Short term response of plankton community to nutrient enrichment in central eastern Arabian Sea: Elucidation through mesocosm experiments.

Oligotrophic waters (OW), generally favour longer food chain facilitated by the microbial loop. In such ecosystems, physical mixing (e.g. upwelling, and winter convection) inject nutrients and propagules from subsurface to the photic zone. Such events are expected to alter the food chain through shifts in the plankton community. Mesocosm experiments were carried out to evaluate the influence of nutrient enrichment from the deep (100-150 m) on the surface plankton community for the first time in the Arabian Sea, through custom-designed enclosures in OW of the central-eastern Arabian Sea (CEAS). Surface water was characterized by low nutrients and phytoplankton biomass (chlorophyll-a of <0.2 µg m-3) and upon nutrient enrichment yielded differing response. Higher abundance of picophytoplankton, bacteria and protists was noticed at a depth of ~100 m than at surface. The inoculation of such a population to the surface, resulted in a significant enhancement of autotrophic (picophytoplankton) and heterotrophic (bacteria and protists) populations. However, significant changes in the abundance of larger plankton was not evident till three days of incubation. Even though autotrophic picophytoplankton responded positively, a distinct increase in chlorophyll-a was not evident. This study points out that the lack of sufficient viable microphytoplankton propagules, neither at the surface nor at the depth (inoculum) are the possible reasons for the lack of their distinct positive response. These experiments suggest the dominance of microbial community response to physical mixing in the OW regions of the Arabian Sea and the importance of propagule diversity. The insights from this experiment will serve as a precursor for appropriate modifications in ocean modelling and forecasting studies and help in building global environmental management tools.

A nomogram for predicting the risk of neck node metastasis in pathologically node-negative oral cavity carcinoma.

OBJECTIVE: To generate a nomogram for predicting the risk of neck node metastasis in pathologically node-negative patients using a combination of variables comprising of protein expression, ultrastructural alterations and clinicopathological parameters. MATERIALS AND METHODS: Surgically removed oral tumours (n = 103) were analysed for the expression of desmosomal and hemidesmosomal assembly proteins by immunohistochemistry and ultrastructural alterations by transmission electron microscopy (TEM). Protein expression, ultrastructural alterations and clinicopathological variables were used to construct nomogram from the training set in 75 patients. Clinical utility of the nomogram was validated in a discrete set of 28 patients. RESULTS: Univariate and multivariate analyses were performed on the training set, and obtained significant variables comprising of integrin ß4 expression (p = .027), number of hemidesmosomes (p = .027)/desmosomes (p = .046), tumour differentiation grade (p = .033) and tumour thickness (p = .024) were used for construction of the nomogram. The area under the curve was calculated for both training 0.821 (95% CI 0.725-0.918) and validation sets 0.880 (95% CI 0.743-1.000). The nomogram demonstrated a predictive accuracy of 73.3% and 78.6% with the sensitivity of 81.4% and 83.3% in the training and validation sets, respectively. CONCLUSIONS: The nomogram constructed on postsurgical tumour samples will be a value addition to histopathology for the detection of neck node metastasis in pathologically node-negative patients.

Assessment of heavy metal contamination of road dusts from industrial areas of Hyderabad, India.

Road dust in industrial areas carries high levels of toxic heavy metals. Exposure to such polluted dust significantly affects the health of people residing in these areas, which is of major concern. The present study was taken up with an aim to highlight the magnitude and potential sources of accumulation of heavy metals in 32 road dust samples collected from six industrial areas of Hyderabad. Acid-digested sample solutions were analyzed by ICP-MS for Cu, Zn, Cr, Co, Pb, Ni, V, Zr, Ce, Y, and Hf. The road dusts exhibit significantly high mean metal levels which are much above their crustal abundances. The relative ordering of mean metal contents is Zr > Zn > Pb > Cr > Ce > Cu > V > Ni > Y > Co > Hf. Elevated pollution indices (I geo, EF, C (i) f, and C deg) reveal that the road dusts are pollution impacted showing varying degree of heavy metal contamination. Strong positive correlations exhibited by metal pairs Cu-Zn, Cr-Ni, Ce-V, Y-Ce, and Hf-Zr imply their origin from common anthropogenic sources. Principal component analysis grouped the metals according to the sources which contributed to their accumulation. The present study confirms to an intensive anthropogenic impact on the accumulation of heavy metals in the studied road dusts attributable mainly to strong influences of vehicular and industrial activity and partly to domestic and natural processes. The results obtained imply the need for further investigations to assess their ecological implications and human health risks.

