Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 222
Filtrar
Más filtros

Banco de datos
Tipo del documento
Intervalo de año de publicación
1.
Osteoporos Int ; 30(11): 2289-2297, 2019 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-31384956

RESUMEN

This study investigated the alterations of mineral metabolism in patients with Graves' disease (GD) who achieved euthyroidism. They had higher fibroblast growth factor 23 (FGF23) and phosphorus as compared with healthy subjects. Serum FGF23 was negatively correlated with serum phosphorus. These indicated abnormal mineral metabolism even after 1.6 years of euthyroid status. INTRODUCTION: FGF23 is involved in the mineral homeostasis, especially the regulation of serum phosphorus. Graves' disease (GD) is associated with accelerated bone turnover, hyperphosphatemia, and elevated serum FGF23. Evidence suggested that serum FGF23 decreased after a 3-month treatment of GD. However, it remains unclear whether serum FGF23, serum phosphorus, and other markers of mineral metabolism will be normalized after euthyroid status achieved. METHODS: A total of 62 patients with euthyroid GD and 62 healthy control subjects were enrolled, and the median duration of euthyroid status was 1.6 years. Endocrine profiles including thyroid function test, autoantibodies, serum FGF23, and bone turnover markers were obtained and compared between the two groups. RESULTS: Euthyroid GD patients had significantly higher serum FGF23 and phosphorus, and lower 25-hydroxyvitamin D (25(OH)D) and intact parathyroid hormone (iPTH) levels as compared with the control group. Serum FGF23 was significantly and negatively correlated with phosphorus level after adjusted for age, gender, calcium, iPTH, and 25(OH)D in the euthyroid GD group. CONCLUSION: Serum phosphorus and FGF23 levels remain higher in GD patients even after euthyroid status has been achieved for a median of 1.6 years. Serum FGF23 was negatively correlated with serum phosphorus in euthyroid GD patients. Underlying mechanisms warrant further investigations. TRIAL REGISTRATION: Registration number: NCT01660308 and NCT02620085.


Asunto(s)
Factores de Crecimiento de Fibroblastos/sangre , Enfermedad de Graves/sangre , Minerales/metabolismo , Fósforo/sangre , Adulto , Anciano , Anciano de 80 o más Años , Biomarcadores/sangre , Remodelación Ósea , Huesos/metabolismo , Calcio/sangre , Estudios de Casos y Controles , Femenino , Factor-23 de Crecimiento de Fibroblastos , Humanos , Masculino , Persona de Mediana Edad , Minerales/sangre , Hormona Paratiroidea/sangre , Vitamina D/análogos & derivados , Vitamina D/sangre , Adulto Joven
2.
Br J Neurosurg ; 33(6): 673-674, 2019 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-31502482

RESUMEN

We present a case of the spinal accessory nerve traversing a fenestrated internal jugular vein. Awareness of this variant may be important in neurosurgical procedures that involve upper cervical exposures.


Asunto(s)
Nervio Accesorio/anomalías , Venas Yugulares/anomalías , Nervios Espinales/anomalías , Nervio Accesorio/cirugía , Cadáver , Humanos , Venas Yugulares/cirugía , Nervios Espinales/cirugía
3.
Diabet Med ; 34(11): 1584-1590, 2017 11.
Artículo en Inglés | MEDLINE | ID: mdl-28710779

