámica Molecular , Multimerización de Proteína , Proteínas Proto-Oncogénicas p21(ras)/química , Transducción de Señal , HumanosRESUMEN
Maize (Zea mays L.) is one of three major grain crops in China, with production reaching 261 million tons in 2019(NBS, 2020). Some fungi cause maize ear rot which lead to significant yield and quality losses. In 2016, about 5% of maize ears were dark brown and covered with a white mould in seed production fields in Lingshui, Hainan Province, China. These ears were brought back to the laboratory for analysis. Molded kernels were surface sterilized in 75% ethanol for 3 min and in 10% sodium hypochlorite for 3 min, subsequently rinsed three times in sterile-distilled water, placed onto potato dextrose agar (PDA), and incubated at 28°C in the dark for 3 days. mycelia tips grown from kernels were transferred into fresh PDA plates. Seven fungal isolates with similar morphology characteristics were obtained, and three of them were identified by morphology and molecular identification. The colonies grew rapidly. The aerial mycelia turned white to black with age. Conidia were straight to slightly curved, oval, pyriform or geniculate, brown to dark brown, and had 2 to 7 septa, with both basal and caudal septa thicker and darker than others, 39.47 to 78.66 ×13.96 to 22.78 µm, with a distinctly protruding hilum swelled from the basal cell. Conidiophores were dark brown, with geniculate tip and many septa. For molecular identification, genomic DNA of isolate was extracted from mycelia. The internal transcribed spacer (ITS), 1,3,8-trihydroxynaphthalene reductase (Brn) and glyceraldehyde-3-phosphate dehydrogenase-like (Gpd) genes were amplified with primers ITS1/ITS4 (White et al. 1990), Brn01/Brn02 (Shimizu et al. 1998) and gpd1/gpd 2 (Berbee et al. 1999) , respectively. BLASTn analysis showed that high identities with Exserohilum rostratum (ITS, LT837845.1, 100%; Brn, AY621165.1, 99.87%; Gpd, LT882543.1, 99.75%). Sequences of ITS, Brn and Gpd were deposited in GenBank with accession numbers MW362495, MW363953 and MW363954, respectively. Based on morphological characteristics and molecular analysis, the isolate was identified as E. rostratum (Hernández-Restrepo et al. 2018). Koch's postulates were completed by using ears of maize inbred line Huangzaosi and Chang7-2 growing in the experimental field of Baoding, Hebei Province. Three days post-silk emergence, each of the four maize ears was injected with 2 ml conidial suspension (1×106 conidia/ml) of isolate ZBSF005 through the silk channel. In the control groups, three ears were inoculated with an equal amount of sterile-distilled water. The inoculated ears grew under natural conditions for 30 days, the diseased kernels and ear tips were black brown and the surface covered with white or gray black mildew layer. The kernels with severe infection were wizened. But the bract could not be infected by the pathogen. Meanwhile, the control remained asymptomatic. The same fungus was successfully re-isolated from the inoculated kernels, and its identity was confirmed by morphological and molecular biology approaches, thus fulfilling Koch's postulates. E. rostratum has been reported to cause leaf spots in a wide range of hosts, such as Calathea picturata, Lagenaria siceraria, Saccharum officinarum, Ananas comosus, Hevea brasiliensis, Zea mays and so on (Chern et al. 2011; Ahmadpour et al. 2013; Choudhary et al. 2018), and it was also reported to cause root rot in Lactuca saliva (Saad et al. 2019). To our knowledge, this is the first report of E. rostratum causing maize ear rot in China. The pathogen was simultaneously inoculated to 8 maize inbred lines in Hebei province, but the disease only occurred in some varieties and the incidence area was large. Therefore, attention should be paid to the prevention and treatment of ear rot caused by this pathogen in the breeding process.
RESUMEN
Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28â in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 µm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.
