RESUMEN
Achieving time-dependent phosphorescence color (TDPC) in organic materials is attractive but extremely challenging due to the nonradiative decay and modulation puzzle of triplet state. Herein, xylan, a hemicellulose waste from the paper mill, was used to construct carbonized polymer dots (CPDs) with clusterization-triggered room-temperature phosphorescence (RTP). CPDs were endowed with tuneable triplet energy levels by through-space conjugation of heteroatom groups, which could be confined in silica to simultaneously activate surface oxide-related low-energy and cross-linked core N-related high-energy emissive centers. Thus, the blue emissive center with a lifetime of 425.6 ms and green emissive center with a longer lifetime of 1506 ms coexisted in the confined CPDs; the former was the dominant contribution to RTP at first, and the latter became dominant over time, leading to a typical TDPC evolution with large color contrast from blue to blue-green and then to green. Meanwhile, the TDPC could remain unobstructed after the confined CPDs were soaked in water for more than a month. The CPDs were successfully applied in location and deformation imaging of hydrogel and advanced dynamic information encryption and anticounterfeiting. The work may shed new light on the design of TDPC materials and broaden the high-value use of paper-mill waste xylan.
RESUMEN
OBJECTIVE: The intricate neuroanatomical structure of the cerebellum is of longstanding interest in epilepsy, but has been poorly characterized within the current corticocentric models of this disease. We quantified cross-sectional regional cerebellar lobule volumes using structural magnetic resonance imaging in 1602 adults with epilepsy and 1022 healthy controls across 22 sites from the global ENIGMA-Epilepsy working group. METHODS: A state-of-the-art deep learning-based approach was employed that parcellates the cerebellum into 28 neuroanatomical subregions. Linear mixed models compared total and regional cerebellar volume in (1) all epilepsies, (2) temporal lobe epilepsy with hippocampal sclerosis (TLE-HS), (3) nonlesional temporal lobe epilepsy, (4) genetic generalized epilepsy, and (5) extratemporal focal epilepsy (ETLE). Relationships were examined for cerebellar volume versus age at seizure onset, duration of epilepsy, phenytoin treatment, and cerebral cortical thickness. RESULTS: Across all epilepsies, reduced total cerebellar volume was observed (d = .42). Maximum volume loss was observed in the corpus medullare (dmax = .49) and posterior lobe gray matter regions, including bilateral lobules VIIB (dmax = .47), crus I/II (dmax = .39), VIIIA (dmax = .45), and VIIIB (dmax = .40). Earlier age at seizure onset ( η ρ max 2 = .05) and longer epilepsy duration ( η ρ max 2 = .06) correlated with reduced volume in these regions. Findings were most pronounced in TLE-HS and ETLE, with distinct neuroanatomical profiles observed in the posterior lobe. Phenytoin treatment was associated with reduced posterior lobe volume. Cerebellum volume correlated with cerebral cortical thinning more strongly in the epilepsy cohort than in controls. SIGNIFICANCE: We provide robust evidence of deep cerebellar and posterior lobe subregional gray matter volume loss in patients with chronic epilepsy. Volume loss was maximal for posterior subregions implicated in nonmotor functions, relative to motor regions of both the anterior and posterior lobe. Associations between cerebral and cerebellar changes, and variability of neuroanatomical profiles across epilepsy syndromes argue for more precise incorporation of cerebellar subregional damage into neurobiological models of epilepsy.
Asunto(s)
Epilepsia del Lóbulo Temporal , Síndromes Epilépticos , Adulto , Humanos , Epilepsia del Lóbulo Temporal/complicaciones , Fenitoína , Estudios Transversales , Síndromes Epilépticos/complicaciones , Cerebelo/diagnóstico por imagen , Cerebelo/patología , Convulsiones/complicaciones , Imagen por Resonancia Magnética/métodos , Atrofia/patologíaRESUMEN
Nonspecific amplification is a serious issue in DNA detection as it can lead to false-positive results and reduce specificity. It is very important to well understand its mechanism through sequencing nonspecific products. Here, an approach is developed using a nanopore sequencing technique after acquiring the long repetitive sequence of DNA products from nonspecific amplification. Based on the sequencing results, a new mechanism of nonspecific amplification designated as dynamic mismatched primer binding (DMPB) with the background DNA (bgDNA) is proposed. Unexpectedly, our findings show that the primers (â¼20 nt) can bind to bgDNA for primer extension when only 6-11 fully matched (9-14 mismatched) base pairs are formed. After the single-stranded DNAs (ssDNAs) attached to the first primer are produced, more interestingly, with the aid of DNA polymerase, the other primer can bind to these ssDNAs in the case that the fully matched base pairs formed between them are even shorter than 6 bp. As a result, perfect "seeds" for polymerase chain reaction with information on both primers are produced so that exponential nonspecific amplification can occur. The DMPB mechanism can explain nonspecific amplification in other approaches as well. Finally, a mini-hairpin DNA is used to effectively inhibit nonspecific amplification by preventing the formation of an unexpected primer-bgDNA complex.