RESUMEN

AIMS: To compare the incidence of hyperglycaemia among participants with low, elevated and normal serum thyroid-stimulating hormone concentration, as well as the incidence of abnormal thyroid function test results among participants with normal blood glucose and those with hyperglycaemia. METHODS: In a prospective study, a cohort of 72 003 participants with normal, low and elevated serum thyroid-stimulating hormone concentration were followed from the study beginning to the first report of diabetes and prediabetes. A proportional hazards regression model was used to calculate the hazard ratios and 95% CIs for each outcome, adjusting for age, sex, education level, smoking, alcohol consumption and obesity. Analyses for the association between dysglycaemia and incident abnormal thyroid function test were also conducted. RESULTS: During a median 2.6 year follow-up, the incident rates for dysglycaemia, particularly prediabetes, were substantially higher in participants with elevated thyroid-stimulating hormone concentrations at baseline, while the rates for participants with normal and low thyroid-stimulating hormone were similar. After controlling for risk factors, participants with elevated thyroid-stimulating hormone retained a 15% increase in risk of prediabetes (adjusted hazard ratio 1.15, 95% CI 1.04-1.26), but were not at greater risk of diabetes (adjusted hazard ratio 0.96, 95% CI 0.64-1.44). By contrast, participants with normal and low thyroid-stimulating hormone concentrations had similar dysglycaemia risks. Participants with diabetes and prediabetes were not at greater risks of developing abnormal thyroid function test results when compared with participants with euglycaemia. CONCLUSIONS: People with elevated serum thyroid-stimulating hormone concentration are at greater risk of developing prediabetes. Whether this includes a greater risk of developing frank diabetes may require an extended period of follow-up to clarify.


Asunto(s)
Trastornos del Metabolismo de la Glucosa/epidemiología , Enfermedades de la Tiroides/epidemiología , Adulto , Anciano , Estudios Transversales , Femenino , Estudios de Seguimiento , Trastornos del Metabolismo de la Glucosa/sangre , Trastornos del Metabolismo de la Glucosa/complicaciones , Trastornos del Metabolismo de la Glucosa/fisiopatología , Humanos , Incidencia , Masculino , Persona de Mediana Edad , Estado Prediabético/sangre , Estado Prediabético/complicaciones , Estado Prediabético/epidemiología , Estado Prediabético/fisiopatología , Enfermedades de la Tiroides/sangre , Enfermedades de la Tiroides/complicaciones , Enfermedades de la Tiroides/diagnóstico , Pruebas de Función de la Tiroides , Glándula Tiroides/fisiopatología , Tirotropina/sangre
4.
Br J Anaesth ; 119(4): 595-605, 2017 Oct 01.
Artículo en Inglés | MEDLINE | ID: mdl-29121289

RESUMEN

BACKGROUND: We hypothesised that intraoperative non-depolarising neuromuscular blocking agent (NMBA) dose is associated with 30-day hospital readmission. METHODS: Data from 13,122 adult patients who underwent abdominal surgery under general anaesthesia at a tertiary care hospital were analysed by multivariable regression, to examine the effects of intraoperatively administered NMBA dose on 30-day readmission (primary endpoint), hospital length of stay, and hospital costs. RESULTS: Clinicians used cisatracurium (mean dose [SD] 0.19 mg kg-1 [0.12]), rocuronium (0.83 mg kg-1 [0.53]) and vecuronium (0.14 mg kg-1 [0.07]). Intraoperative administration of NMBAs was dose-dependently associated with higher risk of 30-day hospital readmission (adjusted odds ratio 1.89 [95% Confidence Interval (CI) 1.26-2.84] for 5th quintile vs 1st quintile; P for trend: P<0.001), prolonged hospital length of stay (adjusted incidence rate ratio [aIRR] 1.20 [95% CI 1.11-1.29]; P for trend: P<0.001) and increased hospital costs (aIRR 1.18 [95% CI 1.13-1.24]; P for trend: P<0.001). Admission type (same-day vs inpatient surgery) significantly modified the risk (interaction term: aOR 1.31 [95% CI 1.05-1.63], P=0.02), and the adjusted odds of readmission in patients undergoing ambulatory surgical procedures who received high-dose NMBAs vs low-dose NMBAs amounted to 2.61 [95% CI 1.11-6.17], P for trend: P<0.001. Total intraoperative neostigmine dose increased the risk of 30-day readmission (aOR 1.04 [1.0-1.08], P=0.048). CONCLUSIONS: In a retrospective analysis, high doses of NMBAs given during abdominal surgery was associated with an increased risk of 30-day readmission, particularly in patients undergoing ambulatory surgery.