RESUMEN
Ear rot is one of the most prevalent and destructive diseases of maize. During field surveys, it was found that a Penicillium ear rot broke out in some areas of Shanxi, Shaanxi, Hebei, and Tianjin in China, with an incidence of 3 to 90%. A Penicillium sp. was isolated from diseased kernels covered with greyish green mold, and three isolates were identified by morphologic and molecular characteristics. The pathogenicity of isolate ZBS205 to maize ears was further determined by artificial inoculation in a field. Furthermore, the sensitivity of isolate ZBS205 against six commonly used fungicides was also evaluated. According to macro- and micromorphologic characteristics, isolate ZBS205 was generally identical to Talaromyces funiculosus (teleomorph of Penicillium funiculosum). The partial gene sequences of the nuclear ribosomal ITS1-5.8S-ITS2 (ITS) region, ß-tubulin, putative ribosome biogenesis protein (Tsr1), and the second largest subunit of the RNA polymerase II (RPB2) from isolates ZBS205, D49-1, and S73-1 showed the highest nucleotide identity to T. funiculosus strain X33, and the phylogenetic analysis conducted by the neighbor-joining method with the combined data of the four genes demonstrated that these three isolates clustered with T. funiculosus strain X33. These results suggested that the fungus isolated from diseased maize kernels was T. funiculosus. Pathogenicity testing showed that the T. funiculosus isolate ZBS205 was pathogenic to maize ears, which showed symptoms of rotted cob and deteriorated kernels. This is the first report of T. funiculosus as the definitive pathogen causing maize ear rot. The result of fungal sensitivity against fungicides showed that pyraclostrobin exhibited the highest toxicity to mycelial growth and could be used as a candidate agent for the prevention and control of T. funiculosus ear rot. The results of the present study provide a basis for understanding ear rot caused by T. funiculosus, and they should play an important role in disease management.
Asunto(s)
Fungicidas Industriales , Talaromyces , Fungicidas Industriales/farmacología , Filogenia , Enfermedades de las Plantas , Talaromyces/genética , Zea maysRESUMEN
Nanomaterials of varying compositions and morphologies are of interest for many applications from catalysis to optics, but the synthesis of nanomaterials and their scale-up are most often time-consuming and Edisonian processes. Information gleaned from the scientific literature can help inform and accelerate nanomaterials development, but again, searching the literature and digesting the information are time-consuming manual processes for researchers. To help address these challenges, we developed scientific article-processing tools that extract and structure information from the text and figures of nanomaterials articles, thereby enabling the creation of a personalized knowledgebase for nanomaterials synthesis that can be mined to help inform further nanomaterials development. Starting with a corpus of â¼35k nanomaterials-related articles, we developed models to classify articles according to the nanomaterial composition and morphology, extract synthesis protocols from within the articles' text, and extract, normalize, and categorize chemical terms within synthesis protocols. We demonstrate the efficiency of the proposed pipeline on an expert-labeled set of nanomaterials synthesis articles, achieving 100% accuracy on composition prediction, 95% accuracy on morphology prediction, 0.99 AUC on protocol identification, and up to a 0.87 F1-score on chemical entity recognition. In addition to processing articles' text, microscopy images of nanomaterials within the articles are also automatically identified and analyzed to determine the nanomaterials' morphologies and size distributions. To enable users to easily explore the database, we developed a complementary browser-based visualization tool that provides flexibility in comparing across subsets of articles of interest. We use these tools and information to identify trends in nanomaterials synthesis, such as the correlation of certain reagents with various nanomaterial morphologies, which is useful in guiding hypotheses and reducing the potential parameter space during experimental design.