Asunto(s)
ADN Polimerasa Dirigida por ADN , ADN , ADN/genética , Reacción en Cadena de la Polimerasa/métodos , Cartilla de ADN , Secuencias Repetitivas de Ácidos Nucleicos , ADN de Cadena Simple , Técnicas de Amplificación de Ácido Nucleico/métodosRESUMEN
RATIONALE: Nasopharyngeal carcinoma (NPC) is a malignant tumor that is endemic in Southeast Asia, North Africa, and southern China. There is an urgent need for effective early diagnosis and treatment of this disease since NPC is currently often detected at advanced stages. METHODS: To reveal the underlying metabolic mechanisms and discover potential diagnostic biomarkers of NPC, we employed ultrahigh-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UHPLC-Q-TOF-MS) and UHPLC-Q-Exactive Orbitrap MS, respectively, to analyze 54 serum samples and 54 urine samples from 27 patients with NPC and 27 healthy control individuals. RESULTS: A total of 1230 metabolites were determined in serum samples, and 181 of the 1230 metabolites were significantly changed in NPC patients. The 181 metabolites were enriched in 16 pathways, including biosynthesis of unsaturated fatty acids, cholesterol metabolism, and ferroptosis. A total of 2509 metabolites were detected in the urine samples. Among them, 179 metabolites were significantly altered in NPC patients, and these metabolites were enriched in eight pathways, including the tricarboxylic acid (TCA) cycle and caffeine metabolism. Seven metabolites, including creatinine and paraxanthine, were found to be significantly changed in both NPC serum and urine samples. Based on them, further biomarker analysis revealed that the panel of three serum metabolites, octanoylcarnitine, creatinine, and decanoyl-l-carnitine, displayed a perfect diagnostic performance (area under the curve [AUC] = 0.973) to distinguish NPC patients from controls, while the other three-metabolite biomarker panel, consisting of stachydrine, decanoyl-l-carnitine, and paraxanthine, had an AUC = 0.809 to distinguish NPC and control in urine samples. CONCLUSION: This work highlights the key metabolites and metabolic pathways disturbed in NPC and presents potential biomarkers for effective diagnosis of this disease.
Asunto(s)
Metabolómica , Neoplasias Nasofaríngeas , Humanos , Carcinoma Nasofaríngeo/diagnóstico , Creatinina , Cromatografía Líquida de Alta Presión/métodos , Metabolómica/métodos , Biomarcadores , Redes y Vías Metabólicas , Carnitina , Neoplasias Nasofaríngeas/diagnósticoRESUMEN
Introduction: In immunotherapy, antibodies are activated to block immune checkpoints, resist tumour immunosuppression, shrink tumours and prevent a recurrence. As the science behind tumour immunotherapy continuously develops and improves, neoadjuvant immunotherapy bears more prominent advantages: antigen exposure not only enhances the degree of tumour-specific T-cell response but also prolongs the duration of actions. In this study, we evaluated the efficacy and safety of McKeown minimally invasive oesophagectomy (McKeown MIO) following neoadjuvant immunotherapy combined with chemotherapy (NICT) in patients with locally advanced oesophageal cancer (OC). Patients and Methods: In this retrospective study, 94 patients underwent either NICT or neoadjuvant chemotherapy (NCT) followed by MIO at our institution from January 2020 to October 2022. We assessed the therapy-related adverse events and perioperative outcomes and compared them between the two groups. Results: After completing at least two cycles of neoadjuvant therapy, all patients underwent McKeown MIO with negative margins within 4-7 weeks. Demographic data of the two cohorts were similar. Regarding perioperative characteristics, the median intraoperative blood loss was 50 ml in the NICT group, lower than that of the NCT group (100 ml, P < 0.05). In addition, the NICT group had significantly more harvested lymph nodes than the NCT group (P < 0.05). No significant differences were found in post-operative complications. The rate of objective response rate in the NICT group was higher than that in the NCT group (88.3% vs. 58.8%). Regarding tumour regression, the number of patients with TRG Grades 1-3 in the NICT group was more than that in the NCT. Adverse events experienced by the two groups included anaemia and elevated transaminase. We found no difference in the adverse events between the two groups. Conclusions: This study showed the efficacy and feasibility of NICT followed by McKeown MIO in treating locally advanced OC.