Molecular phylogenetic profiling of gut-associated bacteria in larvae and adults of flesh flies.

Flesh flies of the genus Sarcophaga (Diptera: Sarcophagidae) are carrion-breeding, necrophagous insects important in medical and veterinary entomology as potential transmitters of pathogens to humans and animals. Our aim was to analyse the diversity of gut-associated bacteria in wild-caught larvae and adult flesh flies using culture-dependent and culture-independent methods. Analysis of 16S rRNA gene sequences from cultured isolates and clone libraries revealed bacteria affiliated to Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes in the guts of larval and adult flesh flies. Bacteria cultured from larval and adult flesh fly guts belonged to the genera Acinetobacter, Bacillus, Budvicia, Citrobacter, Dermacoccus, Enterococcus, Ignatzschineria, Lysinibacillus, Myroides, Pasteurella, Proteus, Providencia and Staphylococcus. Phylogenetic analysis showed clone sequences of the genera Aeromonas, Bacillus, Bradyrhizobium, Citrobacter, Clostridium, Corynebacterium, Ignatzschineria, Klebsiella, Pantoea, Propionibacterium, Proteus, Providencia, Serratia, Sporosarcina, Weissella and Wohlfahrtiimonas. Species of clinically significant genera such as Ignatzschineria and Wohlfahrtiimonas spp. were detected in both larvae and adult flesh flies. Sequence analysis of 16S rRNA gene libraries supported culture-based results and revealed the presence of additional bacterial taxa. This study determined the diversity of gut microbiota in flesh flies, which will bolster the ability to assess microbiological risk associated with the presence of these flies. The present data thereby establish a platform for a much larger study.

Clinical significance of aberrant vimentin expression in oral premalignant lesions and carcinomas.

OBJECTIVE: To investigate the clinical significance of vimentin expression at early and late events of tobacco/areca nut-associated oral tumorigenesis. MATERIALS AND METHODS: Immunohistochemistry (IHC) was carried out on paraffin-embedded tissues of oral mucosa normal (n = 10), inflammatory lesions (n = 19), leukoplakia (n = 52), submucous fibrosis (n = 71) and tumours/cut margins (n = 227 each), using anti-vimentin antibody, and the expression profile was correlated with patients' clinical parameters. Immunofluorescence, Western blot and RT-PCR analysis were also carried out wherever adequate and fresh tissues were available. RESULTS: Aberrant vimentin expression was seen in hyperplastic, dysplastic and fibrotic tissues, which showed statistically significant correlation with the histopathological grade of dysplasia (P = 0.001) and fibrosis (P = 0.009). Vimentin expression also showed statistically significant correlation with tumour size (P = 0.048), clinical stage (P = 0.013), regional lymph node metastases (P = 0.001), local recurrence (P = 0.001) and survival (P = 0.021) of patients with oral squamous cell carcinoma (OSCC). Its expression in invasive fronts statistically correlated with development of nodal metastasis and local recurrence. CONCLUSIONS: Our results suggest possible role of vimentin in early events of tobacco/areca nut-associated oral tumorigenesis, which may prove useful to predict the malignant potential of high-risk oral lesions. Further, association between vimentin expression in invasive fronts and aggressive phenotype of tumours may help clinicians to choose the appropriate treatment modality for OSCC management.

Impact of consultant-led care in early pregnancy unit.