Asunto(s)
Nanoestructuras , Catálisis , Bases de Datos Factuales , Aprendizaje Automático , Programas InformáticosRESUMEN
In eukaryotic organisms, histone acetyltransferase complexes are coactivators that are important for transcriptional activation by modifying chromatin. In this study, a gene (PsGcn5) from Phytophthora sojae encoding a histone acetyltransferase was identified as a homolog of one component of the histone acetyltransferase complex from yeasts to mammals. PsGcn5 was constitutively expressed in each stage tested, but had a slightly higher expression in sporulating hyphae and 3 h after infection. PsGcn5-silenced mutants were generated using polyethylene glycol-mediated protoplast stable transformation. These mutants had normal development, but compared to wild type strains they had higher sensitivity to hydrogen peroxide (H2O2) and significantly reduced virulence in soybean. Diaminobenzidine staining revealed an accumulation of H2O2 around the infection sites of PsGcn5-silenced mutants but not for wild type strains. Inhibition of the plant NADPH oxidase by diphenyleneiodonium prevented host-derived H2O2 accumulation in soybean cells and restored infectious hyphal growth of the mutants. Thus, we concluded that PsGcn5 is important for growth under conditions of oxidative stress and contributes to the full virulence of P. sojae by suppressing the host-derived reactive oxygen species.
Asunto(s)
Histona Acetiltransferasas/metabolismo , Estrés Oxidativo , Phytophthora/enzimología , Phytophthora/fisiología , Factores de Virulencia/metabolismo , Perfilación de la Expresión Génica , Regulación de la Expresión Génica , Técnicas de Silenciamiento del Gen , Peróxido de Hidrógeno/análisis , Phytophthora/genética , Enfermedades de las Plantas/microbiología , Glycine max , VirulenciaRESUMEN
Ezrin, a member of the ezrin/radixin/moesin (ERM) protein family, plays an important role in tumor metastasis. Accumulating studies demonstrated that a high expression level of human ezrin has been correlated with numerous human malignancies. This study was aimed to explore the clinicopathological significance of ezrin protein expression in pancreatic ductal adenocarcinomas (PDAC), and to further identify its role as a potential biomarker and therapeutic target of PDAC. Immunohistochemical (IHC) staining of ezrin protein was performed on 106 PDAC tissue samples and 37 adjacent and 21 normal pancreatic tissue samples. Additionally, localization of ezrin protein in Panc-1 PDAC cell line was observed using immunofluorescence (IF) staining. The correlation between ezrin overexpression and the clinicopathological features of PDAC was evaluated using Chi-square test, and differences in survival curves were analyzed using log-rank tests. In results, ezrin protein is widely distributed in the cytoplasm and membrane of PDAC cells by IHC and IF staining, but some cases showed a cell membrane staining pattern. The positive rate of ezrin protein expression was 82.1% (87/106) in PDAC, which was significantly higher than it in either adjacent pancreatic tissues (37.8%, 14/37) or normal pancreatic tissues (19.0%, 4/21). Overexpression of ezrin was closely related with larger tumor size, positive lymph node metastasis and advanced clinical stage. However, it was not correlated with patient age, gender, differentiation, Ki-67 expression index, and pancreas calcification point. Survival analysis showed that patients with ezrin high expression level had significantly lower overall survival rate than that with ezrin low expression level. Importantly, further analysis using a Cox proportional hazard regression model revealed that high ezrin expression emerged as a significant independent hazard factor for overall survival rates of patients with PDAC along with lymph node metastasis and TNM stage. In conclusion, ezrin protein played an important role in the progression of PDAC, and the overexpression of ezrin protein might be a useful prognostic marker of PDAC.