RESUMEN
OBJECTIVE: Recent work has shown that people with common epilepsies have characteristic patterns of cortical thinning, and that these changes may be progressive over time. Leveraging a large multicenter cross-sectional cohort, we investigated whether regional morphometric changes occur in a sequential manner, and whether these changes in people with mesial temporal lobe epilepsy and hippocampal sclerosis (MTLE-HS) correlate with clinical features. METHODS: We extracted regional measures of cortical thickness, surface area, and subcortical brain volumes from T1-weighted (T1W) magnetic resonance imaging (MRI) scans collected by the ENIGMA-Epilepsy consortium, comprising 804 people with MTLE-HS and 1625 healthy controls from 25 centers. Features with a moderate case-control effect size (Cohen d ≥ .5) were used to train an event-based model (EBM), which estimates a sequence of disease-specific biomarker changes from cross-sectional data and assigns a biomarker-based fine-grained disease stage to individual patients. We tested for associations between EBM disease stage and duration of epilepsy, age at onset, and antiseizure medicine (ASM) resistance. RESULTS: In MTLE-HS, decrease in ipsilateral hippocampal volume along with increased asymmetry in hippocampal volume was followed by reduced thickness in neocortical regions, reduction in ipsilateral thalamus volume, and finally, increase in ipsilateral lateral ventricle volume. EBM stage was correlated with duration of illness (Spearman ρ = .293, p = 7.03 × 10-16 ), age at onset (ρ = -.18, p = 9.82 × 10-7 ), and ASM resistance (area under the curve = .59, p = .043, Mann-Whitney U test). However, associations were driven by cases assigned to EBM Stage 0, which represents MTLE-HS with mild or nondetectable abnormality on T1W MRI. SIGNIFICANCE: From cross-sectional MRI, we reconstructed a disease progression model that highlights a sequence of MRI changes that aligns with previous longitudinal studies. This model could be used to stage MTLE-HS subjects in other cohorts and help establish connections between imaging-based progression staging and clinical features.
Asunto(s)
Epilepsia del Lóbulo Temporal , Epilepsia , Atrofia/patología , Biomarcadores , Estudios Transversales , Epilepsia/complicaciones , Epilepsia del Lóbulo Temporal/patología , Hipocampo/diagnóstico por imagen , Hipocampo/patología , Humanos , Imagen por Resonancia Magnética/métodos , Esclerosis/complicacionesRESUMEN
Polysaccharide nanocrystals have led to the development of multifunctional and sustainable materials, but most are glucose-based carbohydrates derived from valuable natural sources. Here, we present a top-down strategy that enables one, for the first time, to isolate xylose-based hemicellulose nanocrystals from available industrial biowastes. By leveraging the selective oxidation of alkaline periodate, as high as 34 wt % solid yield is accessible. The hemicellulose nanocrystals exhibit platelet-like shapes (10-20 nm thickness, 30-80 nm wide), crystalline features, and superior dispersibility in water. We also showcase their successful interface applications for one-dimensional (1D) carbon nanotube (CNT) nanoinks and two-dimensional (2D) transition-metal dichalcogenide (TMD) nanozymes, which are comparable to the traditional cellulose nanocrystals. The scalable, low-cost, and sustainable hemicellulose nanocrystals can be envisioned to provide an alternative for glucose-based polysaccharide nanocrystals, as well as hold promise for the high-value utilization of biowastes.
