RESUMEN
Polyglutamine diseases are rare, inherited neurodegenerative pathologies that arise as a result of expansion of trinucleotide CAG repeats in the coding segment of certain genes. This expansion leads to the appearance of mRNA with abnormally long repetitive CAG triplets (mCAG-RNA) and proteins with polyglutamine (PolyQ) tracts in the cells, which is why these pathologies are commonly termed polyglutamine diseases, or PolyQ diseases. To date, nine PolyQ diseases have been described: Huntington's disease, dentatorubral pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), and six different types of spinocerebellar ataxia (SCA 1,2,3,6,7, and 17). PolyQ diseases lead to serious, constantly progressing dysfunctions of the nervous and/or muscular systems, and there currently exists no efficacious therapy for any of them. Recent studies have convincingly shown that mCAG-RNA can actively participate in the pathological process during the development of PolyQ diseases. Mutant RNA is involved in a wide range of molecular mechanisms, ultimately leading to disruption of the functions of transcription, splicing, translation, cytosol structure, RNA transport from the nucleus to the cytoplasm, and, finally, to neurodegeneration. This review discusses the involvement of mutant mCAG-RNA in neurodegenerative processes in PolyQ diseases.
Asunto(s)
Enfermedad de Huntington/genética , Enfermedad de Huntington/patología , Mutación , Péptidos/genética , ARN/genética , Humanos , Expansión de Repetición de Trinucleótido/genéticaRESUMEN
BACKGROUND: The recently developed genetically encoded calcium indicator (GECI), called NTnC, has a novel design with reduced size due to utilization of the troponin C (TnC) as a Ca2+-binding moiety inserted into the mNeonGreen fluorescent protein. NTnC binds two times less Ca2+ ions while maintaining a higher fluorescence brightness at the basal level of Ca2+ in neurons as compared with the calmodulin-based GECIs, such as GCaMPs. In spite of NTnC's high brightness, pH-stability, and high sensitivity to single action potentials, it has a limited fluorescence contrast (F-Ca2+/F+Ca2+) and slow Ca2+ dissociation kinetics. RESULTS: Herein, we developed a new NTnC-like GECI with enhanced fluorescence contrast and kinetics by replacing the mNeonGreen fluorescent subunit of the NTnC indicator with EYFP. Similar to NTnC, the developed indicator, named iYTnC2, has an inverted fluorescence response to Ca2+ (i.e. becoming dimmer with an increase of Ca2+ concentration). In the presence of Mg2+ ions, iYTnC2 demonstrated a 2.8-fold improved fluorescence contrast in vitro as compared with NTnC. The iYTnC2 indicator has lower brightness and pH-stability, but similar photostability as compared with NTnC in vitro. Stopped-flow fluorimetry studies revealed that iYTnC2 has 5-fold faster Ca2+ dissociation kinetics than NTnC. When compared with GCaMP6f GECI, iYTnC2 has up to 5.6-fold faster Ca2+ association kinetics and 1.7-fold slower dissociation kinetics. During calcium transients in cultured mammalian cells, iYTnC2 demonstrated a 2.7-fold higher fluorescence contrast as compared with that for the NTnC. iYTnC2 demonstrated a 4-fold larger response to Ca2+ transients in neuronal cultures than responses of NTnC. iYTnC2 response in neurons was additionally characterized using whole-cell patch clamp. Finally, we demonstrated that iYTnC2 can visualize neuronal activity in vivo in the hippocampus of freely moving mice using a nVista miniscope. CONCLUSIONS: We demonstrate that expanding the family of NTnC-like calcium indicators is a promising strategy for the development of the next generation of GECIs with smaller molecule size and lower Ca2+ ions buffering capacity as compared with commonly used GECIs.