Asunto(s)
Adenocarcinoma/metabolismo , Biomarcadores de Tumor/metabolismo , Carcinoma Ductal Pancreático/metabolismo , Proteínas del Citoesqueleto/metabolismo , Páncreas/metabolismo , Neoplasias Pancreáticas/metabolismo , Adenocarcinoma/mortalidad , Adenocarcinoma/secundario , Carcinoma Ductal Pancreático/mortalidad , Carcinoma Ductal Pancreático/secundario , Progresión de la Enfermedad , Femenino , Estudios de Seguimiento , Humanos , Técnicas para Inmunoenzimas , Metástasis Linfática , Masculino , Persona de Mediana Edad , Estadificación de Neoplasias , Páncreas/patología , Neoplasias Pancreáticas/mortalidad , Neoplasias Pancreáticas/patología , Pronóstico , Tasa de Supervivencia , Neoplasias PancreáticasRESUMEN
Sineoculis homeobox homolog 1 (SIX1) is a member of the SIX gene family. It is highly expressed in cancers derived from tissues that play a fundamental role during embryogenesis. Recent studies suggest that inappropriate expression of SIX1 can both initiate tumorigenesis and promote metastasis. To investigate the clinicopathological significance of SIX1 expression in pancreatic ductal adenocarcinoma (PDAC), and to further identify its role as a potential biomarker and therapeutic target in PDAC, 103 PDAC tissue samples and 45 normal pancreatic tissue samples were immunohistochemically stained for SIX1 protein. The localization of SIX1 protein was detected in Panc-1 cancer cells using immunofluorescence staining. Correlations between SIX1 overexpression and the clinicopathological features of pancreatic cancer were evaluated using Chi-square (χ(2)) tests, differences in survival curves were analyzed using log-rank tests, and multivariate survival analysis was performed using the Cox proportional hazard regression model. In results, SIX1 protein showed mainly cytoplasmic/perinuclear staining pattern in PDAC with immunohistochemistry. The strongly positive rate of SIX1 protein was 60.2% (62/103) in PDAC, which was significantly higher than normal pancreatic tissue (6.7%, 3/45). SIX1 overexpression was positively correlated with tumor size, TNM stage, lymph node metastasis, and grade of PDAC (P < 0.001). SIX1 high expression levels influenced overall survival rates in G1, G2, stage I-II and stage III-IV groups of PDAC; and high expression levels had significantly lower overall survival rates than SIX1 low expression levels. In conclusion, SIX1 emerged as a significant independent prognostic factor in PDAC. SIX1 overexpression appears to be associated with PDAC, and may be a potential biomarker for early diagnosis and prognostic evaluation of PDAC.
Asunto(s)
Adenocarcinoma/mortalidad , Biomarcadores de Tumor/metabolismo , Carcinoma Ductal Pancreático/mortalidad , Proteínas de Homeodominio/metabolismo , Páncreas/metabolismo , Neoplasias Pancreáticas/mortalidad , Adenocarcinoma/metabolismo , Adenocarcinoma/patología , Adulto , Anciano , Carcinoma Ductal Pancreático/metabolismo , Carcinoma Ductal Pancreático/patología , Femenino , Técnica del Anticuerpo Fluorescente , Humanos , Técnicas para Inmunoenzimas , Metástasis Linfática , Masculino , Persona de Mediana Edad , Clasificación del Tumor , Estadificación de Neoplasias , Neoplasias Pancreáticas/metabolismo , Neoplasias Pancreáticas/patología , Pronóstico , Tasa de SupervivenciaRESUMEN
LiYF4:18%Yb, 2%Er nanocrystals and NaYF4:18%Yb,2% Er nanoparticles (NCs) were synthesized by a solvothermal approach using oleic acid (OA) as the surfactant. With the excitation of a 980 nm diode laser, LiYF4:18%Yb, 2%Er NCs exhibit more strong emission than alpha-NaYF4:18%Yb, 2%Er at around 1530 nm. The TEM images showed that the LiYF4:18%Yb, 2%Er NCs have a nearly spherical shape and the size is about 15 nm. The OA-capped LiYF4 NCs have excellent dispersibility in organic solvents. These results showed that LiYF4:18%Yb, 2%Er NCs are a promising material for polymer-based optical waveguide amplifiers.
RESUMEN
Learning and memory disorder is a cluster of symptoms caused by neuronal aging and other diseases of the central nervous system (CNS). Panax notoginseng saponins (PNS) are a series of saponins derived from the natural active ingredients of traditional Chinese medicine (TCM) that have neuroprotective effects on the central nervous system. In this paper, we review the ameliorative effects and mechanisms of Panax notoginseng saponin-like components on learning and memory disorders to provide valuable references and insights for the development of new drugs for the treatment of learning and memory disorders. Our summary results suggest that Panax ginseng saponins have significant effects on improving learning and memory disorders, and these effects and potential mechanisms are mediated by their anti-inflammatory, anti-apoptotic, antioxidant, ß-amyloid lowering, mitochondrial homeostasis in vivo, neuronal structure and function improving, neurogenesis promoting, neurotransmitter release regulating, and probiotic homeostasis in vivo activities. These findings suggest the potential of Panax notoginseng saponin-like constituents as drug candidates for improving learning and memory disorders.