Asunto(s)
Nanopartículas , Polisacáridos , Polisacáridos/química , Celulosa/química , Nanopartículas/química , GlucosaRESUMEN
Epilepsy incidence and prevalence peaks in older adults yet systematic studies of brain ageing and cognition in older adults with epilepsy remain limited. Here, we characterize patterns of cortical atrophy and cognitive impairment in 73 older adults with temporal lobe epilepsy (>55 years) and compare these patterns to those observed in 70 healthy controls and 79 patients with amnestic mild cognitive impairment, the prodromal stage of Alzheimer's disease. Patients with temporal lobe epilepsy were recruited from four tertiary epilepsy surgical centres; amnestic mild cognitive impairment and control subjects were obtained from the Alzheimer's Disease Neuroimaging Initiative database. Whole brain and region of interest analyses were conducted between patient groups and controls, as well as between temporal lobe epilepsy patients with early-onset (age of onset <50 years) and late-onset (>50 years) seizures. Older adults with temporal lobe epilepsy demonstrated a similar pattern and magnitude of medial temporal lobe atrophy to amnestic mild cognitive impairment. Region of interest analyses revealed pronounced medial temporal lobe thinning in both patient groups in bilateral entorhinal, temporal pole, and fusiform regions (all P < 0.05). Patients with temporal lobe epilepsy demonstrated thinner left entorhinal cortex compared to amnestic mild cognitive impairment (P = 0.02). Patients with late-onset temporal lobe epilepsy had a more consistent pattern of cortical thinning than patients with early-onset epilepsy, demonstrating decreased cortical thickness extending into the bilateral fusiform (both P < 0.01). Both temporal lobe epilepsy and amnestic mild cognitive impairment groups showed significant memory and language impairment relative to healthy control subjects. However, despite similar performances in language and memory encoding, patients with amnestic mild cognitive impairment demonstrated poorer delayed memory performances relative to both early and late-onset temporal lobe epilepsy. Medial temporal lobe atrophy and cognitive impairment overlap between older adults with temporal lobe epilepsy and amnestic mild cognitive impairment highlights the risks of growing old with epilepsy. Concerns regarding accelerated ageing and Alzheimer's disease co-morbidity in older adults with temporal lobe epilepsy suggests an urgent need for translational research aimed at identifying common mechanisms and/or targeting symptoms shared across a broad neurological disease spectrum.
Asunto(s)
Corteza Cerebral/patología , Disfunción Cognitiva/patología , Disfunción Cognitiva/psicología , Epilepsia del Lóbulo Temporal/patología , Epilepsia del Lóbulo Temporal/psicología , Anciano , Atrofia , Femenino , Humanos , Imagen por Resonancia Magnética , Masculino , Persona de Mediana Edad , Pruebas NeuropsicológicasRESUMEN
BACKGROUND: The present study aimed to determine the functional role of miR-206 in T helper 17 (Th17)/regulatory T (Treg) cell differentiation during the development of osteoarthritis (OA). METHODS: Patients with OA and healthy controls were recruited for investigating the association between miR-206 and Th17/Treg ratio. Transfection experiments were conducted in CD4+ T cells to verify the mechanism of miR-206 on the balance of Treg/Th17. OA model was constructed to detect the clinical score, histopathological changes and Treg/Th17 ratio. OA model was induced in rats to verify the effect of miR-206 inhibition on Th17/Treg immunoregulation. RESULTS: High expression of miR-206 was positively correlated with peripheral Th17/Treg imbalance in patients with OA. The interactions between miR-206 and the 3' untranslated regions (3'-UTR) of suppressor of cytokine signaling-3 (SOCS3) and fork head transcriptional factor 3 (Foxp3) were confirmed by luciferase reporter assays. MiR-206 disturbed the Th17/Treg balance by targeting SOCS3 and Foxp3. In vivo assay demonstrated that antagomiR directed against miR-206 restored Th17/Treg balance during the development of OA. CONCLUSION: MiR-206 contributed to the progression of OA by modulating Th17/Treg imbalance, suggesting that miR-206 inhibition might be a promising therapeutic strategy for the treatment of OA.