Asunto(s)
Calcio/análisis , Imagen Molecular/métodos , Neuronas/metabolismo , Proteínas Recombinantes/metabolismo , Troponina C/metabolismo , Animales , Calcio/metabolismo , Línea Celular , Fluorescencia , Fluorometría/métodos , Hipocampo/citología , Hipocampo/metabolismo , Humanos , Concentración de Iones de Hidrógeno , Cinética , Masculino , Ratones Endogámicos C57BL , Microscopía Fluorescente/instrumentación , Técnicas de Placa-Clamp , Ingeniería de Proteínas/métodos , Proteínas Recombinantes/química , Proteínas Recombinantes/genética , Imagen de Lapso de Tiempo , Troponina C/genéticaRESUMEN
We studied the ability of oligonucleotides CnT25 (n = 2, 5, 7, 9, 12, 25) to form an intermolecular i-motif using circular dichroism, ultra-violet spectroscopy, nuclear magnetic resonance, high-resolution atomic force microscopy, high-performance liquid chromatography, and molecular dynamics simulations. The arrangement of single-stranded oligonucleotides in multimer i-motifs was very unusual: C-tracts of different oligonucleotides followed each other consecutively in order to fold into a closed intermolecular i-motif core with minimal loops (one cytidine in a loop spanning over a minor groove, three cytidines in a loop over a major groove); intact T-tracts protruded from predefined loci allowing visualization of beetle-like nanostructures by atomic force microscopy. The same structures were formed from analogous biotinylated oligonucleotides demonstrating one of the potential applications of such structures as carriers of multiple functional groups. Our findings open up possibilities for the rational design of pH-sensitive DNA aggregates and evaluation of the efficiency of their assembly.
Asunto(s)
Nanoestructuras/química , Oligonucleótidos/química , Secuencia de Bases , Dicroismo Circular , Microscopía de Fuerza Atómica , Simulación de Dinámica Molecular , Resonancia Magnética Nuclear Biomolecular , Conformación de Ácido Nucleico , Oligonucleótidos/síntesis química , Espectrofotometría UltravioletaRESUMEN
1,2-Diol-oligoribonucleotides were prepared using fully protected 2'-O-[2-(2,3-dihydroxypropyl)amino-2-oxoethyl]uridine 3'-phosphoramidite. Incorporation of the 2'-modified uridine residue into oligonucleotide chains does not significantly affect the thermal stability of RNA and RNA-DNA duplexes. Periodate oxidation of the 1,2-diol results in reactive 2'-aldehyde oligoribonucleotides. Further application of these oligonucleotides for cross-linking with bacterial ribonuclease P was investigated.
Asunto(s)
Aldehídos/química , ADN/química , Ácidos Nucleicos Heterodúplex/química , Oligorribonucleótidos/química , Oligorribonucleótidos/síntesis química , ARN/química , Proteínas Bacterianas/química , Ribonucleasa P/químicaRESUMEN
In order to create effective therapeutically significant oligonucleotide structures, a series of analogs of thrombin-binding aptamer d(GGTTGGTGTGGTTGG) containing thiophosphoryl substitutions were synthesized. The anticoagulation effects of the resultant thrombin-binding aptamer analogs were evaluated and the effects of local thiomodifications on their structure and function were studied, including the effects on stability in blood plasma and resistance to DNA nucleases. A promising modified oligonucleotide (LL11) was found with the structure modified only in TT loops. It retains antithrombin properties of thrombin-binding aptamer, but is more resistant to biodegradation.
Asunto(s)
Anticoagulantes/metabolismo , Aptámeros de Nucleótidos/sangre , Aptámeros de Nucleótidos/metabolismo , Oligonucleótidos/metabolismo , Trombina/metabolismo , Anticoagulantes/farmacología , Aptámeros de Nucleótidos/genética , Secuencia de Bases , Cromatografía Líquida de Alta Presión , Espectrometría de Masas , Datos de Secuencia Molecular , Oligonucleótidos/farmacología , Espectrofotometría Ultravioleta , Tiempo de TrombinaRESUMEN
A human alpha-fetoprotein fragment (AFP) modified with oligocationic homologs of nuclear localization signal was used to construct new target cell-selective DNA-carrier proteins. The new recombinant vectors containing C- or N-terminal polynucleotide-binding domains are able to form stable complexes with single- or double-stranded oligonucleotides and plasmid DNA. Using flow cytometry and fluorescent microscopy, it was shown that such nucleoprotein complexes can be selectively internalized in target cells receptors superexpressing AFP receptors. The results obtained are important both for understanding mechanisms of formation of DNA-protein complexes and for studying their interaction with intracellular molecular targets. The new proteins can be used as a tool for the development of highly selective and efficacious gene-selective antitumour drugs.