RESUMEN
ETHNOPHARMACOLOGICAL RELEVANCE: Qilong capsule (QC) is developed from the traditional Chinese medicine formula Buyang Huanwu Decoction, which has been clinically used to invigorate Qi and promote blood circulation to eliminate blood stasis. Myocardial ischemiaâreperfusion injury (MIRI) can be attributed to Qi deficiency and blood stasis. However, the effects of QC on MIRI remain unclear. AIM OF THE STUDY: This study aimed to investigate the protective effect and possible mechanism of QC on platelet function in MIRI rats. MATERIALS AND METHODS: The left anterior descending artery of adult SpragueâDawley rats was ligated for 30 min and then reperfused for 120 min with or without QC treatment. Then, the whole blood viscosity, plasma viscosity, coagulation, platelet adhesion rate, platelet aggregation, and platelet release factors were evaluated. Platelet CD36 and its downstream signaling pathway-related proteins were detected by western blotting. Furthermore, the active components of QC and the molecular mechanism by which QC regulates platelet function were assessed via molecular docking, platelet aggregation tests in vitro and BLI analysis. RESULTS: We found that QC significantly reduced the whole blood viscosity, plasma viscosity, platelet adhesion rate, and platelet aggregation induced by ADP or AA in rats with MIRI. The inhibition of platelet activation by QC was associated with reduced levels of ß-TG, PF-4, P-selectin and PAF. Mechanistically, QC effectively attenuated the expression of platelet CD36 and thus inhibited the activation of Src, ERK5, and p38. The active components of QC apparently suppressed platelet aggregation in vitro and regulated the CD36 signaling pathway. CONCLUSIONS: QC improves MIRI-induced hemorheological disorders, which might be partly attributed to the inhibition of platelet activation via CD36-mediated platelet signaling pathways.
Asunto(s)
Plaquetas , Antígenos CD36 , Medicamentos Herbarios Chinos , Daño por Reperfusión Miocárdica , Activación Plaquetaria , Agregación Plaquetaria , Ratas Sprague-Dawley , Transducción de Señal , Animales , Medicamentos Herbarios Chinos/farmacología , Medicamentos Herbarios Chinos/química , Transducción de Señal/efectos de los fármacos , Masculino , Activación Plaquetaria/efectos de los fármacos , Antígenos CD36/metabolismo , Plaquetas/efectos de los fármacos , Plaquetas/metabolismo , Daño por Reperfusión Miocárdica/prevención & control , Daño por Reperfusión Miocárdica/tratamiento farmacológico , Daño por Reperfusión Miocárdica/metabolismo , Agregación Plaquetaria/efectos de los fármacos , Ratas , Simulación del Acoplamiento MolecularRESUMEN
Aim: Stressful life events have a significant impact on the mental health of college students. Depression, as a prevalent psychological issue, has garnered attention in the field of college student mental health and is closely linked to it. Additionally, parenting style is identified as an important factor influencing the development of college students' mental health. Therefore, this study aims to explore the relationship between these three factors. Methods: A total of 8079 first-year college students from two medical universities in Shandong Province, China were surveyed. The Beck Depression Inventory was utilized to evaluate depressive symptoms among the college students, while the Adolescent Self-rating Life Events Checklist and the Egna Minnen Beträfande Uppfostran were employed to gather data. Subsequently, the SPSS macro program PROCESS was utilized to analyze both the mediating and moderating effects. All statistical analyses were conducted using SPSS 26.0. Results: The study found a detection rate of 6.3% for depressive symptoms among college students. The correlation analysis of this study showed that the stressful life events of college students were significantly positively correlated with depressive symptoms (r=0.261, p< 0.01). Each dimension of parenting style was associated with depressive symptoms in different degrees and directions. At the same time, parenting styles of all sizes play a partial mediating role between stressful life events and depressive symptoms in college students, gender plays a crucial regulatory role in this mediation. Conclusion: Stressful life events experienced by college students have a significant impact on their mental health. Early intervention through positive parenting styles from parents may prove to be beneficial in promoting the development of good mental health among college students.