Asunto(s)
Regulación de la Expresión Génica , MicroARNs/genética , Osteoartritis/etiología , Linfocitos T Reguladores/inmunología , Linfocitos T Reguladores/metabolismo , Células Th17/inmunología , Células Th17/metabolismo , Regiones no Traducidas 3' , Adulto , Anciano , Anciano de 80 o más Años , Animales , Biomarcadores , Estudios de Casos y Controles , Modelos Animales de Enfermedad , Susceptibilidad a Enfermedades/inmunología , Femenino , Humanos , Recuento de Linfocitos , Masculino , Persona de Mediana Edad , Osteoartritis/metabolismo , Osteoartritis/patología , Interferencia de ARN , Ratas , Proteína 3 Supresora de la Señalización de Citocinas/genética , Adulto JovenRESUMEN
T-cell lymphoblastic lymphoma (T-LBL) is a highly aggressive form of lymphoma with poor clinical outcomes and lacks of a standard treatment regimen. In this study, we assessed the safety and efficacy of tandem autologous hematopoietic stem cell transplantation (auto-HSCT) strategy for adult T-LBL and evaluated prognostic factors affecting survival. 181 Newly-diagnosed adult T-LBL patients were enrolled, 89 patients were treated with chemotherapy alone, 46 patients were allocated to single auto-HSCT group, 46 patients were treated with tandem auto-HSCT. The median follow-up time was 37 months, the 3-year progression/relapse rate of the tandem auto-HSCT group was significantly lower than that of the single auto-HSCT group and chemotherapy group (26.5% vs 53.1% and 54.8%). The 3-year PFS and OS rate of the tandem auto-HSCT group (73.5% and 76.3%) were significantly higher than those of the single auto-HSCT group (46.9% and 58.3%) and the chemotherapy group (45.1% and 57.1%). In the tandem auto-HSCT group, age and disease status after the first transplantation impacted the OS and PFS. Multivariate analysis identified that disease status after the first transplantation was the only independent prognostic factor for patients treated with tandem-HSCT. In addition, diagnostic models of the initial CD8+CD28+/CD8+CD28- T cell ratio in predicting the disease status were found to be significant. Taken together, tandem auto-HSCT can be considered an optimal strategy for adult T-LBL patients (ChiCTR-ONN-16008480).
Asunto(s)
Trasplante de Células Madre Hematopoyéticas , Recurrencia Local de Neoplasia , Adulto , China/epidemiología , Supervivencia sin Enfermedad , Humanos , Estudios Prospectivos , Estudios Retrospectivos , Linfocitos T , Trasplante Autólogo , Resultado del TratamientoRESUMEN
BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.
Asunto(s)
Transfusión Sanguínea , ADN Viral/sangre , Herpesvirus Humano 6/genética , Herpesvirus Humano 7/genética , Herpesvirus Humano 8/genética , Reacción en Cadena de la Polimerasa Multiplex/métodos , ADN Viral/genética , Femenino , Herpesvirus Humano 6/aislamiento & purificación , Herpesvirus Humano 7/aislamiento & purificación , Herpesvirus Humano 8/aislamiento & purificación , Humanos , Masculino , Reacción en Cadena de la Polimerasa Multiplex/normas , Estudios Prospectivos , Reproducibilidad de los Resultados , Sensibilidad y Especificidad , Carga Viral/métodos , Carga Viral/normasRESUMEN
Xylan-based films have great potential to replace petroleum-based polymers used for packaging and coatings due to their excellent biocompatibility, biodegradability, and good gas barrier properties. However, fabricating a xylan-based film with flexible, transparent, water-proof, and excellent mechanical properties is an enormous challenge. Herein, we manufactured a series of degradable films with adjustable properties via solution-casting using a water-soluble xylan derivative. This is the first report of a pure xylan-based film with high performance, requiring no additives. The tensile strength of the xylan-based film could be controlled by adjusting the aldehyde content, which varied from 105.0 to 132.6 MPa. The smallest initial water contact angle of the xylan-based films is 93.26°, indicating that these films are hydrophobic. This work shows a simple and viable route toward manufacturing xylan-based films with high tensile strength, flexibility, and transparency, which can be used for packaging materials and coatings.