Asunto(s)
Abdomen/cirugía , Cuidados Intraoperatorios/métodos , Bloqueo Neuromuscular/efectos adversos , Bloqueantes Neuromusculares/efectos adversos , Readmisión del Paciente/estadística & datos numéricos , Complicaciones Posoperatorias/epidemiología , Adulto , Anciano , Procedimientos Quirúrgicos Ambulatorios , Boston/epidemiología , Relación Dosis-Respuesta a Droga , Femenino , Humanos , Masculino , Persona de Mediana Edad , Estudios Retrospectivos
5.
Int J Clin Pract ; 69(12): 1473-85, 2015 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-26299643

RESUMEN

BACKGROUND: An increased risk for ischaemic stroke has been reported in young hyperthyroidism patients independent of atrial fibrillation (AF). However, whether the use of antithyroid drugs in hyperthyroidism patients can reduce the occurrence of ischaemic stroke remains unclear. METHODS: A total of 36,510 newly diagnosed hyperthyroidism patients during 2003-2006 were identified from the Taiwan National Health Insurance Research database. Each patient was individually tracked for 5 years from their index date (beginning the antithyroid drugs) to identify those who suffered from new episode of ischaemic stroke. Medication possession ratio (MPR) was used to represent the antithyroid drug compliance. The association between the MPR and the risk of stroke was examined. RESULTS: The stroke incidence rates for hyperthyroidism patients with age < 45 years and age ≥ 45 years were 0.42 and 3.76 per 1000 person-years, respectively. The patients aged < 45 years with MPR < 0.2 (adjusted hazard ratio, HR, 2.30; 95% CI, 1.13-4.70; p = 0.02) and 0.2 ≤ MPR < 0.4 (adjusted HR, 2.24; 95% CI, 1.06-4.72; p = 0.035) had a significantly increased risk of ischaemic stroke as compared to those with ≥ 0.6. In patients of the age ≥ 45 years, only the patients with MPR < 0.2 (adjusted HR, 1.44; 95% CI, 1.03-2.01; p = 0.036) had a significantly higher risk of ischaemic stroke as compared to those with MPR ≥ 0.6. In hyperthyroidism patients without AF, good antithyroid drugs compliance also reduced the incidence of stroke significantly (adjusted HR, range: 1.52-1.61; p = 0.02); but not in hyperthyroidism with AF. CONCLUSION: Hyperthyroidism patients with good antithyroid drug compliance had a lower risk of ischaemic stroke than patients with poor compliance.


Asunto(s)
Antitiroideos/uso terapéutico , Hipertiroidismo/tratamiento farmacológico , Cumplimiento de la Medicación , Accidente Cerebrovascular/epidemiología , Adulto , Anciano , Femenino , Humanos , Hipertiroidismo/complicaciones , Incidencia , Masculino , Persona de Mediana Edad , Modelos de Riesgos Proporcionales , Factores de Riesgo , Accidente Cerebrovascular/etiología , Taiwán/epidemiología , Adulto Joven
6.
Plant Dis ; 98(5): 701, 2014 May.
Artículo en Inglés | MEDLINE | ID: mdl-30708545