Asunto(s)
ADN/administración & dosificación , alfa-Fetoproteínas/genética , Secuencia de Aminoácidos , Línea Celular Tumoral , ADN/química , Proteínas de Unión al ADN/química , Proteínas de Unión al ADN/genética , Proteínas de Unión al ADN/metabolismo , Portadores de Fármacos , Colorantes Fluorescentes , Humanos , Ligandos , Datos de Secuencia Molecular , Señales de Localización Nuclear , Oligonucleótidos/administración & dosificación , Oligonucleótidos/química , Plásmidos , Estructura Terciaria de Proteína , Receptores de Péptidos/metabolismo , Proteínas Recombinantes/química , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismo , alfa-Fetoproteínas/química , alfa-Fetoproteínas/metabolismoRESUMEN
HEX-labeled oligonucleotides obtained via typical synthetic protocols may contain more than 15% of material with altered spectral characteristics. We discovered hexachlorofluorescein residue transformation unknown earlier for standard DNA ammonolysis step. HEX residue reacts with ammonium hydroxide yielding acridine derivative, which has differed UV-VIS and fluorescent properties compared to HEX. Therefore, for critical bioassays where sensitivity and/or fluorescent signal differentiation (e.g., in quantitative or multiplexed assays) are essential, the careful RP-HPLC purification step is required.
Asunto(s)
Fluoresceínas/química , Fluorescencia , Colorantes Fluorescentes/química , Oligonucleótidos/química , Acridinas/síntesis química , Acridinas/química , Cromatografía Líquida de Alta PresiónRESUMEN
The recombinant protein PGEk, containing residual of the human epidermal factor (hEGF) bearing DNA binding sequence, retains ability of hEGF to bind with hEGF receptor and to induce cell proliferation was shown. On an example of PGEk complexes with telomeric mimic-oligodeoxyribonucleotide d(TTAGGG)4 and with its thio-analogue we had found such systems can be effectively and selectively internalized by hEGF receptors super expressing cells. The association of this process with a protein/oligonucleotide ratio in complexes was investigated. The intracellular localization of oligonucleotides was explored. We had shown that PGEk not only promotes intensive delivery of oligonucleotides, but also protects them from degradation by nucleases. The oligonucleotides in composition of complexes have considerably more expressed cytotoxic activity in comparison with free oligonucleotides.
Asunto(s)
Proliferación Celular/efectos de los fármacos , Citotoxinas/farmacología , Proteínas de Unión al ADN/farmacología , Factor de Crecimiento Epidérmico/farmacología , Oligonucleótidos/farmacología , Proteínas Recombinantes de Fusión/farmacología , Telómero , Animales , Citotoxinas/genética , Proteínas de Unión al ADN/genética , Factor de Crecimiento Epidérmico/genética , Células HeLa , Humanos , Ratones , Oligonucleótidos/genética , Proteínas Recombinantes de Fusión/genética , Telómero/genéticaRESUMEN
The technique of parallel automated synthesis of oligodeoxynucleotides bearing various local thiophosphoryl internucleotide bonds was optimized using assembling in the standby mode and creation of special program blocks. The selected conditions of Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI TOF MS) provided an increase in the method sensitivity (up to 1-10 fmol of oligonucleotide in sample) and registration of reliable spectra of oligodeoxynucleotide thiophosphoryl analogues. This enables to reliably prove the presence of the specified number of thiophosphoryl bonds within synthetic sequences. A series of oligodeoxynucleotides, thioanalogues of d(GGTTGGTGTGGTTGG), a known G-quadruplex antithrombin aptamer, were obtained.
Asunto(s)
Aptámeros de Nucleótidos/síntesis química , Fibrinolíticos/síntesis química , Oligonucleótidos/síntesis química , Fosfatos/síntesis química , Aptámeros de Nucleótidos/química , Fibrinolíticos/química , Oligonucleótidos/química , Fosfatos/química , Espectrometría de Masa por Láser de Matriz Asistida de Ionización DesorciónRESUMEN
The complexation of the new protein vector PGEk--a carrier of nucleic acids into proliferating cells with phosphodiester d(TTAGGG)4 (TMO) and phosphorothioate Sd(TTAGGG)4 (TMS) telomerase inhibitor oligonucleotides was studied. PGEk molecule, consisting of 64 amino acids, is comprising the sequence of the human epidermal growth factor EGFh which is hydrophobic cell targeting moiety serving for receptor-mediated endocytosis and an NLS (nuclear localization signal) which is hydrophilic serving as a DNA-binding and selective nuclear import moiety. Experiments were carried out in 0.01 M Na-phosphate buffer contained 0.1 M NaCl, pH 7.8 at 37 degrees C. CD spectral analysis revealed that TMO molecules folded back into intramolecular antiparallel G-quadruplex while TMS molecules were represented as unstructured thread. The number of adsorbed PGEk molecules were estimated using PGEk intrinsic fluorescence decrease and fluorescence polarization increase of PGEk under oligonucleotide titration. Adsorption isotherms were plotted in Scatchard coordinates. We have shown that adsorption of the first two PGEk molecules on TMO and TMS occurs noncooperatively with the high association constants K1(TMO) = (7 +/- 1) x 10(7) M(-1) and K1(TMS) = (3 +/- 0.5) x 10(7) M(-1), respectively. Further adsorption up to 5-6 PGEk molecules on TMO occurrs cooperatively with still high association constant K2(TMO) = (4.0 +/- 1.5) x 10(6) M(-1). TMS oligonucleotide binds the third PGEk molecule rather weakly, K2(TMS) = (8 +/- 2) x 10(5) M(-1). CD spectral analysis revealed that G-quadruplex structure formed by TMO have undergone a partial unfolding by binding of PGEk molecules while single-stranded structure formed by TMS was not affected by binding PGEk. Thus, the tertiary structure of DNA and the number of adsorbed PGEk molecules formed biologically active compounds PGEk: TMO and PGEk: TMS were defined, which are able to penetrate through the membrane of proliferating cells and to suppress their growth.
Asunto(s)
Inhibidores Enzimáticos/química , Factor de Crecimiento Epidérmico/química , Oligodesoxirribonucleótidos/química , Telomerasa/antagonistas & inhibidores , Telómero/química , Transporte Activo de Núcleo Celular , Animales , Núcleo Celular , Proliferación Celular , Humanos , Estructura Terciaria de Proteína , Telomerasa/químicaRESUMEN
Three evolutionary conserved sites of Alu repeats (PQS2, PQS3 and PQS4) were shown to form stable inter- and intramolecular G-quadruplexes (GQs) in vitro. Structures and topologies of these GQs were elucidated using spectral methods. Self-association of G-rich Alu fragments was studied. Dimeric GQ formation from two distal identical or different putative quadruplex sites - (PQS2)2, (PQS3)2 or PQS2-PQS3 - within one lengthy DNA strand was demonstrated by a FRET-based method. Oligomer PQS4 (folded into a parallel intramolecular GQ) was shown to form stacks of quadruplexes that are stabilized by stacking interactions of external G-tetrads (this was confirmed by DOSY NMR, AFM microscopy and differential CD spectroscopy). Comparative analysis of the properties of various GQs allowed us to put forward a hypothesis of two general mechanisms of intermolecular GQ-dependant genomic rearrangements: 1) formation of a dimeric GQs; 2) association of pre-folded intramolecular parallel GQs from different strands into GQ-stacks. Thus, the observed co-localization of G-rich motifs of Alu elements with double-strand break hotspots and rearrangement hotspots may be accounted for by the specific secondary structure of these motifs. At the same time, this is likely primarily due to high abundance of such G-rich Alu fragments in the genome.
Asunto(s)
Elementos Alu , G-Cuádruplex , Reordenamiento Génico , Genoma Humano , Humanos , Espectroscopía Infrarroja por Transformada de FourierRESUMEN
In this paper, we report results of systematic studies of conformational polymorphism of G-rich DNA fragments from Alu repeats. Alu retrotransposones are primate-specific short interspersed elements. Using the Alu sequence from the prooncogen bcl2 intron and the consensus AluSx sequence as representative examples, we determined characteristic Alu sites that are capable of adopting G-quadruplex (GQ) conformations (i.e., potential quadruplex sites - PQSAlu), and demonstrated by bioinformatics methods that those sites are Alu-specific in the human genome. Genomic frequencies of PQSAlu were assessed (~1/10000 b.p.). The sites were found to be characteristic of young (active) Alu families (Alu-Y). A recombinant DNA sequence bearing the Alu element from the human bcl2 gene (304 b.p.) and its PQS-mutant (Alu-PQS) were constructed. The formation of noncanonical structures in Alubcl2 dsDNA and the absence of such structures in the case of Alu-PQS were shown using DMS-footprinting and AFM microscopy. Expression vectors bearing wild-type and mutant Alu insertions in the promoter regions were obtained, and the effects of these insertions on the expression of the reporter gene in ÐÐÐ293 and HeLa cell lines were compared. Our findings on the spatial organization of Alu repeats may provide insight into the mechanisms of genomic rearrangements which underlie many oncological and neurodegenerative diseases.
Asunto(s)
Elementos Alu , Intrones , Mutación , Conformación de Ácido Nucleico , Proteínas Proto-Oncogénicas c-bcl-2/genética , Animales , Células COS , Chlorocebus aethiops , Células HEK293 , Células HeLa , Humanos , Proteínas Proto-Oncogénicas c-bcl-2/metabolismoRESUMEN
A method to obtain genus-specific DNA probes is suggested. It consists of specific amplification of the intergenic spacer between the 18S and 5.8S ribosomal RNA genes, using primers deduced from conservative ribosomal DNA sequences. The utility of the method is demonstrated on isolation of the 209 b.p. spacer fragment from the genomic DNA of a plant pathogenic fungus Fusarium oxysporum.
Asunto(s)
Sondas de ADN , Fusarium/genética , Secuencia de Bases , Clonación Molecular , Electroforesis en Gel de Agar , Genes Fúngicos , Datos de Secuencia Molecular , Plásmidos , Especificidad de la EspecieRESUMEN
We showed earlier that oligonucleotides 3'-d(GT)5-pO(CH2CH2O)3p-d(GT)5-3' form bimolecular quadruplexes with parallel orientation of their strands, which are held by guanine quartets alternating with unpaired thymines (GT quadruplex). This work deals with the conformational polymorphism and extensibility of G quadruplexes in complex with molecules of an intercalating agent ethidium bromide (EtBr). A cooperative mechanism of EtBr binding to the GT quadruplex was revealed. The binding constant K = (3.3 +/- 0.1) x 10(4) M-1, cooperativity coefficient omega = 2.5 +/- 0.2, and maximal amount of EtBr molecules intercalated in GT quadruplex (N = 8) were determined. It was proved experimentally by analysis of adsorption isotherms and theoretically by mathematical modeling that the GT quadruplex is capable of double extension, which is indicative of the high elasticity of this four-stranded helix. Two most stable conformations of GT quadruplexes with thymine residues intercalated and/or turned outside were found by mechanico-mathematical modeling. The equilibrium is shifted toward the conformation with the looped out thymine residues upon intercalation of EtBr molecules into the GT quadruplex.
Asunto(s)
Conformación de Ácido Nucleico , Secuencias Repetitivas de Ácidos Nucleicos , Secuencia de Bases , Cartilla de ADN , Modelos MolecularesRESUMEN
Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.
Asunto(s)
Aciltransferasas/genética , Gossypium/enzimología , Secuencia de Aminoácidos , Secuencia de Bases , ADN de Cadena Simple , Datos de Secuencia Molecular , Reacción en Cadena de la Polimerasa , Homología de Secuencia de Aminoácido , Homología de Secuencia de Ácido Nucleico , Especificidad de la EspecieRESUMEN
A modified gene (Bt77) of delta-endotoxin from Bacillus thuringiensis var. tenebrionis was constructed and cloned into pMON505. This binary transformation vector was introduced into Agrobacterium tumefaciens strains containing different helper disarmed Ti-plasmids, LBA4404, A281, and CBE21. These Agrobacterium strains were used to transform potato stem segments (S. tuberosum, cv Desiree, Resy, Temp, Granat). Regenerants were selected on kanamycin-containing media. The presence of the Bt77 sequence in plant genomic DNA was confirmed by PCR analysis. Bt gene expression was studied in regenerated plants. Western blot analysis revealed that transgenic plants produced the Bt protein in the range of 0.005-0.02% of total protein. Total protection against insect damage of leaf tissue from these plants was observed in laboratory bioassays with of Colorado beetle larvae. Transgenic plants showed incomplete protection from CB larvae.
Asunto(s)
Bacillus thuringiensis/genética , Proteínas Bacterianas/genética , Toxinas Bacterianas , Endotoxinas/genética , Solanum tuberosum/genética , Agrobacterium tumefaciens/genética , Toxinas de Bacillus thuringiensis , Secuencia de Bases , Cartilla de ADN , Proteínas Hemolisinas , Datos de Secuencia Molecular , Control Biológico de Vectores , Plantas Modificadas Genéticamente , Plásmidos , Reacción en Cadena de la Polimerasa , Transformación GenéticaRESUMEN
A recombinant plasmid providing for the synthesis and secretion of the human atrial natriuretic peptide (hANP) as a C-terminal hybrid with the St. aureus protein A was constructed. The level of secretion of the chimeric proteins and their proteolytic stability were shown to depend upon the genotype of the recipient strains and the cultivation conditions. The hybrid proteins were purified by chromatography on IgG Sepharose. The presence of peptides corresponding to the hANP in the acid hydrolysates of the secreted and affinity-purified proteins was confirmed by the enzyme-linked immunoassay and analytical HPLC.
Asunto(s)
Factor Natriurético Atrial/genética , Escherichia coli/genética , Secuencia de Aminoácidos , Factor Natriurético Atrial/química , Factor Natriurético Atrial/metabolismo , Secuencia de Bases , Humanos , Hidrólisis , Datos de Secuencia Molecular , Oligodesoxirribonucleótidos , Plásmidos , Proteínas Recombinantes de Fusión/química , Proteínas Recombinantes de Fusión/genética , Proteína Estafilocócica A/genéticaRESUMEN
Amylose isomerase (AI) preparations were isolated from rabbit muscles after Petrova et al., as well as by the additional fractionation steps. Their homogeneity, enzymatic activity and RNA, isolated from those preparations, were characterized. AI preparations, as described by Petrova et al., proved to be heterogeneous in respect to the protein and RNA; by using additional fractionation methods RNA and protein have been separated from each other, which proves that a homogeneous stable ribonucleoprotein complex, exerting AI activity, does not exist. It was shown by three independent methods that AI preparations isolated after Petrova do not display branching, but have amylolytic activity. RNA, isolated along with the AI preparations, proved to be mainly total tRNA degraded to different degrees. No RNA corresponding to the previously sequenced 2.5S RNA could be detected in these preparations. RNA preparations do not manifest neither branching, nor amylolytic activity. Our data prove that there is no ribozyme, whose existence has been suggested previously.
Asunto(s)
Enzima Ramificadora de 1,4-alfa-Glucano/metabolismo , Músculos/enzimología , ARN Catalítico/metabolismo , Ribonucleoproteínas/metabolismo , Enzima Ramificadora de 1,4-alfa-Glucano/genética , Animales , Secuencia de Bases , Cromatografía en Gel , Electroforesis en Gel de Poliacrilamida , Datos de Secuencia Molecular , ARN/genética , ConejosRESUMEN
Association between the RAPD markers and the resistance to race 4 of the black rot causative agent was studied in Brassica rapa L. Experiments were carried out using doubled haploid lines, obtained via crosses between the race 4-susceptible fodder turnip and resistant pak-choi, and the F2 progeny of the crosses between the doubled haploid lines with contrasting resistance. The WE(22)980 RAPD marker inherited from the pak-choi and associated with the clubroot susceptibility was also linked to the locus responsible for the resistance to race 4 of Xanthomonas campestris pv. campestris. The two other RAPD markers were linked to susceptibility to black rot. Simultaneous association of the same DNA markers with the resistance/susceptibility to two different obligate pathogens favored the hypothesis on cluster organization of the resistance genes in plants. The markers described can be used in plant breeding and in further investigation of the genetic bases of resistance in plants.
Asunto(s)
Brassica/genética , Mapeo Cromosómico , Ligamiento Genético , Marcadores Genéticos , Xanthomonas campestris/patogenicidad , Secuencia de Bases , Brassica/microbiología , Cartilla de ADN , Técnica del ADN Polimorfo Amplificado AleatorioRESUMEN
The frequency of specific mini- and micro-satellites known also as short tandem repeated sequences (STR) in the human 13 chromosome was estimated by hybridization of STR core oligonucleotides to recombinant cosmid clones transferred to a grid from a human 13 chromosome specific cosmid library ICRF Lawrist 4 C108 (DN L4/HS 13). Oligonucleotides: M13 and Jeffreys minisatellite core sequences and micro-satellite core sequences (TCC)5, (CAC)5, and (GACA)4 were [gamma-32P] end labeled and hybridized to membrane filters carrying good ordered cosmid clones. It was shown that great number of all these mini- and micro-satellite copies (besides of Jeffreys minisatellite) are spread independently along the 13th chromosome. It was also estimated that two or more (GACA)n blocks present in the same cosmid (i.e. on the stretch of 40-50 kb) forming similar groups of clustered micro-satellites. The interesting peculiarity has been recorded that some (GACA)n+ cosmids are also hybridizable to conservative 28SrDNA 3'-fragment that indicates that (GACA)n localization in the nucleoli area. As the result of it we began the creation of a new highly polymorphic markers collections for these chromosome.