Asunto(s)
Polímeros , Xilanos , Interacciones Hidrofóbicas e Hidrofílicas , Resistencia a la Tracción , AguaRESUMEN
BACKGROUND & AIMS: The presence of multifocal tumors, developed either from intrahepatic metastasis (IM) or multicentric occurrence (MO), is a distinct feature of hepatocellular carcinoma (HCC). Immunogenomic characterization of multifocal HCC is important for understanding immune escape in different lesions and developing immunotherapy. METHODS: We combined whole-exome/transcriptome sequencing, multiplex immunostaining, immunopeptidomes, T cell receptor (TCR) sequencing and bioinformatic analyses of 47 tumors from 15 patients with HCC and multifocal lesions. RESULTS: IM and MO demonstrated distinct clonal architecture, mutational spectrum and genetic susceptibility. The immune microenvironment also displayed spatiotemporal heterogeneity, such as less T cell and more M2 macrophage infiltration in IM and higher expression of inhibitory immune checkpoints in MO. Similar to mutational profiles, shared neoantigens and TCR repertoires among tumors from the same patients were abundant in IM but scarce in MO. Combining neoantigen prediction and immunopeptidomes identified T cell-specific neoepitopes and achieved a high verification rate in vitro. Immunoediting mainly occurred in MO but not IM, due to the relatively low immune infiltration. Loss of heterozygosity of human leukocyte antigen (HLA) alleles, identified in 17% of multifocal HCC, hampered the ability of major histocompatibility complex to present neoantigens, especially in IM. An integrated analysis of Immunoscore, immunoediting, TCR clonality and HLA loss of heterozygosity in each tumor could stratify patients into 2 groups based on whether they have a high or low risk of recurrence (p = 0.038). CONCLUSION: Our study comprehensively characterized the genetic structure, neoepitope landscape, T cell profile and immunoediting status that collectively shape tumor evolution and could be used to optimize personalized immunotherapies for multifocal HCC. LAY SUMMARY: Immunogenomic features of multifocal hepatocellular carcinoma (HCC) are important for understanding immune-escape mechanisms and developing more effective immunotherapy. Herein, comprehensive immunogenomic characterization showed that diverse genomic structures within multifocal HCC would leave footprints on the immune landscape. Only a few tumors were under the control of immunosurveillance, while others evaded the immune system through multiple mechanisms that led to poor prognosis. Our study revealed heterogeneous immunogenomic landscapes and immune-constrained tumor evolution, the understanding of which could be used to optimize personalized immunotherapies for multifocal HCC.
Asunto(s)
Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/inmunología , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/inmunología , Neoplasias Primarias Múltiples/genética , Neoplasias Primarias Múltiples/inmunología , Escape del Tumor , Adulto , Anciano , Anciano de 80 o más Años , Antígenos de Neoplasias/genética , Biomarcadores de Tumor/genética , Linfocitos T CD8-positivos/inmunología , Femenino , Predisposición Genética a la Enfermedad , Antígenos HLA/genética , Humanos , Linfocitos Infiltrantes de Tumor/inmunología , Masculino , Persona de Mediana Edad , Mutación , Recurrencia Local de Neoplasia , Receptores de Antígenos de Linfocitos T/genética , Transcriptoma , Secuenciación del ExomaRESUMEN
Given the highly heterogeneity of diffuse large B cell lymphoma (DLBCL) and the diverse demands for proper treatment, many patients would relapse or show resistance to current therapeutic regimens, new treatment options are urgent to be explored. Curcumin harbored anti-tumor potential in various cancers, here, we investigated the possible effects and mechanism of curcumin on human DLBCL in vitro and in vivo, we found that curcumin inhibited cell viability in a concentration and time dependent manner, promoted cell apoptosis and arrested cell cycle at G2 phase, and these effects were mediated by PPARγ promotion and Akt/mTOR pathway inactivation. Furthermore, effects of curcumin on human DLBCL cells could be partly rescued by PPARγ antagonist GW9662, and enhanced by PPARγ agonist rosiglitazone. Taken together, our results demonstrated that curcumin inhibited the proliferation of DLBCL cells by up-regulating the expression of PPARγ, and our results might provide novel therapeutic approaches and a potential target to DLBCL treatment.
Asunto(s)
Antineoplásicos/metabolismo , Curcumina/metabolismo , Linfoma de Células B Grandes Difuso/tratamiento farmacológico , PPAR gamma/metabolismo , Anilidas/metabolismo , Animales , Apoptosis , Puntos de Control del Ciclo Celular , Línea Celular Tumoral , Proliferación Celular , Regulación Neoplásica de la Expresión Génica/efectos de los fármacos , Humanos , Ratones SCID , Neoplasias Experimentales , Proteínas Proto-Oncogénicas c-akt/metabolismo , Rosiglitazona/metabolismo , Transducción de Señal , Serina-Treonina Quinasas TOR/metabolismoRESUMEN
Mutations in the retinitis pigmentosa GTPase regulator (RPGR) gene, are the major cause of X-linked retinitis pigmentosa (RP), in which exon open reading frame 15 (ORF15) of RPGR has been implicated to play a substantial role. We identified a novel hemizygous missense mutation E585K of RPGR from whole-exome sequencing of RP. RNA-Seq analysis and functional study were conducted to investigate the underlying pathogenic mechanism of the mutation. Our results showed that the mutation actually affected RPGR ORF15 splicing. RNA-Seq analysis of the human retina followed by validation in cells revealed a complex splicing pattern near the 3' boundary of RPGR exon 14 in the ORF15 region, resulting from a variety of alternative splicing events (ASEs). The wildtype RPGR mini-gene expressed in human 293T cells confirmed these ASEs in vitro. In contrast, without new RNA species detected, the mutant mini-gene disrupted the splicing pattern of the ORF15 region, and caused loss of RPGR transcript heterogeneity. The RNA species derived from the mutant mini-gene were predominated by a minor out-of-frame transcript that was also observed in wildtype RPGR, resulting from an upstream alternative 5' splice site in exon 14. Our findings therefore provide insights into the influence of RPGR exonic mutations on alternative splicing of the ORF15 region, and the underlying molecular mechanism of RP.
Asunto(s)
Proteínas del Ojo/genética , Mutación Missense/genética , Sistemas de Lectura Abierta/genética , Retinitis Pigmentosa/genética , Secuencia de Aminoácidos , Secuencia de Bases , Línea Celular , Proteínas del Ojo/química , Hemicigoto , Humanos , Masculino , Empalme del ARN/genética , ARN Mensajero/genética , ARN Mensajero/metabolismoRESUMEN
OBJECTIVE: To increase the in vivo stability of bioactive proteins via optimized loading methods. RESULTS: ß-Glucosidase (ß-Glu), as a model protein, was immobilized on magnetic nanoparticles(denoted as MNP-ß-Glu) by chemical coupling methods and was further modified by poly(ethylene glycol) (PEG) molecules (denoted as MNP-ß-Glu-PEG) to increase its stability. The physicochemical properties of the as-prepared nanohybrids, including the particle size, zeta potential, and enzyme activity, were well characterized. The proper MNP/ß-Glu feed ratio was important for optimizing the particle size. Analysis of enzyme activity showed that the stability of immobilized ß-Glu compared with free ß-Glu was lower in deionized water and higher in blood serum at 37 °C. MNP-ß-Glu-PEG retained 77.9% of the initial activity within 30 days at 4 °C, whereas the free enzyme retained only 58.2%. Pharmacokinetic studies of Sprague-Dawley (SD) rats showed that the MNP-ß-Glu-PEG group retained a higher enzyme activity in vivo (41.46% after 50 min) than the MNP-ß-Glu group (0.03% after 50 min) and the ß-Glu group (0.37% after 50 min). Moreover, in contrast to the MNP-ß-Glu group, the enzyme activity was not fully synchronous with the decrease in the Fe concentration in the MNP-ß-Glu-PEG group. CONCLUSIONS: All findings indicated that the method of immobilization on magnetic nanoparticles and PEG modification is promising for the application of bioactive proteins in vivo.
Asunto(s)
Enzimas Inmovilizadas , Nanopartículas de Magnetita/química , Polietilenglicoles/química , Animales , Estabilidad de Enzimas , Enzimas Inmovilizadas/química , Enzimas Inmovilizadas/metabolismo , Enzimas Inmovilizadas/farmacocinética , Tamaño de la Partícula , Ratas , Ratas Sprague-Dawley , beta-Glucosidasa/química , beta-Glucosidasa/metabolismo , beta-Glucosidasa/farmacocinéticaRESUMEN
Dry eye syndrome (DES) is a growing public health concern with a high global prevalence; however, the fundamental processes involved in its pathogenic mechanisms remain poorly understood. In the present study, we applied nanoscale liquid chromatography and quadrupole time-of-flight tandem mass spectrometry (nanoLC/Q-TOF-MS/MS) and ultraperformance LC/Q-TOF-MS/MS technologies on tear samples obtained from 18 dry eye patients and 19 healthy controls for integrated proteomic and metabolomic analyses. Overall, 1031 tear proteins were detected, while 190 proteins were determined to be significantly expressed in dry eye patients. Further functional analysis suggested that various biological processes were highly expressed and involved in the pathogenesis of DES, especially immune and inflammatory processes. In total, 156 named metabolites were identified, among which 34 were found to be significantly changed in dry eye patients. The results highlighted the key elements, especially inflammatory-related proteins and metabolites that played important roles in the development of DES. Further, the regulatory roles of primary pathways, including complement and coagulation cascades, glycolysis/gluconeogenesis, and amino acid metabolism, were also identified as processes involved in DES. Collectively, our work not only provided insight into the potential biomarkers of DES for diagnostic and prognostic purposes but extended our knowledge of the physiopathology of this syndrome.
Asunto(s)
Proteínas del Sistema Complemento/genética , Síndromes de Ojo Seco/genética , Proteínas del Ojo/genética , Metaboloma , Proteoma/genética , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Aminoácidos/metabolismo , Estudios de Casos y Controles , Cromatografía Liquida , Proteínas del Sistema Complemento/clasificación , Proteínas del Sistema Complemento/metabolismo , Síndromes de Ojo Seco/metabolismo , Síndromes de Ojo Seco/fisiopatología , Proteínas del Ojo/clasificación , Proteínas del Ojo/metabolismo , Femenino , Regulación de la Expresión Génica , Redes Reguladoras de Genes , Gluconeogénesis/genética , Glucólisis/genética , Humanos , Masculino , Persona de Mediana Edad , Mapeo de Interacción de Proteínas , Proteoma/clasificación , Proteoma/metabolismo , Espectrometría de Masa por Láser de Matriz Asistida de Ionización Desorción , Lágrimas/químicaRESUMEN
BACKGROUND: Excess energy intake contributes to metabolic disorders. However, the relationship between excess sugar and fat in their contributions to metabolic abnormalities remains to be further elucidated. Here we conducted a prospective feeding experiment to evaluate effects of dietary fat-to-sugar ratio on diet-induced metabolic abnormalities in adult cynomolgus monkeys. METHODS: Four groups of adult cynomolgus monkeys were fed regular chow plus emulsion with combinations of high sugar (HS) or low sugar (HS) and low fat (LF) or high fat (HF) for 7 months. Plasma levels of total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), triglyceride (TG) and blood glucose were measured for all the four groups of animals during the experiment. RESULTS: Plasma levels of TC and LDL-C gradually increased in all 4 diets groups, with the highest increase found in the LSHF group compared to the other three groups (P = 0.0018 and P = 0.0005 respectively). HF induced increased fasting glucose (P = 0.0077) and HS induced higher TG (P = 0.0227) respectively. Intriguingly, HSHF led to dramatically smaller magnitude of increase in LDL-C and TC levels compared to LSHF, while such difference was absent between the LSLF and LSHF groups. Our findings thus indicate interactive effects of HS and HF on TC and LDL-C. In addition, HF exhibited stronger effects on lipid abnormalities than HS. CONCLUSIONS: In the current study, our prospective feeding experiment in adult cynomolgus monkeys revealed effects of different fat-to-sugar ratios on diet-induced metabolic abnormalities. Furthermore, our findings suggest that not only excess dietary energy but also the balance of dietary fat-to-sugar ratio matters in diet-induced lipid abnormalities.
Asunto(s)
Carbohidratos de la Dieta , Grasas de la Dieta , Azúcares , Animales , Femenino , Masculino , Administración Oral , Glucemia/metabolismo , HDL-Colesterol/sangre , LDL-Colesterol/sangre , Carbohidratos de la Dieta/administración & dosificación , Grasas de la Dieta/administración & dosificación , Macaca fascicularis , Estudios Prospectivos , Azúcares/administración & dosificación , Triglicéridos/sangreRESUMEN
Epithelial-mesenchymal transition (EMT) plays a critical role in initiating tumor invasion and metastasis of colorectal cancer (CRC), although the underlying mechanisms remain to be clarified. Herein, we demonstrate that the active form of Rac family small GTPase 1 (RAC1-GTP) is overexpressed in CRCs and promotes the EMT-mediated invasion of CRC cells through activation of the signal transducers and activators of transcription 3 (STAT3) pathway. Increased expression of RAC1-GTP in CRC tissues was positively correlated with the TNM stages of CRCs and indicated poor prognosis of CRC patients. Targeting RAC1-GTP activity by its specific inhibitor NSC23766 markedly suppressed the migration and invasion of CRC cells. Mechanistically, RAC1-GTP directly interacted with STAT3 to promote STAT3 phosphorylation, thus promoted EMT of CRC cells. Enforced expression of constitutively activated STAT3 (STAT3-C) abrogated the suppressive effect of RAC1-GTP disruption on the migration and invasion of CRC cells. Importantly, NSC23766 disrupted EMT in CRC cells and significantly diminished growth of CRC xenografts. Taken together, our data indicate that RAC1-GTP is an important player in EMT-mediated tumor invasion and a potential therapeutic target for CRCs.