RESUMEN

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

7.
Diabet Med ; 30(3): 318-25, 2013 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-22946586

RESUMEN

AIMS: To evaluate whether homeostasis model assessment and high-sensitivity C-reactive protein improve the prediction of isolated post-load hyperglycaemia. METHODS: The subjects were 1458 adults without self-reported diabetes recruited between 2006 and 2010. Isolated post-load hyperglycaemia was defined as fasting plasma glucose < 7 mmol/l and 2-h post-load plasma glucose ≥ 11.1 mmol/l. Risk scores of isolated post-load hyperglycaemia were constructed by multivariate logistic regression. An independent group (n = 154) was enrolled from 2010 to 2011 to validate the models' performance. RESULTS: One hundred and twenty-three subjects (8.28%) were newly diagnosed as having diabetes mellitus. Among those with undiagnosed diabetes, 64 subjects (52%) had isolated post-load hyperglycaemia. Subjects with isolated post-load hyperglycaemia were older, more centrally obese and had higher blood pressure, HbA(1c), fasting plasma glucose, triglycerides, LDL cholesterol, high-sensitivity C-reactive protein and homeostasis model assessment of insulin resistance and lower homeostasis model assessment of ß-cell function than those without diabetes. The risk scores included age, gender, BMI, homeostasis model assessment, high-sensitivity C-reactive protein and HbA(1c). The full model had high sensitivity (84%) and specificity (87%) and area under the receiver operating characteristic curve (0.91), with a cut-off point of 23.81; validation in an independent data set showed 88% sensitivity, 77% specificity and an area under curve of 0.89. CONCLUSIONS: Over half of those with undiagnosed diabetes had isolated post-load hyperglycaemia. Homeostasis model assessment and high-sensitivity C-reactive protein are useful to identify subjects with isolated post-load hyperglycaemia, with improved performance over fasting plasma glucose or HbA(1c) alone.


Asunto(s)
Glucemia/metabolismo , Proteína C-Reactiva/metabolismo , Homeostasis/fisiología , Hiperglucemia/diagnóstico , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Diabetes Mellitus Tipo 2/diagnóstico , Ayuno/sangre , Femenino , Prueba de Tolerancia a la Glucosa/métodos , Hemoglobina Glucada/metabolismo , Humanos , Masculino , Persona de Mediana Edad , Modelos Biológicos , Medición de Riesgo , Adulto Joven
8.
Eur J Cancer Care (Engl) ; 22(4): 468-73, 2013 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-23730735

RESUMEN

Cancer patients with terminal stage peritoneal carcinomatosis are often unable to eat, rendering total parenteral nutrition (TPN) as the only option to avoid starvation. In this retrospective study, we reviewed the medical records of 46 patients with peritoneal carcinomatosis and compared them to the records of 51 patients who had gastrointestinal malignancy without evidence of peritoneal carcinomatosis. The factors evaluated include demographic data, cause of primary malignancy, ascites formation, anthropometric measurements, laboratory tests, and outcome measurements as well as factors associated with greater than 90-day survival. In-hospital mortality was observed in 31 of the 46 patients with peritoneal carcinomatosis, with a median survival time of 40 days (4-148 days) for all 46 patients. The median duration of TPN administration in the peritoneal carcinomatosis group was 24.1 ± 27.4 days (3-68 days). Severe infection related to TPN application was seen in 5/46 (10.7%) patients with peritoneal carcinomatosis and 6/51 (9.8%) patients without peritoneal carcinomatosis. The length of survival varied widely among terminal patients with peritoneal carcinomatosis. The average survival time in peritoneal carcinomatosis patients receiving TPN was short, indicating that the nutrition support of TPN was relatively suboptimal. Ascites was not a prognostic factor for peritoneal carcinomatosis, while body mass index was a predictor for 90-day survival.


Asunto(s)
Carcinoma/terapia , Nutrición Parenteral , Neoplasias Peritoneales/terapia , Adulto , Anciano , Carcinoma/mortalidad , Femenino , Mortalidad Hospitalaria , Humanos , Tiempo de Internación/estadística & datos numéricos , Modelos Logísticos , Masculino , Persona de Mediana Edad , Evaluación de Resultado en la Atención de Salud , Neoplasias Peritoneales/mortalidad , Estudios Retrospectivos , Análisis de Supervivencia
10.
Plant Dis ; 97(2): 291, 2013 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-30722339