Early pregnancy complication remains a significant cause of maternal morbidity and mortality. Despite the paucity of evidence to support consultant-led early pregnancy unit over nurse- or sonographer-led services, hospitals have devoted scarce resources to appoint consultants to lead their early pregnancy units. We compared the management and outcomes of confirmed and suspected ectopic pregnancy 1 year before and one year after the transition from a nurse-led to a consultant-led early pregnancy unit in a London hospital. Our study showed improvements in the rates of negative laparoscopy, ruptured ectopic pregnancy during follow-up, need for laparotomy, ITU admission and length of stay and statistically significant reduction in operative intervention, without concomitant rise in morbidity or mortality in women with confirmed or suspected ectopic pregnancies.

Comparing ensemble methods combined with different aggregating models using micrograph cell segmentation as an initial application example.

Strategies such as ensemble learning and averaging techniques try to reduce the variance of single deep neural networks. The focus of this study is on ensemble averaging techniques, fusing the results of differently initialized and trained networks. Thereby, using micrograph cell segmentation as an application example, various ensembles have been initialized and formed during network training, whereby the following methods have been applied: (a) random seeds, (b) L 1-norm pruning, (c) variable numbers of training examples, and (d) a combination of the latter 2 items. Furthermore, different averaging methods are in common use and were evaluated in this study. As averaging methods, the mean, the median, and the location parameter of an alpha-stable distribution, fit to the histograms of class membership probabilities (CMPs), as well as a majority vote of the members of an ensemble were considered. The performance of these methods is demonstrated and evaluated on a micrograph cell segmentation use case, employing a common state-of-the art deep convolutional neural network (DCNN) architecture exploiting the principle of the common VGG-architecture. The study demonstrates that for this data set, the choice of the ensemble averaging method only has a marginal influence on the evaluation metrics (accuracy and Dice coefficient) used to measure the segmentation performance. Nevertheless, for practical applications, a simple and fast estimate of the mean of the distribution is highly competitive with respect to the most sophisticated representation of the CMP distributions by an alpha-stable distribution, and hence seems the most proper ensemble averaging method to be used for this application.

First Report of Grapevine leafroll-associated virus 1 Infecting Grapevines in India.

Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.

Evaluation of Fermentation Efficiency of Yeast Strains and their Effect on Quality of Young Wines.

The yeast has important role in fermentation of wine grapes and wine quality. The fermentation of wine grapes affect by efficiency of particular yeast strain, sugar content, pH, available temperature, etc. To evaluate the efficiency of yeast strains (Premier Cuvee, RS-1, RS-2, RS-3 and natural), present study was conducted on two wine grape varieties viz.; Sauvignon Blanc (White) and Cabernet Sauvignon (Red). Efficiency of yeast strains was evaluated in terms of conversion rate of sugar into alcohol. As per recorded data, strain RS-3 (Pichia kudriavzevii) was found more efficient than other strains in fermentation of Cabernet Sauvignon with efficiency of 84.4 per cent but in case of Sauvignon Blanc, the commercial culture Premier Cuevee was found superior over RS-3. The quality parameters of young wines of both the varieties were also affected by the used strains. Considering the efficiency and impact on various parameters of wines, local strain, i.e., RS-3 was found at par with commercial culture (Premier Cuvee). The RS-3 strain has potential to produce quality wines. However, studies on effects of RS-3 strain on some specific quality parameters of wines like varietal aroma compounds, flavours etc. are needed.

Number of necessary training examples for Neural Networks with different number of trainable parameters.

In this work, the network complexity should be reduced with a concomitant reduction in the number of necessary training examples. The focus thus was on the dependence of proper evaluation metrics on the number of adjustable parameters of the considered deep neural network. The used data set encompassed Hematoxylin and Eosin (H&E) colored cell images provided by various clinics. We used a deep convolutional neural network to get the relation between a model's complexity, its concomitant set of parameters, and the size of the training sample necessary to achieve a certain classification accuracy. The complexity of the deep neural networks was reduced by pruning a certain amount of filters in the network. As expected, the unpruned neural network showed best performance. The network with the highest number of trainable parameter achieved, within the estimated standard error of the optimized cross-entropy loss, best results up to 30% pruning. Strongly pruned networks are highly viable and the classification accuracy declines quickly with decreasing number of training patterns. However, up to a pruning ratio of 40%, we found a comparable performance of pruned and unpruned deep convolutional neural networks (DCNN) and densely connected convolutional networks (DCCN).

Mumbai harbour, India: gateway for introduction of marine organisms.

Ships have been identified as one of the important vectors in the translocation of organisms from one bioregion to another leading to bioinvasion. In this context, harbours serve as a gateway for the introduction of alien species. Surveys were carried out in the vicinity of ports of Mumbai for macrobenthic fauna, zooplankton and hard substratum community on three different occasions during 2001-2002. The study shows that 14 polychaete species are recently introduced to this area. Mytilopsis sallei, a bivalve, which is an invasive species in the Indian context continued to be present but was restricted to enclosed docks, indicating preference for embayed water bodies. The polychaete Protula tubularia was abundant in the hard substratum community and is being reported as a possible ship-mediated introduction.

Characterization and electrochemical studies of Mn(II), Co(II), Ni(II) and Cu(II) complexes with 2-mercapto-3-substituted-quinazolin-4-one and 1,10-phenanthroline or ethylenediamine as ligands.

Some mixed ligand complexes of the type [M(L(1) or L(2))(phen or en)(H(2)O)Cl], where M=Mn(II), Co(II), Ni(II) and Cu(II); HL(1)=2-mercapto-quinazolin-4-one; HL(2)=2-mercapto-3-phenyl-quinazolin-4-one; phen=1,10-phenanthroline; en=ethylenediamine have been prepared. All complexes were characterized on the basis of elemental analysis, molar conductance, magnetic susceptibility measurements, IR, UV-vis, ESR and powder X-ray diffraction studies. IR spectra of these complexes reveal that the complex formation occurred through both nitrogen and sulphur atoms. On the basis of electronic spectral data and magnetic susceptibility measurement octahedral geometry has been proposed for the complexes. The ESR spectral data of the Cu(II) complexes showed that the metal-ligand bonds have considerable covalent character. X-ray diffraction studies of Cu(II) complexes are used to elucidate the crystal structure. The electrochemical behaviour of mixed ligand Ni(II) complexes was studied which showed that complexes of phen appear at more positive potential as compared to those for corresponding en complexes.

Cross-referral between voluntary HIV counselling and testing centres and TB services, Maharashtra, India, 2003-2004.

SETTING: India has a high tuberculosis (TB) burden, with 1.8 million new cases per year. Although an estimated 2.5 million people are infected with human immunodeficiency virus (HIV), the national HIV prevalence is <1%. India's size and diverse TB-HIV epidemiology pose a major challenge to the implementation of links between TB and HIV/AIDS programme services. METHODS: A pilot cross-referral initiative was instituted between voluntary counselling and testing centres (VCT) and the diagnostic and treatment facilities of the Revised National TB Control Programme (RNTCP) in four districts of Maharashtra, India. OBJECTIVE: To detect TB disease among VCT patients and selectively screen TB patients for referral to VCT services. RESULTS: Between July 2003 and June 2004, 336 (3%) of 9921 VCT patients were identified as TB suspects and 83 (29%) were diagnosed with TB disease. Of the 765 selectively referred TB cases, 181 (24%) were found to be HIV-positive, representing 11% of the newly detected persons living with HIV in the four districts. CONCLUSIONS: The pilot cross-referral initiative yielded significant numbers of active TB cases among VCT patients and HIV-positive persons among TB patients. Collaborative activities between HIV/AIDS and TB programmes need to be rapidly scaled up to other states in India.

Atm inactivation results in aberrant telomere clustering during meiotic prophase.

A-T (ataxia telangiectasia) individuals frequently display gonadal atrophy, and Atm-/- mice show spermatogenic failure due to arrest at prophase of meiosis I. Chromosomal movements take place during meiotic prophase, with telomeres congregating on the nuclear envelope to transiently form a cluster during the leptotene/zygotene transition (bouquet arrangement). Since the ATM protein has been implicated in telomere metabolism of somatic cells, we have set out to investigate the effects of Atm inactivation on meiotic telomere behavior. Fluorescent in situ hybridization and synaptonemal complex (SC) immunostaining of structurally preserved spermatocytes I revealed that telomere clustering occurs aberrantly in Atm-/- mice. Numerous spermatocytes of Atm-/- mice displayed locally accumulated telomeres with stretches of SC near the clustered chromosome ends. This contrasted with spermatogenesis of normal mice, where only a few leptotene/zygotene spermatocytes I with clustered telomeres were detected. Pachytene nuclei, which were much more abundant in normal mice, displayed telomeres scattered over the nuclear periphery. It appears that the timing and occurrence of chromosome polarization is altered in Atm-/- mice. When we examined telomere-nuclear matrix interactions in spermatocytes I, a significant difference was observed in the ratio of soluble versus matrix-associated telomeric DNA sequences between meiocytes of Atm-/- and control mice. We propose that the severe disruption of spermatogenesis during early prophase I in the absence of functional Atm may be partly due to altered interactions of telomeres with the nuclear matrix and distorted meiotic telomere clustering.

Gyrineum natator: a potential indicator of imposex along the Indian coast.

Imposex related studies have used neogastropods as sentinel organism. In this effort, we elucidate the potential of a mesogastropod, Gyrineum natator, for imposex monitoring on the central west coast of India. Observations were made with specimens collected from Mumbai (three stations), Ratnagiri (two stations), Goa (one station) and Mangalore (one station). The analyzed populations at all four sites were affected by imposex. The six different stages of imposex in this organism are illustrated through schematic and scanning electron micrographs. In view of the anticipated ban on TBT based antifouling paints this baseline information can serve as an indicator for environmental monitoring in this region.

"Spiral-Cap" ileocystoplasty for bladder augmentation and ureteric reimplant.

OBJECTIVE: To demonstrate the new technique of Spiral-cap ileocystoplasty for bladder augmentation and simultaneous ureteric reimplant. MATERIALS AND METHODS: Seven patients with small capacity bladder and simultaneous lower ureteric involvement operated in single tertiary care institute over the last 5 years were included in this study. Spiral-cap ileocystoplasty was used in all the patients for bladder augmentation. Proximal part of the same ileal loop was used in isoperistaltic manner for ureteric reimplantation. Distal end of this ileal loop was intussuscepted into the pouch to decrease the incidence of reflux. Detubularized distal portion of the loop was reconfigured in spiral manner to augment the native bladder. Patients were analyzed for upper tract changes, serum creatinine, bladder capacity, and requirement of clean intermittent self-catheterization in follow-up over 5 years. RESULTS: There was no evidence of any urinary or bowel leak in the postoperative period. Recovery was equivalent with those treated with other methods of bladder augmentation. Follow-up ultrasonography showed good capacity bladder. Upper tracts were well preserved in follow-up. Urinary bladder and lower ureter pathologies were addressed simultaneously. CONCLUSION: Spiral-cap ileocystoplasty is a useful technique in patients who require simultaneous bladder augmentation and ureteric reimplant.

Differential expression of miRNAs in pancreatobiliary type of periampullary adenocarcinoma and its associated stroma.

Periampullary adenocarcinomas can be of two histological subtypes, intestinal or pancreatobiliary. The latter is more frequent and aggressive, and characterized by a prominent desmoplastic stroma, which is tightly related to the biology of the cancer, including its poor response to chemotherapy. Whereas miRNAs are known to regulate various cellular processes and interactions between cells, their exact role in periampullary carcinoma remains to be characterized, especially with respect to the prominent stromal component of pancreatobiliary type cancers. The present study aimed at elucidating this role by miRNA expression profiling of the carcinomatous and stromal component in twenty periampullary adenocarcinomas of pancreatobiliary type. miRNA expression profiles were compared between carcinoma cells, stromal cells and normal tissue samples. A total of 43 miRNAs were found to be differentially expressed between carcinoma and stroma of which 11 belong to three miRNA families (miR-17, miR-15 and miR-515). The levels of expression of miRNAs miR-17, miR-20a, miR-20b, miR-223, miR-10b, miR-2964a and miR-342 were observed to be higher and miR-519e to be lower in the stromal component compared to the carcinomatous and normal components. They follow a trend where expression in stroma is highest followed by carcinoma and then normal tissue. Pathway analysis revealed that pathways regulating tumor-stroma interactions such as ECM interaction remodeling, epithelial-mesenchymal transition, focal adhesion pathway, TGF-beta, MAPK signaling, axon guidance and endocytosis were differently regulated. The miRNA-mRNA mediated interactions between carcinoma and stromal cells add new knowledge regarding tumor-stroma interactions.

Influence of ATM function on telomere metabolism.

The ATM gene product, which is defective in the cancer-prone disorder ataxia telangiectasia, has been implicated in mitogenic signal transduction, chromosome condensation, meiotic recombination and cell cycle control. The ATM gene has homology with the TEL1 gene of yeast, mutations of which lead to shortened telomeres. To test the hypothesis that the ATM gene product is involved in telomere metabolism, we examined telomeric associations (TA), telomere length, and telomerase activity in human cells expressing either dominant-negative or complementing fragments of the ATM gene. The phenotype of RKO colorectal tumor cells expressing ATM fragments containing a leucine zipper (LZ) motif mimics that of ataxia telangiectasia (A-T) cells. These transfected RKO cells relative to transfected controls had a higher frequency of cells with TA and shortened telomeres, but no detectable change in telomerase activity. In addition, the percentage of cells with TA after gamma irradiation was higher in the transfected RKO cells with dominant negative activity of the ATM gene, compared to control cells. SV40 transformed fibroblasts derived from an A-T patient and transfected with a complementing carboxyl terminal kinase region of the ATM gene had a reduced frequency of cells with TA, with no effect on the telomere length or telomerase activity. The present studies using isogenic cells with manipulated ATM function demonstrate a role for the ATM gene product in telomere metabolism.

Molecular cloning and chromosomal localization of Chinese hamster telomeric protein chTRF1. Its potential role in chromosomal instability.

Chinese hamster cells frequently have altered karyotypes. To investigate the basis of recent observations that karyotypic alterations are related to telomeric fusions, we asked whether these alterations are due to lack of telomere repeat binding factor/s. Further, Chinese hamster chromosomes contain large blocks of interstitial telomeric repeats, which are preferentially involved in chromosome breakage and exchange, rendering it an interesting model for such studies. Here, we report on the cloning and the chromosomal localization of the Chinese hamster telomere repeat binding factor, chTRF1. The sequence analysis revealed, similar to human TRF1 (hTRF1), an N-terminal acidic domain, a TRF1 specific DNA binding motif and a C-terminal Myb type domain. Unlike mouse TRF1 (mTRF1), chTRF1 shows 97.5% identity to hTRF1. chTRF1 gene was localized on the long arm of chromosome 5. In vitro translation of chTRF1 resulted in protein product similar in molecular weight to hTRF1. Immunostaining of Chinese hamster ovary cells (CHO) with anti-TRF1 antibody revealed punctate nuclear staining. At metaphase, antibodies failed to detect TRF1 on most of the chromosome ends and the interstitial telomeric repeat bands. These studies suggest that chTRF1 does not bind the interstitial telomeric repeats, and its presence at the metaphase chromosome ends is limited. The later could be a factor contributing to frequent karyotypic alterations observed in Chinese hamster cells.

Functional role for the c-Abl tyrosine kinase in meiosis I.

The c-Abl tyrosine kinase is activated by ionizing radiation and certain other DNA-damaging agents. The DNA-dependent protein kinase (DNA-PK) and the ataxia telangiectasia mutated (ATM) gene product, effectors in the DNA damage response, contribute to the induction of c-Abl activity. The present study demonstrates that c-Abl is expressed in mouse and rat testes, and predominantly in pachytene spermatocytes of meiosis I. The results also demonstrate that c-Abl interacts directly with meiotic chromosomes. In concert with a requirement for c-Abl at the pachytene stage, we show that, in contrast to wild-type mice, testes from Abl-/- mice exhibit defects in spermatogenesis. These findings provide the first demonstration that c-Abl plays a functional role in meiosis.