Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 86
Filtrar
Más filtros

Banco de datos
Tipo del documento
Intervalo de año de publicación
1.
Mar Drugs ; 21(5)2023 May 08.
Artículo en Inglés | MEDLINE | ID: mdl-37233485

RESUMEN

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.


Asunto(s)
Fitosteroles , Theonella , Animales , Humanos , Esteroles/farmacología , Esteroles/química , Receptores Citoplasmáticos y Nucleares
2.
Molecules ; 28(6)2023 Mar 21.
Artículo en Inglés | MEDLINE | ID: mdl-36985811

RESUMEN

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.


Asunto(s)
Receptores de Esteroides , Receptor X de Pregnano , Receptores de Esteroides/metabolismo , Receptores Citoplasmáticos y Nucleares , Simulación del Acoplamiento Molecular , Biblioteca de Genes
3.
Neurol Sci ; 43(11): 6529-6538, 2022 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-35804254

RESUMEN

BACKGROUND: The BUB 1 mitotic checkpoint serine/threonine kinase B (BUB1B) gene encodes a key protein in the mitotic spindle checkpoint, which acts as a surveillance mechanism, crucial for the maintenance of the correct chromosome number during cell deviation. Mutations of BUB1B gene are linked to mosaic variegated aneuploidy 1 (MVA1) syndrome, a rare autosomal recessive disorder characterized by widespread mosaic aneuploidies, involving different chromosomes and tissues. MVA1 is clinically characterized by intrauterine growth restriction, post-natal growth retardation, and severe neurologic impairment including microcephaly, developmental delay/intellectual disability, epileptic seizures, and generalized hypotonia. Malignancies are also serious sequelae associated with the disorder. We reported on a case of two-year-old Italian girl with MVA1 who shows severe neurologic impairment, microcephaly and epileptic seizures. MATERIALS AND METHODS: Clinical data collection and genetic diagnosis of the patient were assessed. Mutational analysis covers the chromosomal microarray analysis, the gene methylation pattern studied using the methylation-specific multiplex ligation-dependent probe amplification, and the family-based Whole Exome Sequencing (WES). A literature research based on reported cases of MVA and premature chromatid separation was also included. RESULTS: Karyotyping has revealed 12% of mosaics in the patient who carries a novel variant in BUB1B gene (c.2679A > T, p.Arg893Ser) detected by WES. Thirty-one cases of MVA1 including the present report, and four prenatally diagnosed cases with MVA1 were selected and inspected. CONCLUSION: Clinical and genetic findings reported in the girl strongly suggest a new MVA1 genotype-phenotype correlation and lead to a reappraisal of a severe syndrome. Diagnosis and in-depth follow-up provided worthwhile data.


Asunto(s)
Microcefalia , Mosaicismo , Humanos , Microcefalia/genética , Proteínas Serina-Treonina Quinasas/genética , Aneuploidia , Síndrome , Mutación/genética , Convulsiones , Proteínas de Ciclo Celular/genética , Proteínas de Ciclo Celular/metabolismo
4.
Int J Mol Sci ; 23(3)2022 Jan 20.
Artículo en Inglés | MEDLINE | ID: mdl-35163018

RESUMEN

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.


Asunto(s)
ADN/química , Desoxiadenosinas/química , G-Cuádruplex , Oligonucleótidos/química , Telómero , Catálisis , Humanos , Estereoisomerismo
5.
Neurol Sci ; 41(12): 3547-3562, 2020 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-32827285

RESUMEN

Since its first clinical description (on his son) by William James West (1793-1848) in 1841, and the definition of the classical triad of (1) infantile spasms; (2) hypsarrhythmia, and (3) developmental arrest or regression as "West syndrome", new and relevant advances have been recorded in this uncommon disorder. New approaches include terminology of clinical spasms (e.g., infantile (IS) vs. epileptic spasms (ES)), variety of clinical and electroencephalographic (EEG) features (e.g., typical ictal phenomena without EEG abnormalities), burden of developmental delay, spectrum of associated genetic abnormalities, pathogenesis, treatment options, and related outcome and prognosis. Aside the classical manifestations, IS or ES may present with atypical electroclinical phenotypes (e.g., subtle spasms; modified hypsarrhythmia) and may have their onset outside infancy. An increasing number of genes, proteins, and signaling pathways play crucial roles in the pathogenesis. This condition is currently regarded as a spectrum of disorders: the so-called infantile spasm syndrome (ISs), in association with other causal factors, including structural, infectious, metabolic, syndromic, and immunologic events, all acting on a genetic predisposing background. Hormonal therapy and ketogenic diet are widely used also in combination with (classical and recent) pharmacological drugs. Biologically targeted and gene therapies are increasingly studied. The present narrative review searched in seven electronic databases (primary MeSH terms/keywords included West syndrome, infantile spasms and infantile spasms syndrome and were coupled to 25 secondary clinical, EEG, therapeutic, outcomes, and associated conditions terms) including MEDLINE, Embase, Cochrane Central, Web of Sciences, Pubmed, Scopus, and OMIM to highlight the past knowledge and more recent advances.


Asunto(s)
Espasmos Infantiles , Electroencefalografía , Humanos , Lactante , Pronóstico , Espasmos Infantiles/diagnóstico , Espasmos Infantiles/genética , Espasmos Infantiles/terapia
6.
COPD ; 17(4): 378-383, 2020 08.
Artículo en Inglés | MEDLINE | ID: mdl-32586145

RESUMEN

In patients with moderate-to-severe Chronic Obstructive Pulmonary Disorder (COPD), pulmonary hyperinflation can occur at rest and increase during episodes of exacerbation. Among other mechanical constraints, changes in position and configuration of the diaphragm are also induced by increased end-expiratory lung volume. Both descent and flattening of diaphragm might damage the phrenic nerves by stretching their fibers. The study aimed to investigate the phrenic nerve conduction in COPD patients in stable conditions and during COPD exacerbation. In a group of 11 COPD patients without relevant comorbidities in stable conditions and subsequently in another group of 10 COPD patients during in-hospital COPD exacerbation and recovery, measurements of functional respiratory parameters and assessment of phrenic nerves motor conduction by bilateral electric stimulation were performed concurrently. Significant increase in phrenic nerves latency (p < 0.05), but similar amplitude of motor compound muscle action potential (cMAP) was observed in stable COPD patients vs. matched controls (p < 0.05). However, in COPD patients with resting pulmonary hyperinflation as reliably detected by substantial Inspiratory Capacity reduction (<80% pred.), the mean bilateral latency was longer vs. COPD patients without pulmonary hyperinflation (p < 0.02). During COPD exacerbation, in contrast with mean latency, the mean amplitude of phrenic nerves cMAP improved at discharge when compared with in-hospital admission (p < 0.05). In stable COPD patients the velocity of phrenic nerve conduction was impaired mostly in the presence of pulmonary hyperinflation, while during COPD exacerbation where dynamic pulmonary hyperinflation abruptly occurs, the reversible decrease of cMAP amplitude does suggest a temporary, acute axonal damage of phrenic nerves, potentially contributing to diaphragmatic dysfunction in these circumstances.


Asunto(s)
Capacidad Inspiratoria/fisiología , Conducción Nerviosa/fisiología , Nervio Frénico/fisiopatología , Enfermedad Pulmonar Obstructiva Crónica/complicaciones , Enfermedad Pulmonar Obstructiva Crónica/fisiopatología , Anciano , Anciano de 80 o más Años , Diafragma/fisiopatología , Progresión de la Enfermedad , Femenino , Humanos , Mediciones del Volumen Pulmonar , Masculino , Persona de Mediana Edad , Tiempo de Reacción/fisiología , Recuperación de la Función/fisiología , Mecánica Respiratoria/fisiología
7.
Handb Exp Pharmacol ; 256: 137-165, 2019.
Artículo en Inglés | MEDLINE | ID: mdl-31201554

RESUMEN

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.


Asunto(s)
Ácidos y Sales Biliares/química , Receptores Citoplasmáticos y Nucleares/agonistas , Receptores Citoplasmáticos y Nucleares/antagonistas & inhibidores , Receptores Acoplados a Proteínas G/agonistas , Receptores Acoplados a Proteínas G/antagonistas & inhibidores , Ácidos y Sales Biliares/farmacología , Humanos , Ligandos
8.
Childs Nerv Syst ; 35(3): 523-527, 2019 03.
Artículo en Inglés | MEDLINE | ID: mdl-30209598

RESUMEN

BACKGROUND: Grisel's syndrome is a non-traumatic subluxation of the atlantoaxial joints, which is caused by an inflammatory process involving the upper neck. Torticollis, neck pain, and reduced neck mobility are the main clinical signs of presentation. Predisposing factors are trauma, hyperlaxity of the transverse and alar ligaments of the atlantoaxial joints, and surgical interventions carried out in this area. Several viral and bacterial pathogens have been reported as causative events of Grisel's syndrome, including Epstein-Barr virus, Kawasaki disease, Streptococcus pyogenes, Staphylococcus aureus, and other infectious agents. Grisel's syndrome linked to Mycoplasma pneumoniae infection as the trigger has not previously been reported. Mycoplasma pneumoniae is a small prokaryotic microbe and a frequent etiologic factor of respiratory tract infections and, less frequently, of extrapulmonary body organs. The recognition of the Grisel's syndrome is based on clinical and neuroradiological investigations, and early diagnosis and specific treatment are crucial to the successful outcome of the disease. RESULTS: We report the case of an 8-year-old girl with Grisel's syndrome caused by an upper respiratory tract infection due to Mycoplasma pneumoniae. Diagnostic suspicion and treatment of Grisel's syndrome were established quickly by anamnestic and clinical data and confirmed by radiological findings. The girl was immediately treated with specific antibiotic therapy and cervical immobilization, thus preventing the most dangerous complications of the disorder. CONCLUSION: Mycoplasma pneumoniae, among the other infectious agents, may be cause of scute torticollis and Gresel's syndrome.


Asunto(s)
Articulación Atlantoaxoidea/patología , Luxaciones Articulares/etiología , Neumonía por Mycoplasma/complicaciones , Niño , Femenino , Humanos , Mycoplasma pneumoniae , Dolor de Cuello/etiología , Tortícolis/etiología
9.
Phytochem Anal ; 30(5): 524-534, 2019 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-31168900

RESUMEN

INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. METHODOLOGY: An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high-performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI-MS) data. By nuclear magnetic resonance (NMR) [1 H, 13 C and two-dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. RESULTS: In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2-C-methyl-D-erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c-Src-mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. CONCLUSIONS: Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.


Asunto(s)
Crassulaceae/química , Fitoquímicos/análisis , Extractos Vegetales/farmacología , Cicatrización de Heridas/efectos de los fármacos , Proliferación Celular/efectos de los fármacos , Cromatografía Líquida de Alta Presión , Células HCT116 , Humanos , Transducción de Señal/efectos de los fármacos , Análisis Espectral/métodos
10.
Molecules ; 24(9)2019 Apr 30.
Artículo en Inglés | MEDLINE | ID: mdl-31052163

RESUMEN

The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided fractionation of the extract led to the isolation of four iridoid glycosides, including a new one known as nepetamoside (1), one hexenyl-diglycoside, and some polyphenol and flavonoid components. None of the isolated iridoid components displayed significant effects on nitrites formation in an in vitro LPS-induced model of inflammation, thus suggesting that the plant anti-inflammatory effect is probably due to a synergistic action among its constituents.


Asunto(s)
Nepeta/química , Fitoquímicos/química , Fitoquímicos/farmacología , Extractos Vegetales/química , Extractos Vegetales/farmacología , Animales , Supervivencia Celular/efectos de los fármacos , Fraccionamiento Químico , Citocinas/metabolismo , Macrófagos/efectos de los fármacos , Macrófagos/metabolismo , Estructura Molecular , Fitoquímicos/aislamiento & purificación , Extractos Vegetales/aislamiento & purificación , Análisis Espectral
11.
Ann Pharmacother ; 52(7): 645-649, 2018 07.
Artículo en Inglés | MEDLINE | ID: mdl-29442544

RESUMEN

BACKGROUND: Few studies on adult and pediatric patients have shown pyridoxine efficacy as additional therapy for those receiving levetiracetam (LEV) to prevent and mitigate behavioral adverse effects (BAEs). OBJECTIVE: The aim of our study was to analyze the safety and efficacy of pyridoxine supplementation in the prevention of LEV adverse effects, including suicidal ideation. METHODS: This randomized, case-control trial included patients receiving LEV as monotherapy treatment. Patients were subdivided into 2 groups, according to whether they were treated with LEV only (group 1) or LEV with supplemental pyridoxine (group 2). RESULTS: In both cohorts, the most frequent BAEs were irritability/aggression followed by depression and confusion. Those patients (92%) who initiated pyridoxine after 1 month of LEV treatment did not need to change or suspend LEV ( P < 0.001), and BAE improved after 9.06 ± 3.05 days of pyridoxine supplementation. None of the patients complained of symptoms of pyridoxine toxicity, and no new adverse effects of LEV off-label were reported. CONCLUSIONS: In our study, we found pyridoxine to be safe and effective in controlling LEV-induced BAEs in children.


Asunto(s)
Anticonvulsivantes/efectos adversos , Conducta Infantil/efectos de los fármacos , Levetiracetam/efectos adversos , Piridoxina/administración & dosificación , Adolescente , Adulto , Agresión/efectos de los fármacos , Niño , Preescolar , Confusión/tratamiento farmacológico , Depresión/tratamiento farmacológico , Quimioterapia Combinada , Femenino , Humanos , Genio Irritable/efectos de los fármacos , Masculino , Resultado del Tratamiento
12.
COPD ; 15(6): 581-587, 2018 12.
Artículo en Inglés | MEDLINE | ID: mdl-30894078

RESUMEN

Bacterial colonization is a well-known phenomenon in acute care, but scant information is available regarding the rehabilitation setting. We retrospectively analyzed, in COPD patients admitted to a Respiratory Rehabilitative unit in 2010, the number of cultures requested, of positive cultures, and of cultures showing multiple drug resistant (MDR) organisms. We also compared hospital admissions (HA) with versus without positive cultures and with versus without MDR and investigated which baseline variables may predict length of stay (LOS) > 30 days. Of 286 COPD admissions (involving 269 patients, age 71 ± 11 years, males 66%), culture samples were requested in 62 (22%). The rate of colonization and of MDR organisms was 61 and 39%, respectively. Patients with a positive culture had a worse clinical condition and disability, and were more frequently tracheostomized, on invasive mechanical ventilation (MV) and admitted from/discharged to acute care. Patients with MDR cultures showed a lower exercise tolerance. Factors predicting LOS > 30 days were the presence of comorbidities, invasive MV, age > 65 years, and lower functional status, but not a positive culture or MDR presence. To our knowledge, this is the first real-life Italian study investigating the epidemiology of colonization and the association between colonization and LOS in a respiratory rehabilitation setting. Further investigation is necessary to clarify the relationship between colonization burden and patients' baseline clinical status and outcomes.


Asunto(s)
Portador Sano/epidemiología , Portador Sano/microbiología , Tiempo de Internación , Enfermedad Pulmonar Obstructiva Crónica/microbiología , Enfermedad Pulmonar Obstructiva Crónica/rehabilitación , Factores de Edad , Anciano , Anciano de 80 o más Años , Portador Sano/diagnóstico , Comorbilidad , Farmacorresistencia Bacteriana Múltiple , Tolerancia al Ejercicio , Femenino , Estado de Salud , Hospitalización , Humanos , Intubación Intratraqueal , Italia/epidemiología , Masculino , Persona de Mediana Edad , Enfermedad Pulmonar Obstructiva Crónica/fisiopatología , Centros de Rehabilitación , Estudios Retrospectivos
13.
Neurol Neurochir Pol ; 52(3): 406-409, 2018.
Artículo en Inglés | MEDLINE | ID: mdl-29455904

RESUMEN

Unilateral palsy of the hypoglossal nerve is a rare complication of orthodontic procedures. The main reported causes of HNP are: orthopedic and otorhinolaryngology surgical interventions, and in particular maneuvers involving compression or overstretching of the hypoglossal nerve, dental procedures and traumas, and also infections, motoneuron disorders, tumors, vascular diseases. Diagnosis is usually performed by electrophysiology studies (EMG-VCN), and brain magnetic resonance imaging (MRI) is useful to exclude other causes. The prognosis depends on the location and extension of the damage. Currently there is not a standardized treatment approach except the speech therapy, although, in some cases, the high-dose steroid treatment could be useful. We describe the case of a ten-year-old female, who was admitted in our Unit after a deviation of the tongue associated with dysarthria and dysphagia, occurred after the application of a mobile orthodontic device.


Asunto(s)
Trastornos de Deglución , Enfermedades del Nervio Hipogloso , Niño , Disartria , Femenino , Humanos , Nervio Hipogloso , Parálisis
14.
Org Biomol Chem ; 12(43): 8646-55, 2014 Nov 21.
Artículo en Inglés | MEDLINE | ID: mdl-25251727

RESUMEN

The analysis of two Thorectidae sponge samples, Hyrtios sp. and Petrosaspongia sp., collected at Fiji Islands, led to the isolation of five new scalarane derivatives along with fifteen known compounds. Their structures were elucidated on the basis of NMR and MS spectroscopic data. The small library of natural scalarane derivatives was investigated for their ability to modulate the activity of trans-activation response DNA-binding protein of 43 kDa (TDP-43), a key factor in several neurodegenerative conditions and the study resulted in the identification of potent inhibitors of TDP-43 protein.


Asunto(s)
ADN de Cadena Simple/química , Proteínas de Unión al ADN/antagonistas & inhibidores , Fármacos Neuroprotectores/química , Poríferos/química , Sesterterpenos/química , Animales , Proteínas de Unión al ADN/química , Cinética , Estructura Molecular , Fármacos Neuroprotectores/aislamiento & purificación , Fármacos Neuroprotectores/farmacología , Unión Proteica/efectos de los fármacos , Sesterterpenos/aislamiento & purificación , Sesterterpenos/farmacología , Relación Estructura-Actividad
15.
Mar Drugs ; 12(6): 3091-115, 2014 May 27.
Artículo en Inglés | MEDLINE | ID: mdl-24871460

RESUMEN

In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives were prepared and evaluated for their ability to activate the PXR by assessing transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3ß-ol (4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR target gene CYP3A4. To shed light on the molecular basis of the interaction between these ligands and PXR, we investigated, through docking simulations, the binding mechanism of the most potent compound of the series, 4, to the PXR. Our findings provide useful functional and structural information to guide further investigations and drug design.


Asunto(s)
Antozoos/química , Hidroxiesteroides/farmacología , Receptores de Esteroides/efectos de los fármacos , Animales , Citocromo P-450 CYP3A/genética , Regulación de la Expresión Génica/efectos de los fármacos , Células Hep G2 , Humanos , Hidroxiesteroides/química , Hidroxiesteroides/aislamiento & purificación , Ligandos , Simulación del Acoplamiento Molecular , Receptor X de Pregnano , Receptores de Esteroides/metabolismo
16.
Mar Drugs ; 12(7): 4045-68, 2014 Jul 03.
Artículo en Inglés | MEDLINE | ID: mdl-25056629

RESUMEN

Marine organisms and their metabolites represent a unique source of potential pharmaceutical substances. In this study, we examined marine-derived substances for their bioactive properties in a cell-based Chikungunya virus (CHIKV) replicon model and for in vitro anti-inflammatory activity. In the screening of a marine sample library, crude extracts from the Indian soft coral, Sinularia kavarattiensis, showed promising activity against the CHIKV replicon. Bioassay-guided chemical fractionation of S. kavarattiensis resulted in the isolation of six known norcembranoids (1-6) and one new compound, named kavaranolide (7). The structures were elucidated on the basis of NMR and MS spectroscopic data. Compounds 1-3 and 5-7 were evaluated for their replicon-inhibiting potential in the CHIKV model by using a luminescence-based detection technique and live cell imaging. Compounds 1 and 2 showed moderate inhibition of the CHIKV replicon, but imaging studies also revealed cytotoxic properties. Moreover, the effects of the isolated compounds on primary microglial cells, an experimental model for neuroinflammation, were evaluated. Compound 2 was shown to modulate the immune response in microglial cells and to possess potential anti-inflammatory properties by dose-dependently reducing the release of pro- and anti-inflammatory cytokines.


Asunto(s)
Antozoos/metabolismo , Antiinflamatorios/aislamiento & purificación , Antivirales/aislamiento & purificación , Diterpenos/aislamiento & purificación , Animales , Virus Chikungunya/efectos de los fármacos , Diterpenos/química , Diterpenos/farmacología , Relación Dosis-Respuesta a Droga , Relación Estructura-Actividad
17.
Seizure ; 118: 156-163, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38735085

RESUMEN

BACKGROUND: The main objective of this study was to evaluate the neurological consequences of delayed pyridoxine administration in patients diagnosed with Pyridoxin Dependent Epilepsies (PDE). MATERIALS AND METHODS: We reviewed 29 articles, comprising 52 genetically diagnosed PDE cases, ensuring data homogeneity. Three additional cases were included from the General Pediatric Operative Unit of San Marco Hospital. Data collection considered factors like age at the first seizure's onset, EEG reports, genetic analyses, and more. Based on the response to first-line antiseizure medications, patients were categorized into four distinct groups. Follow-up evaluations employed various scales to ascertain neurological, cognitive, and psychomotor developments. RESULTS: Our study includes 55 patients (28 males and 27 females), among whom 15 were excluded for the lack of follow-up data. 21 patients were categorized as "Responder with Relapse", 11 as "Resistant", 6 as "Pyridoxine First Approach", and 2 as "Responders". The neurological outcome revealed 37,5 % with no neurological effects, 37,5 % showed complications in two developmental areas, 15 % in one, and 10 % in all areas. The statistical analysis highlighted a positive correlation between the time elapsed from the administration of pyridoxine after the first seizure and worse neurological outcomes. On the other hand, a significant association was found between an extended latency period (that is, the time that elapsed between the onset of the first seizure and its recurrence) and worse neurological outcomes in patients who received an unfavorable score on the neurological evaluation noted in a subsequent follow-up. CONCLUSIONS: The study highlights the importance of early recognition and intervention in PDE. Existing medical protocols frequently overlook the timely diagnosis of PDE. Immediate administration of pyridoxine, guided by a swift diagnosis in the presence of typical symptoms, might improve long-term neurological outcomes, and further studies should evaluate the outcome of PDE neonates promptly treated with Pyridoxine.


Asunto(s)
Anticonvulsivantes , Epilepsia , Piridoxina , Humanos , Piridoxina/administración & dosificación , Piridoxina/uso terapéutico , Epilepsia/tratamiento farmacológico , Epilepsia/diagnóstico , Masculino , Femenino , Anticonvulsivantes/administración & dosificación , Recién Nacido , Complejo Vitamínico B/administración & dosificación , Lactante
18.
In Vivo ; 38(4): 1660-1664, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38936905

RESUMEN

BACKGROUND/AIM: Bladder cancer (BC) is the most prevalent malignant tumor in the urinary tract, classified mainly into muscle-invasive BC (MIBC) and non-MIBC (NMIBC). Recent studies highlight the important role of changes in transcriptome activity in carcinogenesis, aiding in the identification of additional differentially regulated candidate genes, improving our understanding of the molecular basis of gene regulation in BC. This study aimed to evaluate the transcriptome of MIBC patients compared with normal subjects. MATERIALS AND METHODS: mRNA sequencing was conducted using the Illumina NovaSeq 6000 Dx system in a case series comprising 11 subjects with MIBC and 19 healthy controls matched for age and sex. For functional analysis, the pathfindR package was utilized to comprehensively identify pathways enriched in omics data within active subnetworks. RESULTS: Our results demonstrated the presence of differentiated pathways, including spliceosome activity, oxidative phosphorylation, and chemical carcinogenesis due to reactive oxygen species, in MIBC patients compared with controls. CONCLUSION: The identification of novel molecular pathways in MIBC patients could prove useful in defining cancer predisposition factors and exploring potential therapeutic options.


Asunto(s)
Perfilación de la Expresión Génica , Regulación Neoplásica de la Expresión Génica , Transcriptoma , Neoplasias de la Vejiga Urinaria , Humanos , Neoplasias de la Vejiga Urinaria/genética , Neoplasias de la Vejiga Urinaria/patología , Masculino , Femenino , Persona de Mediana Edad , Anciano , Invasividad Neoplásica/genética , Estudios de Casos y Controles , Biomarcadores de Tumor/genética , Redes Reguladoras de Genes , Secuenciación de Nucleótidos de Alto Rendimiento , Biología Computacional/métodos
19.
Mol Diagn Ther ; 28(3): 329-337, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38581611

RESUMEN

INTRODUCTION: GNAO1 encephalopathy is characterized by severe hypotonia, psychomotor retardation, epilepsy, and movement disorders. Genetic variations in GNAO1 have been linked to neurological symptoms including movement disorders like dystonia. The correlation between the E246K mutation in the Gα subunit and aberrant signal transduction of G proteins has been established but no data are reported regarding the efficacy of medical treatment with tetrabenazine. METHODS: Molecular modeling studies were performed to elucidate the molecular mechanisms underlying this mutation. We developed drug efficacy models using molecular dynamic simulations that replicated the behavior of wild-type and mutated proteins in the presence or absence of ligands. RESULTS AND DISCUSSION: We demonstrated that the absence of the mutation leads to normal signal transduction upon receptor activation by the endogenous ligand, but not in the presence of tetrabenazine. In contrast, the presence of the mutation resulted in abnormal signal transduction in the presence of the endogenous ligand, which was corrected by the drug tetrabenazine. Tetrabenazine was identified as a promising therapeutic option for pediatric patients suffering from encephalopathy due to an E246K mutation in the GNAO1 gene validated through molecular dynamics. This is a potential first example of the use of this technique in a rare neurological pediatric disease.


Asunto(s)
Subunidades alfa de la Proteína de Unión al GTP Gi-Go , Simulación de Dinámica Molecular , Tetrabenazina , Humanos , Subunidades alfa de la Proteína de Unión al GTP Gi-Go/genética , Subunidades alfa de la Proteína de Unión al GTP Gi-Go/metabolismo , Tetrabenazina/uso terapéutico , Mutación , Encefalopatías/tratamiento farmacológico , Encefalopatías/genética , Medicina de Precisión/métodos , Transducción de Señal/efectos de los fármacos
20.
Front Chem ; 12: 1425867, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-39086986

RESUMEN

BAR502, a bile acid analogue, is active as dual FXR/GPBAR1 agonist and represents a promising lead for the treatment of cholestasis and NASH. In this paper we report the synthesis and the biological evaluation of a library of hybrid compounds prepared by combining, through high-yield condensation reaction, some fibrates with BAR502.The activity of the new conjugates was evaluated towards FXR, GPBAR1 and PPARα receptors, employing transactivation or cofactor recruitment assays. Compound 1 resulted as the most promising of the series and was subjected to further pharmacological investigation, together with stability evaluation and cell permeation assessment. We have proved by LCMS analysis that compound 1 is hydrolyzed in mice releasing clofibric acid and BAR505, the oxidized metabolite of BAR502, endowed with retained dual FXR/GPBAR1 activity.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA