Eco-friendly management of Meloidogyne incognita in cadmium-contaminated soil by using nematophagous fungus Purpureocillium lavendulum YMF1.683: Efficacy and mechanism.

Root-knot nematodes (RKNs) are distributed globally, including in agricultural fields contaminated by heavy metals (HM), and can cause serious crop damages. Having a method that could control RKNs in HM-contaminated soil while limit HM accumulation in crops could provide significant benefits to both farmers and consumers. In this study, we showed that the nematophagous fungus Purpureocillium lavendulum YMF1.683 exhibited a high nematocidal activity against the RKN Meloidogyne incognita and a high tolerance to CdCl2. Comparing to the P. lavendulum YMF1.838 which showed low tolerance to Cd2+, strain YMF1.683 effectively suppressed M. incognita infection and significantly reduced the Cd2+ uptake in tomato root and fruit in soils contaminated by 100 mg/kg Cd2+. Transcriptome analyses and validation of gene expression by RT-PCR revealed that the mechanisms contributed to high Cd-resistance in YMF1.683 mainly included activating autophagy pathway, increasing exosome secretion of Cd2+, and activating antioxidation systems. The exosomal secretory inhibitor GW4869 reduced the tolerance of YMF1.683 to Cd2+, which firstly demonstrated that fungal exosome was involved in HM tolerance. The up-regulation of glutathione synthesis pathway, increasing enzyme activities of both catalase and superoxide dismutase also played important roles in Cd2+ tolerance of YMF1.683. In Cd2+-contaminated soil, YMF1.683 limited Cd2+-uptake in tomato by up-regulating the genes of ABCC family in favor of HM sequestration in plant, and down-regulating the genes of ZIP, HMA, NRAMP, YSL families associated with HM absorption, transport, and uptake in plant. Our results demonstrated that YMF1.683 could be a promising bio-agent in eco-friendly management of M. incognita in Cd2+ contaminated soils.

Survival and infectivity of second-stage root-knot nematode Meloidogyne incognita juveniles depend on lysosome-mediated lipolysis.

Adaptation to nutrient deprivation depends on the activation of metabolic programs to use reserves of energy. When outside a host plant, second-stage juveniles (J2) of the root-knot nematode (Meloidogyne spp.), an important group of pests responsible for severe losses in the production of crops (e.g., rice, wheat, and tomato), are unable to acquire food. Although lipid hydrolysis has been observed in J2 nematodes, its role in fitness and the underlying mechanisms remain unknown. Using RNA-seq analysis, here, we demonstrated that in the absence of host plants, the pathway for the biosynthesis of polyunsaturated fatty acids was upregulated, thereby increasing the production of arachidonic acid in middle-stage J2 Meloidogyne incognita worms. We also found that arachidonic acid upregulated the expression of the transcription factor hlh-30b, which in turn induced lysosomal biogenesis. Lysosomes promoted lipid hydrolysis via a lysosomal lipase, LIPL-1. Furthermore, our data demonstrated that blockage of lysosomal lipolysis reduced both lifespan and locomotion of J2 worms. Strikingly, disturbance of lysosomal lipolysis resulted in a decline in infectivity of these juveniles on tomato roots. Our findings not only reveal the molecular mechanism of lipolysis in J2 worms but also suggest potential novel strategies for the management of root-knot nematode pests.

First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

Sphingobacterium lumbrici sp. nov., a novel bacterium isolated from wormcast of Eisenia foetida.

A novel Gram-stain-negative, rod-shaped, non-motile, yellowish bacterium, designated strain 1.3611T, was isolated from the wormcast of Eisenia foetida. The strain grew optimally at 30-37 ℃, at pH 7.0 and with 0-1.0 % (w/v) NaCl. Based on the results of 16S rRNA gene sequence and phylogenetic analyses, strain 1.3611T showed the highest degree of 16S rRNA gene sequence similarity to Sphingobacterium olei HAL-9T (97.0 %), followed by Sphingobacterium alkalisoli Y3L14T (95.8 %). The respiratory quinone of strain 1.3611T was menaquinone-7 (MK-7) and its major cellular fatty acids were iso-C15 : 0 (41.3 %), summed feature 3 (C16 : 1 ω7c and/or C16 : 1 ω6c, 22.1 %) and iso-C17 : 0 3-OH (16.2 %). The major polar lipids were sphingophospholipid, phosphatidylethanolamine, four unidentified glycolipids, two unidentified phospholipids and five unidentified polar lipids. The genomic DNA G+C content was 39.0 mol%. The digital DNA-DNA hybridization and average nucleotide identity values between the genomes of strain 1.3611T and S. olei HAL-9T were 37.9 and 88.9 %, respectively. According to the phenotypic and chemotaxonomic phylogenetic results, strain 1.3611T should represent a novel species of the genus Sphingobacterium, for which the name Sphingobacterium lumbrici sp. nov. is proposed, with strain 1.3611T (=KCTC 62980T=CCTCC AB 2018349T) as the type strain.

Nocardioides stalactiti sp. nov., isolated from a cave stalactite surface.

An aerobic, rod-shaped, Gram-stain-positive, actinobacterial strain, designated 1.0914T, was isolated from a stalactite sample collected from a cave located in Guizhou Province, southwest PR China. Based on 16S rRNA gene sequence analysis, strain 1.0914T shared highest similarities values with Nocardioides pelophilus CGMCC 4.7388T (97.7 %), Nocardioides immobilis CCTCC AB 2017083T (97.5 %) and Nocardioides silvaticus CCTCC AB 2018079T (97.3 %) and values lower than 97.0 % to other members of the genus Nocardioides. Phylogenetic trees based on 16S rRNA gene sequences indicated that strain 1.0914T formed an isolated branch with N. pelophilus CGMCC 4.7388T, N. immobilis CCTCC AB 2017083T and N. silvaticus CCTCC AB 2018079T. The polar lipids contained phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol and one unidentified phospholipid in the cellular membrane. The major fatty acids were identified as iso-C16 : 0, C18 : 1 ω9c, C17 : 1 ω8c and C16 : 0. The predominant respiratory quinone was MK-8(H4) and ll-diaminopimelic acid was the diagnostic diamino acid in the cell-wall peptidoglycan. The genomic DNA G+C content was 71.1 mol%. The orthologous average nucleotide identiy values between N. pelophilus CGMCC 4.7388T, N. immobilis CCTCC AB 2017083T, N. silvaticus CCTCC 2018079T and strain 1.0914T were 82.3, 81.7 and 81.9 % respectively. DNA-DNA hybridization values between N. pelophilus CGMCC 4.7388T, N. immobilis CCTCC AB 2017083T, N. silvaticus CCTCC 2018079T and strain 1.0914T were 25.2, 24.6 and 24.5 % respectively. The phylogenetic, phenotypic and chemotaxonomic data supported the classification of strain 1.0914T as representing a new species of Nocardioides, for which the name Nocardioides stalactiti sp. nov. is proposed. The type strain is 1.0914T (=CCTCC AB 2018266T=KCTC 49243T).

Luteimonas lumbrici sp. nov., a novel bacterium isolated from wormcast.

A Gram-stain-negative, yellow-green bacterium, designated 1.1416T, was isolated from wormcast of Eisenia foetida. The strain was non-motile, rod-shaped, and grew optimally on NA medium at 30 °C, pH 7.0 and with 0 % (w/v) NaCl. On the basis of the 16S rRNA gene sequence and phylogenetic analysis, 1.1416T showed the highest degree of 16S rRNA gene sequence similarity to Luteimonas arsenica 26-35T (96.2 %), followed by Luteimonas lutimaris G3T (96.1 %). The respiratory quinone of 1.1416T was ubiquinone-8 (Q-8), and its major cellular fatty acids were iso-C15 : 0 (39.8 %), summed feature 9 (iso-C17 : 1 ω9c or C16 : 0 10-methyl) (18.6 %). The major polar lipids of 1.1416T were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine and six unidentified phospholipids. The genomic DNA G+C content of 1.1416T was 71.0 mol%. According to the results of the phenotypic and chemotaxonomic phylogenetic analyses, strain 1.1416T represents a novel species of the genus Luteimonas, for which the name Luteimonas lumbrici sp. nov. is proposed, with strain 1.1416T (=KCTC 62979T=CCTCC AB 2018348T) as the type strain.

Asticcacaulis tiandongensis sp. nov., a new member of the genus Asticcacaulis, isolated from a cave soil sample.

A Gram-stain negative, aerobic, motile and rod-shaped bacterium, designated strain 3.1105T, was isolated from a karst district soil sample collected from Tiandong cave, Guizhou province, south-west PR China. The isolate grew at 10-40 °C and pH 5.0-8.0 and tolerated up to 1 % NaCl (w/v) on R2A medium, with optimal growth at 25-30 °C, pH 7.0 and 0 % NaCl (w/v). Cells showed oxidase-positive and catalase-positive reactions. The respiratory quinone was Q-10. The predominant cellular fatty acids contained C18 : 1ω7c 11-methyl, summed feature 8 (C18 : 1ω7c or C18 : 1ω6c), C16 : 0 and C17 : 0. The major polar lipids were phosphatidylglycerol and monoglycosyldiglycerides. The genomic DNA G+C content was 56.0 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that 3.1105T should be affiliated to the genus Asticcacaulis and showed highest 16S rRNA gene sequence similarity values with Asticcacaulis excentricus CB 48T (96.0 %), Asticcacaulis endophyticus ZFGT-14T (95.3 %) and lower than 95.3 % similarity to other species of the genus Asticcacaulis. The polyphasic taxonomic characteristics indicated that strain 3.1105T represents a novel species of the genus Asticcacaulis, for which the name Asticcacaulis tiandongensis sp. nov., (type strain 3.1105T=KCTC 62978T=CCTCC AB 2018268T) is proposed.

Flavisolibacter nicotianae sp. nov., isolated from rhizosphere soil of Nicotiana tabacum L.

A Gram-stain-negative, aerobic, non-motile and rod-shaped bacterium, designated strain X7XT, was isolated from a rhizosphere soil sample of Nicotiana tabacum L. collected from a tobacco factory located in Kunming, south-western China. The cells showed oxidase-positive and catalase-positive reactions. Growth occurred at 20-40 °C and pH 6.0-8.0, with optimal growth at 30 °C and pH 7.0. The predominant respiratory quinone was MK-7. The major fatty acids were identified as iso-C15 : 0, iso-C17 : 0 3OH and summed feature 3 (C16 : 1 ω7c and/or C16 : 1 ω6c). The cellular polar lipids contained phosphatidylethanolamine, an unidentified aminophospholipid, two unidentified glycolipids, four unidentified aminolipids and four unidentified lipids. The genomic DNA G+C content was 49.7 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain X7XT should be affiliated to the genus Flavisolibacter. Results from further analysis showed that strain X7XT had highest 16S rRNA gene sequence similarity to Flavisolibacter metallilatus TX0661T (96.4 %) and 'Flavisolibacter swuensis' SR2-4-2T (96.4 %), followed by other species of the genus Flavisolibacter. The polyphasic taxonomic characteristics indicated that strain X7XT represents a novel species of the genus Flavisolibacter, for which the name Flavisolibacternicotianae sp. nov. (type strain X7XT=KCTC 62326T=CGMCC 16451T) is proposed.

Sphingomonas tabacisoli sp. nov., a member of the genus Sphingomonas, isolated from rhizosphere soil of Nicotiana tabacum L.

A Gram-staining-negative, aerobic, motile and rod-shaped bacterium, designated strain X1-8T, was isolated from rhizosphere soil of Nicotiana tabacum L. collected from the tobacco produce base located in Kunming, south-west PR China. Cells showed oxidase-negative and catalase-positive reactions and were motile by means of peritrichous flagella. Growth occurred at 25-40 °C and pH 6.0-8.0 with optimal growth at 30-35 °C, pH 7.0. The major respiratory lipoquinone was Q-10. C16 : 0 and summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c) were identified as major cellular fatty acids. The profile of polar lipids contained diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, phosphatidylmethylethanolamine, sphingoglycolipid, phosphatidylcholine and one unidentified glycolipid. The major polyamine was sym-homospermidine. The genomic DNA G+C content was 66.5 mol%. The results of phylogenetic analysis based on 16S rRNA gene sequences indicated that X1-8T should be affiliated to the genus Sphingomonasand formed a clade with most closely related species Sphingomonas changbaiensisNBRC 104936T. The results of 16S rRNA gene sequences similarity analysis indicated that X1-8T had the highest similarity with S. changbaiensisNBRC 104936T (98.4 %) and lower than 96.0 % with other species of the genus Sphingomonas. DNA-DNA hybridization data indicated that X1-8T represented a novel genomic species of the genus Sphingomonas. The characteristics determined in the polyphasic taxonomic study indicated that X1-8T represents a novel species of the genus Sphingomonas, for which the name Sphingomonas tabacisoli sp. nov. (type strain X1-8T=KCTC 62032T=CGMCC 1.16275T) is proposed.

Sphingobacterium tabacisoli sp. nov., isolated from a tobacco field soil sample.

A Gram-staining-negative, non-motile and rod-shaped bacterium, designated strain h337T, was isolated from an arable soil sample of a tobacco field in Kunming, south-west China. The cells showed oxidase-positive and catalase-positive reactions. Growth was observed at 10-35 °C, at pH 6.0-9.0 and in the presence of up to 3 % (w/v) NaCl, with optimal growth at 30 °C, pH 7.0 and with 1-2 % (w/v) NaCl. The predominant isoprenoid quinone was MK-7. The major fatty acids were identified as iso-C15 : 0, iso-C17 : 0 3-OH, summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c) and summed feature 4 (iso-C17 : 1 I and/or anteiso-C17 : 1 B). The cellular polar lipids contained phosphatidylethanolamine, sphingophospholipid, four unidentified phospholipids, five unidentified lipids and three unidentified aminophospholipids. The genomic DNA G+C content was 41.5 mol%. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain h337T should be assigned to the genus Sphingobacterium. 16S rRNA gene sequence similarity analysis showed that strain h337T was most closely related to 'Sphingobacteriumyamdrokense' 3-0-1 (98.8 %) and Sphingobacteriumyanglingense CCNWSP36-1T (98.5 %) and shared less than 97 % similarity with other species of the genus Sphingobacterium. DNA-DNA hybridization data indicated that the isolate represented a novel genomic species belonging to the genus Sphingobacterium. The characteristics determined in this polyphasic taxonomic study indicated that strain h337T represents a novel species of the genus Sphingobacterium, for which the name Sphingobacterium tabacisoli sp. nov. (type strain h337T=KCTC 52298T=CCTCC AB 2017155T) is proposed.

Bacillus endozanthoxylicus sp. nov., an endophytic bacterium isolated from Zanthoxylum bungeanum Maxim leaves.

A Gram-stain-positive, rod-shaped, motile bacterium, designated as 1404T, was isolated from leaves of Chinese red pepper (Huajiao) (Zanthoxylum bungeanum Maxim) collected from Gansu, north-west China. Spores were not observed under a range of conditions. Strain 1404T was observed to grow at 15-45 °C and pH 6.0-10.0 and in presence of 0-5 % (w/v) NaCl concentration. The cell wall of strain 1404T was found to contain meso-diaminopimelic acid, and the predominant respiratory quinone was identified as MK-7. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unidentified phospholipid as well as three unidentified polar lipids. The major fatty acids profile of strain 1404T consisted of iso-C15 : 0 (25.6 %), anteiso-C15 : 0 (18.4 %) and iso-C14 : 0 (12.1 %). Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain 1404T was affiliated to the genus Bacillus and was closely related to Bacillusoryzisoli 1DS3-10T, Bacillusbenzoevorans DSM 5391T and Bacilluscirculans DSM 11T with sequence similarity of 98.3, 98.2 and 96.9 %, respectively. The G+C content of the genomic DNA was determined to be 39.4 mol%. DNA-DNA hybridization values indicated that relatedness between strain 1404T and the type strains of closely related species of the genus Bacillus was below 41 %. Therefore, on the basis of the data from the polyphasic taxonomic study presented, strain 1404T represents a novel species of the genus Bacillus, for which the name proposed is Bacillus endozanthoxylicus sp. nov. The type strain is 1404T (=CCTCC AB 2017021T=KCTC 33827T).

The Mechanisms of Pharmacological Activities of Ophiocordyceps sinensis Fungi.

The entomopathogenic fungus Ophiocordyceps sinensis, formerly known as Cordyceps sinensis, has long been used as a traditional Chinese medicine for the treatment of many illnesses. In recent years its usage has increased dramatically because of the improvement of people's living standard and the emphasis on health. Such demands have resulted in over-harvesting of this fungus in the wild. Fortunately, scientists have demonstrated that artificially cultured and fermented mycelial products of O. sinensis have similar pharmacological activities to wild O. sinensis. The availability of laboratory cultures will likely to further expand its usage for the treatment of various illnesses. In this review, we summarize recent results on the pharmacological activities of the components of O. sinensis and their putative mechanisms of actions. Copyright © 2016 John Wiley & Sons, Ltd.

Increased polysaccharide production and biosynthetic gene expressions in a submerged culture of Ganoderma lucidum by the overexpression of the homologous α-phosphoglucomutase gene.

This study aimed to improve the production of polysaccharide by engineering the biosynthetic pathway in Ganoderma lucidum through the overexpression of α-phosphoglucomutase (PGM) gene. PGM is responsible for the linkage between sugar catabolism and sugar anabolism. The effects of PGM gene overexpression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including PGM, UDP-glucose pyrophosphorylase (UGP), and ß-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in G. lucidum overexpressing the PGM gene were 23.67 mg/100 mg dry weight and 1.76 g/L, respectively, which were higher by 40.5 and 44.3% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were upregulated by 4.77-, 1.51- and 1.53-fold, respectively, in the engineered strain, suggesting that increased polysaccharide biosynthesis may result from a higher expression of those genes.

AfSwi6 Regulates the Stress Response, Chlamydospore Production, and Pathogenicity in the Nematode-Trapping Fungus Arthrobotrys flagrans.

Nematode-trapping (NT) fungi are a major resource for controlling parasitic nematodes. Arthrobotrys flagrans, as a typical NT fungus, can capture nematodes by producing three-dimensional nets. The APSES transcription factor Swi6 plays a vital role in fungal growth and the pathogenicity of pathogens. In this study, we characterized AfSwi6 via gene disruption using the homologous recombinant method and transcriptome sequencing. Knockout of the AfSwi6 gene caused defects in mycelial growth, trap formation and pathogenicity, chlamydospore production, and stress response. Moreover, the transcriptome data indicated that AfSwi6 was related to DNA repair, stress response, and plasma membrane fusion. The result showed that AfSwi6 has a significant effect on trap development and chlamydospore production in A. flagrans.

Diversity of Trichoderma species associated with the black rot disease of Gastrodia elata, including four new species.

Introduction: Trichoderma species establish symbiotic relationships with plants through both parasitic and mutualistic mechanisms. While some Trichoderma species act as plant pathogenic fungi, others utilize various strategies to protect and enhance plant growth. Methods: Phylogenetic positions of new species of Trichoderma were determined through multi-gene analysis relying on the internal transcribed spacer (ITS) regions of the ribosomal DNA, the translation elongation factor 1-α (tef1-α) gene, and the RNA polymerase II (rpb2) gene. Additionally, pathogenicity experiments were conducted, and the aggressiveness of each isolate was evaluated based on the area of the cross-section of the infected site. Results: In this study, 13 Trichoderma species, including 9 known species and 4 new species, namely, T. delicatum, T. robustum, T. perfasciculatum, and T. subulatum were isolated from the diseased tubers of Gastrodia elata in Yunnan, China. Among the known species, T. hamatum had the highest frequency. T. delicatum belonged to the Koningii clade. T. robustum and T. perfasciculatum were assigned to the Virens clade. T. subulatum emerged as a new member of the Spirale clade. Pathogenicity experiments were conducted on the new species T. robustum, T. delicatum, and T. perfasciculatum, as well as the known species T. hamatum, T. atroviride, and T. harzianum. The infective abilities of different Trichoderma species on G. elata varied, indicating that Trichoderma was a pathogenic fungus causing black rot disease in G. elata. Discussion: This study provided the morphological characteristics of new species and discussed the morphological differences with phylogenetically proximate species, laying the foundation for research aimed at preventing and managing diseases that affect G. elata.

High-throughput method for screening pendimethalin-degrading bacteria from one microbial bank.

The extensive use of chemical pesticides, such as herbicides, has resulted in significant environmental pollution. Microbial degradation represents a crucial approach for managing this pesticide-associated pollution, with enrichment culturing serving as a method for isolating pesticide-degrading microorganisms. However, the efficiency of this strategy is limited, often yielding only a few isolated strains. In this study, a new mineral salt medium (MSM) was developed, and a high-throughput method was used for screening pendimethalin-degrading bacteria by measuring the bacterial growth in the MSM. The utilization of this method resulted in the isolation of 56 pendimethalin-degrading bacteria from approximately 2000 bacterial strains, including 37 Bacillus spp., 10 Alcaligenes spp., 5 Pseudomonas spp., and other 4 strains identified for the first time as pendimethalin-degrading strains. This method may hold promise not only for isolating bacterial strains capable of degrading other pesticides but also for facilitating the utilization of the substantial bacterial strains stored in bacterial banks.

Exploring the nematicidal mechanisms and control efficiencies of oxalic acid producing Aspergillus tubingensis WF01 against root-knot nematodes.

Background and aims: Root-knot nematodes (RKN; Meloidogyne spp.) are among the highly prevalent and significantly detrimental pathogens that cause severe economic and yield losses in crops. Currently, control of RKN primarily relies on the application of chemical nematicides but it has environmental and public health concerns, which open new doors for alternative methods in the form of biological control. Methods: In this study, we investigated the nematicidal and attractive activities of an endophytic strain WF01 against Meloidogyne incognita in concentration-dependent experiments. The active nematicidal metabolite was extracted in the WF01 crude extract through the Sephadex column, and its structure was identified by nuclear magnetic resonance and mass spectrometry data. Results: The strain WF01 was identified as Aspergillus tubingensis based on morphological and molecular characteristics. The nematicidal and attractive metabolite of A. tubingensis WF01 was identified as oxalic acid (OA), which showed solid nematicidal activity against M. incognita, having LC50 of 27.48 µg ml-1. The Nsy-1 of AWC and Odr-7 of AWA were the primary neuron genes for Caenorhabditis elegans to detect OA. Under greenhouse, WF01 broth and 200 µg ml-1 OA could effectively suppress the disease caused by M. incognita on tomatoes respectively with control efficiency (CE) of 62.5% and 70.83%, and promote plant growth. In the field, WF01-WP and 8% OA-WP formulations showed moderate CEs of 51.25%-61.47% against RKN in tomato and tobacco. The combined application of WF01 and OA resulted in excellent CEs of 66.83% and 69.34% toward RKN in tomato and tobacco, respectively. Furthermore, the application of WF01 broth or OA significantly suppressed the infection of J2s in tomatoes by upregulating the expression levels of the genes (PAL, C4H, HCT, and F5H) related to lignin synthesis, and strengthened root lignification. Conclusion: Altogether, our results demonstrated that A. tubingensis WF01 exhibited multiple weapons to control RKN mediated by producing OA to lure and kill RKN in a concentration-dependent manner and strengthen root lignification. This fungus could serve as an environmental bio-nematicide for managing the diseases caused by RKN.

New Species of Didymellaceae within Aquatic Plants from Southwestern China.

Members of Didymellaceae have a wide geographical distribution throughout different ecosystems, and most species are associated with fruit, leaf, stem and root diseases of land plants. However, species that occur in aquatic plants are not clearly known. During a survey of the diversity of endophytes in aquatic plants in Yunnan, Sichuan, and Guizhou provinces, we obtained 51 isolates belonging to Didymellaceae based on internal transcribed spacer region (ITS) sequences. Further, the phylogenetic positions of these isolates were determined by combined sequences composed of ITS, partial large subunit nrRNA gene (28S nrDNA; LSU), RNA polymerase II second largest subunit (rpb2) and partial beta-tubulin gene (tub2). Combining morphological characteristics and multi-locus phylogenetic analyses, two new varieties belong to Boeremia and 12 new species distributed into seven genera were recognized from 51 isolates, i.e., Cumuliphoma, Didymella, Dimorphoma, Ectophoma, Leptosphaerulina, Remotididymella, and Stagonosporopsis. Among these species, only one species of Stagonosporopsis and two species of Leptosphaerulina show teleomorphic stages on OA, but have no anamorphic state. Each new species is described in detail, and the differences between new species and their phylogenetically related species are discussed here. The high frequency of new species indicates that aquatic plants may be a special ecological niche which highly promotes species differentiation. At the same time, the frequent occurrence of new species may indicate the need for extensive investigation of fungal resources in those aquatic environments where fungal diversity may be underestimated.

Two new Trichoderma species (Hypocreales, Hypocreaceae) isolated from decaying tubers of Gastrodiaelate.

Species of Trichoderma are widely distributed around the world. In this study, two new species in Trichoderma, named as T.albidum and T.variegatum, were introduced and illustrated. These species were isolated from diseased tubers of Gastrodiaelata in China and identified based on morphological characteristics and multi-gene sequence analyses of three loci that is the internal transcribed spacer regions of the ribosomal DNA (ITS), the translation elongation factor 1-α encoding gene (tef1-α) and the gene encoding the second largest nuclear RNA polymerase subunit (rpb2). Distinctions between the new species and their close relatives were discussed. According to results of the phylogenetic analyses, T.albidum belonged to the Harzianum clade and T.variegatum are grouped with species of the Spirale clade. The expansion of two clades provided research foundations for the prevention and control of tuber diseases in G.elata.

Volatile Metabolites from Brevundimonas diminuta and Nematicidal Esters Inhibit Meloidogyne javanica.

Brevundimonas diminuta is broadly distributed in terrestrial and aquatic environments and has various biological activities. In this study, we found that B. diminuta exhibited nematicidal activity against the plant root-knot nematode, Meloidogyne javanica. A total of 42 volatile organic compounds (VOCs) from B. diminuta were identified using gas chromatography-mass spectrometry (GC-MS). The nematicidal activity of the 10 main VOCs was tested against M. javanica. Butyl butanoate (4 µL) caused the mortality of 80.13% of M. javanica after 4 h. The nematicidal activity of an additional 38 butyl-butyrate-like volatile esters was also investigated. Of these, seven had strong nematicidal activity against M. javanica, five of which showed egg-hatching inhibitory activity. This study is the first to report that butyl butanoate, ethyl 2-methylbutanoate, ethyl 4-methylpentanoate, ethyl pent-4-enoate, and methyl undecanoate have nematicidal activity against M. javanica. The results indicated that B. diminuta could serve as a candidate microorganism for the biocontrol of plant root-knot nematodes, showing that volatile esters have great potential as nematicides.