RESUMEN

A disease of okra (Abelmoschus esculentus) causing yellowing veins and mosaic on leaves and fruit has emerged in Thailand. Incidences of 50 to 100% diseased plants were observed in fields in Kanchanaburi and Nakhon Pathom provinces in 2009 and 2010, respectively. Leaf samples were collected from three and four diseased plants in Kanchanaburi and Nakhon Pathom, respectively. All seven samples tested positive for begomovirus by PCR using universal primer pair PAL1v1978B/PAR1c715H (3). One sample from Kanchanaburi also tested positive by ELISA using Okra mosaic virus (Genus Tymovirus) antiserum (DSMZ, Braunschweig, Germany). When the nucleotide sequences of the 1.5 kb begomovirus PCR products were compared they were found to share 99.1 to 99.5% identity with each other, and 97.5 to 97.7% identity to Bhendi yellow vein mosaic virus Okra isolate from India (GenBank Accession No. GU112057; BYVMV-[IN: Kai:OY: 06]). The complete DNA-A sequence for a Kanchanaburi isolate (JX678967) was obtained using abutting primers WTHOK6FL-V/-C (WTHOK6FL-V: 5'-GCGAAGCTTAGATAACGCTCCTT-3'; WTHOK6FL-C: 5'-TCCAAGCTTTGAGTCTGCAACGT-3'), while that of a Nakhon Pathom isolate (JX678966) was obtained with primers WTHOK6FLV/WTHOK2FL-C (WTHOK2FL-C: 5'-TCCAAGCTTTGAGTCTGCATCGT-3'). The DNA-A sequences of both isolates are 2,740 nucleotides in length and share 99.6% identity. Each has the geminivirus conserved sequence (TAATATTAC), two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). Based on BLASTn searching GenBank and sequence analysis using MegAlign (DNASTAR), both DNA-A sequences have greatest nucleotide identity (96.2 to 96.4%) with BYVMV-[IN: Kai:OY: 06] from India. Also, BYVMV-associated betasatellite DNA (1.4 kb) was detected in all begomovirus-positive samples, except one sample from Nakhon Pathom (1). However, no virus DNA-B was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (2). Okra infected with BYVMV has been reported in South Asia in Bangladesh, India, and Pakistan. To the best of our knowledge, this is the first report of BYVMV associated with Okra Yellow Vein Mosaic Disease in Southeast Asia. Since fruits with symptoms are regarded as low quality and have little market value, even low incidence of the disease is likely to cause significant reductions in marketable yield. Strategies for managing BYVMV in okra in South and Southeast Asia should be sought, including the breeding and selecting of resistant varieties. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

12.
Nat Genet ; 12(2): 144-8, 1996 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-8563751

RESUMEN

Individuals with neurofibromatosis type 1 (NF1) are predisposed to certain cancers including juvenile chronic myelogenous leukaemia (JCML). The NF1 tumour-suppressor gene encodes a protein (neurofibromin) that accelerates GTP hydrolysis on Ras proteins. Here we show that primary leukaemic cells from children with NF1 show a selective decrease in NF1-like GTPase activating protein (GAP) activity for Ras but retain normal cellular GAP activity. Leukaemic cells also show an elevated percentage of Ras in the GTP-bound conformation. JCML cells are hypersensitive to granulocyte-macrophage colony stimulating factor (GM-CSF), and we observed a similar pattern of aberrant growth in haematopoietic cells from Nf1-/- mouse embryos. These data define a specific role for neurofibromin in negatively regulating GM-CSF signaling through Ras in haematopoietic cells and they suggest that hypersensitivity to GM-CSF may be a primary event in the development of JCML.


Asunto(s)
Células Madre Hematopoyéticas/patología , Neurofibromatosis 1/metabolismo , Proteínas/fisiología , Proteínas ras/fisiología , Animales , División Celular , Células Cultivadas , Niño , Proteínas Activadoras de GTPasa , Genes de Neurofibromatosis 1 , Factor Estimulante de Colonias de Granulocitos y Macrófagos/farmacología , Guanosina Trifosfato/metabolismo , Humanos , Leucemia Mielógena Crónica BCR-ABL Positiva/patología , Ratones , Neurofibromatosis 1/patología , Neurofibromina 1 , Proteínas/metabolismo , Transducción de Señal/fisiología , Proteínas Activadoras de ras GTPasa , Proteínas ras/metabolismo
13.
East Asian Arch Psychiatry ; 31(4): 97-104, 2021 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-34987120