RESUMEN
OBJECTIVE: Brain microvascular endothelial cells (BMECs) were found to shift from their usually inactive state to an active state in ischemic stroke (IS) and cause neuronal damage. Ginsenoside Rb1 (GRb1), a component derived from medicinal plants, is known for its pharmacological benefits in IS, but its protective effects on BMECs have yet to be explored. This study aimed to investigate the potential protective effects of GRb1 on BMECs. METHODS: An in vitro oxygen-glucose deprivation/reperfusion (OGD/R) model was established to mimic ischemia-reperfusion (I/R) injury. Bulk RNA-sequencing data were analyzed by using the Human Autophagy Database and various bioinformatic tools, including gene set enrichment analysis (GSEA), Gene Ontology (GO) classification and enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, protein-protein interaction network analysis, and molecular docking. Experimental validation was also performed to ensure the reliability of our findings. RESULTS: Rb1 had a protective effect on BMECs subjected to OGD/R injury. Specifically, GRb1 was found to modulate the interplay between oxidative stress, apoptosis, and autophagy in BMECs. Key targets such as sequestosome 1 (SQSTM1/p62), autophagy related 5 (ATG5), and hypoxia-inducible factor 1-alpha (HIF-1α) were identified, highlighting their potential roles in mediating the protective effects of GRb1 against IS-induced damage. CONCLUSION: GRbl protects BMECs against OGD/R injury by influencing oxidative stress, apoptosis, and autophagy. The identification of SQSTM1/p62, ATG5, and HIF-1α as promising targets further supports the potential of GRb1 as a therapeutic agent for IS, providing a foundation for future research into its mechanisms and applications in IS treatment.
Asunto(s)
Apoptosis , Autofagia , Células Endoteliales , Ginsenósidos , Estrés Oxidativo , Ginsenósidos/farmacología , Estrés Oxidativo/efectos de los fármacos , Autofagia/efectos de los fármacos , Células Endoteliales/efectos de los fármacos , Células Endoteliales/metabolismo , Apoptosis/efectos de los fármacos , Humanos , Encéfalo/efectos de los fármacos , Encéfalo/metabolismo , Encéfalo/patología , Simulación del Acoplamiento Molecular , Mapas de Interacción de Proteínas/efectos de los fármacos , Daño por Reperfusión/tratamiento farmacológico , Daño por Reperfusión/metabolismo , Microvasos/efectos de los fármacos , Microvasos/citología , Microvasos/metabolismo , Biología Computacional/métodos , Glucosa/metabolismoRESUMEN
A 2009 survey of 418 venue-based male commercial sex workers in Shenzhen, China revealed that 19.9% used recreational drugs. Consistent condom use by drug users was lower than that by nonusers. HIV, syphilis, and herpes simplex virus 2 prevalences were higher among drug users. Prevention programs need to address drug use among male commercial sex workers in China.
Asunto(s)
Síndrome de Inmunodeficiencia Adquirida/epidemiología , Condones/estadística & datos numéricos , Herpes Genital/epidemiología , Herpesvirus Humano 2 , Drogas Ilícitas/efectos adversos , Trabajadores Sexuales/estadística & datos numéricos , Trastornos Relacionados con Sustancias/epidemiología , Sífilis/epidemiología , China/epidemiología , Homosexualidad Masculina/estadística & datos numéricos , Humanos , Ketamina/efectos adversos , Masculino , Metanfetamina/efectos adversos , Asunción de Riesgos , Parejas Sexuales , Trastornos Relacionados con Sustancias/prevención & control , Adulto JovenRESUMEN
As one of the most prevalent chronic disorders, airway disease is a major cause of morbidity and mortality worldwide. In order to understand its underlying mechanisms and to enable assessment of therapeutic efficacy of a variety of possible interventions, noninvasive investigation of the airways in a large number of subjects is of great research interest. Due to its high resolution in temporal and spatial domains, computed tomography (CT) has been widely used in clinical practices for studying the normal and abnormal manifestations of lung diseases, albeit there is a need to clearly demonstrate the benefits in light of the cost and radiation dose associated with CT examinations performed for the purpose of airway analysis. Whereas a single CT examination consists of a large number of images, manually identifying airway morphological characteristics and computing features to enable thorough investigations of airway and other lung diseases is very time-consuming and susceptible to errors. Hence, automated and semiautomated computerized analysis of human airways is becoming an important research area in medical imaging. A number of computerized techniques have been developed to date for the analysis of lung airways. In this review, we present a summary of the primary methods developed for computerized analysis of human airways, including airway segmentation, airway labeling, and airway morphometry, as well as a number of computer-aided clinical applications, such as virtual bronchoscopy. Both successes and underlying limitations of these approaches are discussed, while highlighting areas that may require additional work.
Asunto(s)
Sistema Respiratorio/diagnóstico por imagen , Tomografía Computarizada por Rayos X/métodos , Broncoscopía , Humanos , Imagenología Tridimensional , Pulmón/anatomía & histología , Pulmón/diagnóstico por imagen , Pulmón/fisiología , Pulmón/fisiopatología , Sistema Respiratorio/anatomía & histología , Enfermedades Respiratorias/diagnóstico por imagen , Enfermedades Respiratorias/patología , Enfermedades Respiratorias/fisiopatologíaRESUMEN
We examined an at-risk population in China, money boys (MBs), to evaluate their potential role for transmitting HIV and sexually transmitted infections (STIs). Data were collected from 418 MBs selected by time-location cluster sampling, using a self-administered computerized questionnaire and testing a small blood sample for HIV/STIs. One-third (32.1%) of participants self-identified as homosexual, 25.4% heterosexual, 33.5% bisexual, and 9.1% uncertain. Consistent condom use by participants was 70-80% with commercial sex partners, 43.9% with girlfriends, and 60-70% with other non-commercial partners. HIV prevalence was 3.3%; syphilis, 10.5%; and HSV-2, 11.0%; overall prevalence for any was 20.3%. Factors significantly associated with HIV/STIs included being minority (OR = 4.82), having only male partners (OR = 1.92), having more male casual partners in the last 6 months (OR = 1.28), being younger at sexual debut (OR = 1.14), and being older (OR = 1.11). This study emphasizes the importance of developing targeted interventions for MBs, particularly those who are homosexual or minority.
Asunto(s)
Condones/estadística & datos numéricos , Seropositividad para VIH/epidemiología , Trabajo Sexual/estadística & datos numéricos , Trabajadores Sexuales/estadística & datos numéricos , Sexualidad/estadística & datos numéricos , Sífilis/epidemiología , Adulto , Bisexualidad/estadística & datos numéricos , China/epidemiología , Femenino , Seropositividad para VIH/sangre , Seropositividad para VIH/transmisión , Conocimientos, Actitudes y Práctica en Salud , Heterosexualidad/estadística & datos numéricos , Homosexualidad/estadística & datos numéricos , Humanos , Masculino , Prevalencia , Factores de Riesgo , Encuestas y Cuestionarios , Sífilis/sangre , Sífilis/transmisiónRESUMEN
Slopes along the highway and railway routes are subjected to not only static loads but also dynamic loads generated by vehicles and trains. The induced excessive deformation potentially poses a threat to slope stability. In terms of the extensive application of ecological slope protection, plants play a critical role in slope stability, as the roots can enhance the shear strength of the soil. This study aims to investigate the influence of different root distribution patterns on the dynamic characteristics induced by cyclic loading. By conducting a group of dynamic triaxial tests, the results indicate that the root system can significantly enhance the liquefaction resistance of the soil when the soil is subjected to lower dynamic loads, and the cross arrangement has a better-reinforced effect than the mixed arrangement. The reinforced effect was not obvious when the soil was subjected to a dynamic load with a larger stress amplitude. In addition, based on the validation of the seed model, a new pore water pressure development model was proposed according to the test results. Overall, the research provides a new model and some innovative observations to better understand the dynamic behavior of root-reinforced soil.
Asunto(s)
Plantas , Suelo , Resistencia al CorteRESUMEN
In simulating viscous incompressible SPH fluids, incompressibility and viscosity are typically solved in two separate stages. However, the interference between pressure and shear forces could cause the missing of behaviors that include preservation of sharp surface details and remarkable viscous behaviors such as buckling and rope coiling. To alleviate this problem, we introduce for the first time the semi-implicit method for pressure linked equations (SIMPLE) into SPH to solve incompressible fluids with a broad range viscosity. We propose to link incompressibility and viscosity solvers, and impose incompressibility and viscosity constraints iteratively to gradually remove the interference between pressure and shear forces. We will also discuss how to solve the particle deficiency problem for both incompressibility and viscosity solvers. Our method is stable at simulating incompressible fluids whose viscosity can range from zero to an extremely high value. Compared to state-of-the-art methods, our method not only produces realistic viscous behaviors, but is also better at preserving sharp surface details.
RESUMEN
High-performance computing (HPC) systems play a critical role in facilitating scientific discoveries. Their scale and complexity (e.g., the number of computational units and software stack) continue to grow as new systems are expected to process increasingly more data and reduce computing time. However, with more processing elements, the probability that these systems will experience a random bit-flip error that corrupts a program's output also increases, which is often recognized as silent data corruption. Analyzing the resiliency of HPC applications in extreme-scale computing to silent data corruption is crucial but difficult. An HPC application often contains a large number of computation units that need to be tested, and error propagation caused by error corruption is complex and difficult to interpret. To accommodate this challenge, we propose an interactive visualization system that helps HPC researchers understand the resiliency of HPC applications and compare their error propagation. Our system models an application's error propagation to study a program's resiliency by constructing and visualizing its fault tolerance boundary. Coordinating with multiple interactive designs, our system enables domain experts to efficiently explore the complicated spatial and temporal correlation between error propagations. At the end, the system integrated a nonmonotonic error propagation analysis with an adjustable graph propagation visualization to help domain experts examine the details of error propagation and answer such questions as why an error is mitigated or amplified by program execution.
RESUMEN
The melon fruit surface groove (fsg) not only affects peel structure and causes stress-induced fruit cracking but also fits consumers' requirements in different regions. In this study, genetic inheritance analysis of three F2 populations derived from six parental lines revealed that the fsg trait is controlled by a simple recessive inherited gene. Through bulked segregant analysis sequencing (BSA-seq), the Cmfsg locus was detected in an 8.96 Mb interval on chromosome 11 and then initially mapped to a region of approximately 1.15 Mb. Further fine mapping with a large F2 population including 1,200 plants narrowed this region to 207 kb containing 11 genes. A genome-wide association study (GWAS) with 187 melon accessions also produced the same chromosome region for the Cmfsg locus. Due to the rare molecular markers and lack of mutations in the coding and promoter regions of the 11 candidate genes in the fine-mapped interval, we conducted in silico BSA to explore the natural melon panel to predict candidate genes for the Cmfsg locus. A 1.07 kb segment upstream of MELO3C019694.2 (annotated as the AGAMOUS MADS-box transcription factor) exhibited a correlation with the grooved and non-grooved accessions among the F2 individuals, and a natural panel consisted of 17 melon accessions. The expression level of MELO3C019694.2 in the pericarp was higher in grooved lines than in non-grooved lines and was specifically expressed in fruit compared with other tissues (female flower, male flower, root, and leaf). This work provides fundamental information for further research on melon fsg trait formation and molecular markers for melon breeding.