First Report of Rice yellow mottle virus in Rice in Federal Democratic Republic of Ethiopia.

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (5). In the Federal Democratic Republic of Ethiopia, however, the disease has never been reported in rice fields. In September 2012, plants with leaf yellowing and mottling symptoms were observed near Bahir Dar and in the Fogera district in the northwestern part of the country during a joint survey of scientists from Madagascar (FOFIFA), Ethiopian Institute of Agricultural Research (EIAR), and Japan International Cooperation Agency (JICA). The disease was observed in 2013 in Fogera and Dera districts, where samples were collected, causing small patches of infected plants in ~5% of the fields. Symptomatic leaves of two plants collected in the fields were inoculated on five plants of the susceptible O. sativa cultivar IR64. All inoculated plants reproduced the typical yellow mottle symptoms. Symptomatic leaves of eight plants collected in the fields reacted positively when tested by double antibody sandwich (DAS)-ELISA tests with a polyclonal antiserum raised against a Madagascan isolate of RYMV (2), indicating for the first time the presence of the virus in Ethiopia. Triple antibody sandwich (TAS) tests with discriminant monoclonal antibodies (2) revealed that they all belonged to serotype 4, a serotype found in East Africa and in Madagascar. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from four samples. The 720-bp coat protein (CP) gene was amplified with reverse transcription (RT)-PCR with the primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. KMO17554, KMO14555, KMO17556, and KMO17557). The four sequences showed over 98% nucleotide identity between each other. They shared over 92% nucleotide identity with isolates of strains S4 found in Kenya, Uganda, Tanzania, and Madagascar (4). Agricultural changes associated to rice intensification are known to favor RYMV emergence and spread (5). Recent efforts have been led by the National Rice Research and Development Strategy (NRRDSE) to intensify rice cultivation in Ethiopia (1). Early knowledge of RYMV occurrence in the country is a prerequisite to extended surveys of the disease and implementation of control measures. References: (1) K. Assefa et al. Challenges and opportunities of rice in Ethiopian agricultural development. www.eiar.gov.et/Publications/frgseries2.pdf , 2011. (2) D. Fargette et al. Arch. Virol. 147:583, 2002. (3) A. Pinel et al. Arch. Virol. 145:1621, 2000. (4) M. Rakotomalala et al. Virus Res. 171:71, 2013. (5) O. Traoré et al. Virus Res. 141:258, 2009.

First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

First Report of Rice yellow mottle virus on Rice in Burundi.

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5'CGCTCAACATCCTTTTCAGGGTAG3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

Near-Complete Genome Sequences of Rice Yellow Mottle Virus Isolates from Senegal.

Rice yellow mottle virus in Senegal is reported here for the first time. The near-complete genomic sequences of two isolates (Se1 and Se5) were obtained. A comparison with 18 sequences from West Africa revealed a new cluster with an isolate from Gambia, located at a basal position in the phylogenetic tree.

A reassessment of the epidemiology of Rice yellow mottle virus following recent advances in field and molecular studies.

The available knowledge on the epidemiology of Rice yellow mottle virus (RYMV) is reassessed in the light of major advances in field and molecular studies of the disease it causes in rice. Previously un-described means of transmission by mammals and through leaf contact have been discovered recently. Several agricultural practices, including the use of seedbed nurseries, have also contributed to a massive build-up of RYMV inoculum. Phytosanitation is now known to be critical to reduce disease incidence in rice. A new model of the ecology of RYMV in which man plays a central role has emerged. Furthermore, estimates of the evolutionary rate of change of RYMV provided a time-frame for its epidemiology, the first attempt for a plant virus. Earlier interpretations of the patterns of virus diversity which assumed a long-term evolution, and assigned a major role to adaptive events had to be discarded. In contrast, a wave-like model of dispersal of RYMV, which postulates its initial diversification in East Africa, followed by westward spread across the continent, was developed, refined and dated. The most salient -- and largely unexpected -- finding is that RYMV emerged recently and subsequently spread rapidly throughout Africa in the last two centuries. Diversification and spread of RYMV has been concomitant with an extension of rice cultivation in Africa since the 19th century. This major agro-ecological change increased the encounters between primary hosts of RYMV and cultivated rice. It also modified the landscape ecology in ways that facilitated virus spread.

First Report of Rice yellow mottle virus in Rice in The Gambia.

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice (Oryza sativa) production in Africa. First reported in Kenya during 1966, RYMV was later found in most countries in Africa where rice is grown (1). In countries in westernmost Africa (The Gambia, Guinea-Bissau, Mauritania, and Senegal), plants with leaf yellowing and mottling symptoms were observed, but RYMV was never isolated. Rice is the staple food in The Gambia. In 2006, four samples were collected from local rice varieties in the Kuntaur Region in the center of The Gambia. Mechanical inoculation with leaf extracts from all samples caused typical yellow mottle symptoms on the susceptible rice varieties BG90-2, Bouaké 189, and IR64. RYMV was detected in the four samples collected by ELISA with polyclonal antisera (2). The 720-nt coat protein gene was amplified for each isolate by reverse-transcriptase-PCR with primers 5'-CAAAGATGGCCAGGAA-3' (sense) and 5'-CTCCCCCACCCATCCCGAGAATT-3' (antisense) (2). The RT-PCR products were directly sequenced (EMBL Accession Nos. AM765810, AM765811, AM765812, and AM765813) and then aligned using ClustalW with a pool of RYMV coat protein sequences from West African isolates (EMBL Accession Nos. AJ279905, AJ279901, AJ885137, AJ885124, and AJ279935). Phylogenetic reconstruction by maximum-likelihood with PAUP indicated that the isolates from The Gambia formed a monophyletic group with over 97% nucleotide identity and are closely related to isolates of other countries in West Africa (Burkina Faso, Côte d'Ivoire, Guinea, Mali, and Sierra-Leone) with 91 to 94% identity. Detection of RYMV in The Gambia indicates that RYMV is present in westernmost Africa, which is referred to as the 'rice belt' of Africa, and shows that RYMV is widely distributed from eastern Africa (Tanzania) to the western part of the continent. References: (1) N. K. Kouassi et al. Plant Dis. 89:124, 2005. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.

First Report of Rice yellow mottle virus in Rice in Uganda.

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa) is grown (2). During July 2000, plants with leaf yellowing and mottling symptoms were observed in Uganda in a subsistence rice field northeast of Lake Victoria, close to the Nile River. RYMV was detected by using enzyme-linked immunosorbent assay with polyclonal RYMV antisera (1) in the four samples collected. Discriminant monoclonal antibodies revealed that the samples contained RYMV serotype 4, a serotype found in eastern Africa (Madagascar, Kenya, and Tanzania) (2). The 720-nt long coat protein gene of two isolates was amplified by reverse transcriptase-polymerase chain reaction and sequenced (1). The two Ugandan isolates had 99% nt sequence identity (EMBL Accession Nos. AM114523 and AM114524). They belonged to a monophyletic group (97% nt identity) containing isolates from eastern Kenya and northern Tanzania (close to the Lake Victoria). These form a sister group (93% identity) of isolates from Lake Malawi Region in western Tanzania and are more distantly related (88% identity) to the basal strains from eastern Tanzania (2). Isolation of the Lake Victoria Region from the rest of the Tanzania by distance, physical barriers, and patchy rice cultivation explains the specificity of the strain. Year-round growth of wild and cultivated rice around the lake ensures host continuity in time and space that facilitates spread that accounts for the homogeneity of the isolates of this area. Knowledge of the presence of RYMV in Uganda is important since rice cultivation is intensified in this country and is planned in neighboring southern Sudan. References: (1) A. Pinel et al. Arch. Virol. 145:1621, 2000. (2) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Recombination, selection and clock-like evolution of Rice yellow mottle virus.

The clock-like diversification of Rice yellow mottle virus (RYMV), a widespread RNA plant virus that infects rice in Africa, was tested following a three-step approach with (i) an exhaustive search of recombinants, (ii) a comprehensive assessment of the selective constraints over lineages, and (iii) a stepwise series of tests of the molecular clock hypothesis. The first evidence of recombination in RYMV was found in East Africa, in the region most favorable to co-infection. RYMV evolved under a pronounced purifying selection, but the selection pressure did vary among lineages. There was no phylogenetic evidence of transient deleterious mutations. ORF2b, which codes for the polymerase and is the most constrained ORF, tends to diversify clock-like. With the other ORFs and the full genome, the departure from the strict clock model was limited. This likely reflects the dominant conservative selection pressure and the clock-like fixation of synonymous mutations.