RESUMEN

OBJECTIVES: To determine the psychometric properties of the Chinese version of the work and social adjustment scale (CWSAS) in outpatients with common mental disorders, and to evaluate the correlations of CWSAS with Physical Health Questionnaire-9 (PHQ-9), General Anxiety Disorder-7 (GAD-7), World Health Organization Five Well-being Index (WHO-5), and Chinese version of the Perceived Stress Scale-10 (CPSS-10). METHODS: Forward and backward translations of the CWSAS was performed. Between October 2018 and March 2020, 252 outpatients with a common mental disorder who had a job or a job plan were recruited from two psychiatric centres in Hong Kong. Participants were asked to complete the CWSAS, PHQ-9, GAD-7, WHO-5, and CPSS-10. Classical test theory and Rasch analysis were undertaken to determine the psychometric properties of the CWSAS and its correlations with other tools. RESULTS: Principal component analysis revealed that the CWSAS was a one-factor structure and showed adequate convergent and discriminant validities, internal consistency, item-total correlation, and inter-item correlation. There was a significant group difference in terms of employment status. CPSS-10 and PHQ-9 were predictors for CWSAS score. The CWSAS was a distinct factor among other outcome measures. Rasch analysis indicated that the CWSAS was well-targeted and unidimensional. The CWSAS had an adequate person separation index, item separation index, person reliability, and item reliability. No categorical disordering was found, whereas inadequate adjacent threshold distance was reported. The item of ability to work indicated a noticeable differential item functioning in employment status and main source of finance. CONCLUSION: The CWSAS is psychometrically appropriate to measure functional outcomes in outpatients with common mental disorders.


Asunto(s)
Trastornos Mentales , Pacientes Ambulatorios , Hong Kong , Humanos , Psicometría , Reproducibilidad de los Resultados , Ajuste Social , Encuestas y Cuestionarios
14.
Plant Dis ; 94(5): 637, 2010 May.
Artículo en Inglés | MEDLINE | ID: mdl-30754457

RESUMEN

Whitefly-transmitted begomoviruses (family Geminiviridae, genus Begomovirus) cause severe epidemic and high yield losses on pepper (Capsicum annuum) crops in many areas of the world. In Taiwan, pepper plants showing leaf curling, blistering, distortion, mild vein yellowing, and stunting were observed in fields in Tainan County in 2007, but with disease incidence less than 10%. However, disease incidence of more than 70% was observed in some fields in Pingtung, Kaohsiung, Chiayi, and Yunlin counties in 2009. Two symptomatic samples in 2007 and three for each county in 2009 were collected for begomovirus detection. Viral DNA was extracted and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR using primer pairs PAL1v1978/PAR1c715 (4), DNABLC1/DNABLV2 (2), and Beta01/Beta02 (1), respectively. The expected 1.5-kb PCR product for DNA-A and 2.6-kb for DNA-B were obtained from all samples. However, DNA-beta was not detectable in any of the samples. One positive sample from each, Pingtung (LG6-2), Kaoshiung (LJ3-5), Tainan (P2-4), Chiayi (SG4-3), and Yunlin (HW2-2), were selected for further molecular characterization of DNA-A and DNA-B. On the basis of the sequences of the 1.5-kb DNA-A and 2.6-kb DNA-B PCR product, specific PCR primers were designed to obtain the complete DNA-A and DNA-B sequences for pepper-infecting begomovirus isolate LG6-2 (GenBank Accession Nos. GU208515 and GU208519), LJ3-5 (GenBank Nos. GU208516 and GU208520), P2-4 (GenBank Nos. EU249457 and EU249458), SG4-3 (GenBank Nos. GU208517 and GU208521), and HW2-2 (GenBank Nos. GU208518 and GU208522). The five isolates each contained the begomoviral conserved nonanucleotide sequence-TAATATTAC in DNA-As and DNA-Bs, six open reading frames (ORFs AV1, AV2, AC1, AC2, AC3, and AC4) in DNA-As, and two open reading frames (ORFs BV1 and BC1) in DNA-Bs. Sequence comparison by MegAlign software (DNASTAR, Inc. Madison, WI) showed that the five pepper-infecting begomovirus isolates had 99% nucleotide sequence identity in DNA-As and DNA-Bs and so they are considered isolates of the same species. BLASTn analysis with begomovirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD) indicated that the DNA-As and DNA-Bs of the five isolates had the highest nucleotide sequence identity of 99% each with the respective DNA-A and DNA-B of Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Nos. EF577266 and EF577267), a recently emerging bipartite begomovirus infecting tomato in Taiwan (3). On the basis of the DNA-A sequence comparison and the International Committee on Taxonomy of Viruses demarcation of species at 89% sequence identity, these virus isolates belong to the species TYLCTHV. The isolate P2-4 was found transmissible to C. annuum 'Early Calwonder' by whitefly (Bemisia tabaci biotype B) and induced the same leaf curling, blistering, and mild vein yellowing symptoms as those observed in pepper fields. To our knowledge, this is the first report of a begomovirus infecting pepper in Taiwan. The presence of TYLCTHV in the major pepper-production areas should be taken into consideration for pepper disease management and in developing begomovirus resistant pepper cultivars for Taiwan. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) F.-J. Jan et al. Plant Dis. 91:1363, 2007 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

15.
Sci Rep ; 10(1): 19610, 2020 11 12.
Artículo en Inglés | MEDLINE | ID: mdl-33184302

RESUMEN

In other species characterized to date, aging, as a function of reproductive potential, results in the breakdown of proteaostasis and a decreased capacity to mount responses by the heat shock response (HSR) and other proteostatic network pathways. Our understanding of the maintenance of stress pathways, such as the HSR, in honey bees, and in the reproductive queen in particular, is incomplete. Based on the findings in other species showing an inverse relationship between reproductive potential and HSR function, one might predict that that HSR function would be lost in the reproductive queens. However, as queens possess an atypical uncoupling of the reproduction-maintenance trade-off typically found in solitary organisms, HSR maintenance might also be expected. Here we demonstrate that reproductive potential does not cause loss of HSR performance in honey bees as queens induce target gene expression to levels comparable to those induced in attendant worker bees. Maintenance of HSR function with advent of reproductive potential is unique among invertebrates studied to date and provides a potential model for examining the molecular mechanisms regulating the uncoupling of the reproduction-maintenance trade-off in queen bees, with important consequences for understanding how stresses impact different types of individuals in honey bee colonies.


Asunto(s)
Abejas/fisiología , Respuesta al Choque Térmico/fisiología , Reproducción/fisiología , Animales , Abejas/genética , Expresión Génica , Respuesta al Choque Térmico/genética , Proteostasis , Reproducción/genética
16.
Arch Virol ; 154(2): 369-72, 2009.
Artículo en Inglés | MEDLINE | ID: mdl-19156351

RESUMEN

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.


Asunto(s)
Abelmoschus/virología , Begomovirus/genética , ADN Viral/genética , Enfermedades de las Plantas/virología , Virus Satélites/genética , Secuencia de Bases , Begomovirus/clasificación , Datos de Secuencia Molecular , Niger , Filogenia , Virus Satélites/clasificación , Homología de Secuencia
17.
J Phys Condens Matter ; 21(31): 314013, 2009 Aug 05.
Artículo en Inglés | MEDLINE | ID: mdl-21828574

RESUMEN

We have used energy-filtered x-ray photoelectron emission microscopy (XPEEM) and synchrotron radiation to measure the grain orientation dependence of the work function of a sintered niobium-doped strontium titanate ceramic. A significant spread in work function values is found. Grain orientation and surface reducing/oxidizing conditions are the main factors in determining the work function. Energy-filtered XPEEM looks ideally suited for analysis of other technologically interesting polycrystalline samples.

18.
Plant Dis ; 93(3): 321, 2009 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-30764201

RESUMEN

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

19.
Prim Care Diabetes ; 13(2): 134-141, 2019 04.
Artículo en Inglés | MEDLINE | ID: mdl-30448412

RESUMEN

AIMS: Gestational diabetes (GDM) and Type 2 diabetes pose tremendous health and economic burdens as worldwide incidence increases. Primary care-based systematic diabetes screening and prevention programs could be effective in women with previous GDM. GooD4Mum aimed to determine whether a Quality Improvement Collaborative (QIC) would improve postpartum diabetes screening and prevention planning in women with previous GDM in general practice. METHODS: Fifteen general practices within Victoria (Australia) participated in a 12-month QIC, consisting of baseline and four quarterly audits, guideline-led workshops and Plan-Do-Study-Act feedback cycles after each audit. The primary outcome measures were the proportion of women on local GDM registers completing a diabetes screening test and a diabetes prevention planning consultation within the previous 15 months. RESULTS: Diabetes screening increased with rates more than doubled from 26% to 61% and postpartum screening increased from 43%-60%. Diabetes prevention planning consultations did not show the same level of increase (0%-10%). The recording of body mass index improved overall (51%-69%) but the number of women with normal body mass index did not. CONCLUSIONS: GooD4Mum supported increased diabetes screening and the monitoring of high risk women with previous GDM in general practice.


Asunto(s)
Diabetes Mellitus Tipo 2/prevención & control , Diabetes Gestacional/terapia , Medicina General , Tamizaje Masivo/métodos , Salud Materna , Atención Primaria de Salud , Prevención Primaria/métodos , Mejoramiento de la Calidad , Indicadores de Calidad de la Atención de Salud , Adulto , Anciano , Diabetes Mellitus Tipo 2/diagnóstico , Diabetes Mellitus Tipo 2/epidemiología , Diabetes Gestacional/diagnóstico , Diabetes Gestacional/epidemiología , Femenino , Estado de Salud , Humanos , Persona de Mediana Edad , Valor Predictivo de las Pruebas , Embarazo , Factores Protectores , Medición de Riesgo , Factores de Riesgo , Victoria/epidemiología
20.
Br J Cancer ; 99(1): 118-25, 2008 Jul 08.
Artículo en Inglés | MEDLINE | ID: mdl-18594537

RESUMEN

Alterations in the tumour suppressor p53 have been reported in tumour-associated stromal cells; however, the consequence of these alterations has not been elucidated. We investigated p53 status and responses to p53-activating drugs using tumour-associated stromal cells from A375 melanoma and PC3 prostate carcinoma xenografts, and a spontaneous prostate tumour model (TRAMP). p53 accumulation after treatment with different p53-activating drugs was diminished in tumour-associated stromal cells compared to normal stromal cells. Tumour-associated stromal cells were also less sensitive to p53-activating drugs - this effect could be reproduced in normal stromal cells by p53 knockdown. Unlike normal stromal cells, tumour stromal cells failed to arrest in G(2) after etoposide treatment, failed to upregulate p53-inducible genes, and failed to undergo apoptosis after treatment with vincristine. The lower levels of p53 in tumour stromal cells accompanied abnormal karyotypes and multiple centrosomes. Impaired p53 function in tumour stroma might be related to genomic instability and could enable stromal cell survival in the destabilising tumour microenvironment.


Asunto(s)
Antineoplásicos/farmacología , Resistencia a Antineoplásicos/genética , Genes p53/genética , Células del Estroma/metabolismo , Animales , Apoptosis/efectos de los fármacos , Ciclo Celular/efectos de los fármacos , Línea Celular Tumoral , Modelos Animales de Enfermedad , Etopósido/farmacología , Expresión Génica , Humanos , Ratones , Células del Estroma/efectos de los fármacos , Vincristina/farmacología , Ensayos Antitumor por Modelo de Xenoinjerto
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA