Structural Change from Nonparallel to Parallel G-Quadruplex Structures in Live Cancer Cells Detected in the Lysosomes Using Fluorescence Lifetime Imaging Microscopy.

Time-gated fluorescence lifetime imaging microscopy with the o-BMVC fluorescent probe provides a visualizing method for the study of exogenous G-quadruplexes (G4s) in live cancer cells. Previously, imaging results showed that the parallel G4s are accumulated and that nonparallel G4s are not detected in the lysosomes of CL1-0 live cells. In this work, the detection of the G4 signals from exogenous GTERT-d(FN) G4s in the lysosomes may involve a structural change in live cells from intramolecular nonparallel G4s to intermolecular parallel G4s. Moreover, the detection of the G4 signals in the lysosomes after the 48 h incubation of HT23 G4s with CL1-0 live cells indicates the occurrence of structural conversion from the nonparallel G4s to the parallel G4s of HT23 in the live cells. In addition, the detection of much stronger G4 signals from ss-GTERT-d(FN) than ss-HT23 in the lysosomes of CL1-0 live cells may be explained by the quick formation of the intermolecular parallel G4s of ss-GTERT-d(FN) and the degradation of ss-HT23 before its intramolecular parallel G4 formation. This work provides a new approach to studying G4-lysosome interactions in live cells.

Folding and Unfolding of Exogenous G-Rich Oligonucleotides in Live Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Fluorescent Probe.

Guanine-rich oligonucleotides (GROs) can self-associate to form G-quadruplex (G4) structures that have been extensively studied in vitro. To translate the G4 study from in vitro to in live cells, here fluorescence lifetime imaging microscopy (FLIM) of an o-BMVC fluorescent probe is applied to detect G4 structures and to study G4 dynamics in CL1-0 live cells. FLIM images of exogenous GROs show that the exogenous parallel G4 structures that are characterized by the o-BMVC decay times (≥2.4 ns) are detected in the lysosomes of live cells in large quantities, but the exogenous nonparallel G4 structures are hardly detected in the cytoplasm of live cells. In addition, similar results are also observed for the incubation of their single-stranded GROs. In the study of G4 formation by ssHT23 and hairpin WT22, the analyzed binary image can be used to detect very small increases in the number of o-BMVC foci (decay time ≥ 2.4 ns) in the cytoplasm of live cells. However, exogenous ssCMA can form parallel G4 structures that are able to be detected in the lysosomes of live CL1-0 cells in large quantities. Moreover, the photon counts of the o-BMVC signals (decay time ≥ 2.4 ns) that are measured in the FLIM images are used to reveal the transition of the G4 formation of ssCMA and to estimate the unfolding rate of CMA G4s with the addition of anti-CMA into live cells for the first time. Hence, FLIM images of o-BMVC fluorescence hold great promise for the study of G4 dynamics in live cells.

Antisense Oligonucleotides Used to Identify Telomeric G-Quadruplexes in Metaphase Chromosomes and Fixed Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci.

Identification of the existence of G-quadruplex (G4) structure, from a specific G-rich sequence in cells, is critical to the studies of structural biology and drug development. Accumulating evidence supports the existence of G4 structure in vivo. Particularly, time-gated fluorescence lifetime imaging microscopy (FLIM) of a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), was used to quantitatively measure the number of G4 foci, not only in different cell lines, but also in tissue biopsy. Here, circular dichroism spectra and polyacrylamide gel electrophoresis assays show that the use of antisense oligonucleotides unfolds their G4 structures in different percentages. Using antisense oligonucleotides, quantitative measurement of the number of o-BMVC foci in time-gated FLIM images provides a method for identifying which G4 motifs form G4 structures in fixed cells. Here, the decrease of the o-BMVC foci number, upon the pretreatment of antisense sequences, (CCCTAA)3CCCTA, in fixed cells and at the end of metaphase chromosomes, allows us to identify the formation of telomeric G4 structures from TTAGGG repeats in fixed cells.

Binding of Small Molecules to G-quadruplex DNA in Cells Revealed by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci.

G-quadruplex (G4) structures have recently received increasing attention as a potential target for cancer research. We used time-gated fluorescence lifetime imaging microscopy (FLIM) with a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), to measure the number of o-BMVC foci, which may represent G4 foci, in cells as a common signature to distinguish cancer cells from normal cells. Here, the decrease in the number of o-BMVC foci in the pretreatment of cancer cells with TMPyP4, BRACO-19 and BMVC4 suggested that they directly bind to G4s in cells. In contrast, the increase in the number of o-BMVC foci in the pretreatment of cells with PDS and Hoechst 33258 (H33258) suggested that they do not inhabit the binding site of o-BMVC to G4s in cells. After the H33258 was removed, the gradual decrease of H33258-induced G4 foci may be due to DNA repair. The purpose of this work is to introduce o-BMVC foci as an indicator not only to verify the direct binding of potential G4 ligands to G4 structures but also to examine the possible effect of some DNA binding ligands on DNA integrity by monitoring the number of G4 foci in cells.

Direct evidence of mitochondrial G-quadruplex DNA by using fluorescent anti-cancer agents.

G-quadruplex (G4) is a promising target for anti-cancer treatment. In this paper, we provide the first evidence supporting the presence of G4 in the mitochondrial DNA (mtDNA) of live cells. The molecular engineering of a fluorescent G4 ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC), can change its major cellular localization from the nucleus to the mitochondria in cancer cells, while remaining primarily in the cytoplasm of normal cells. A number of BMVC derivatives with sufficient mitochondrial uptake can induce cancer cell death without damaging normal cells. Fluorescence studies of these anti-cancer agents in live cells and in isolated mitochondria from HeLa cells have demonstrated that their major target is mtDNA. In this study, we use fluorescence lifetime imaging microscopy to verify the existence of mtDNA G4s in live cells. Bioactivity studies indicate that interactions between these anti-cancer agents and mtDNA G4 can suppress mitochondrial gene expression. This work underlines the importance of fluorescence in the monitoring of drug-target interactions in cells and illustrates the emerging development of drugs in which mtDNA G4 is the primary target.

Inhibition of cancer cell migration and invasion through suppressing the Wnt1-mediating signal pathway by G-quadruplex structure stabilizers.

WNT1 encodes a multifunctional signaling glycoprotein that is highly expressed in several malignant tumors. Patients with Wnt1-positive cancer are usually related to advanced metastasis. Here, we found that a stretch of G-rich sequences located at the WNT1 promoter region is capable of forming G-quadruplex structures. The addition of G-quadruplex structure stabilizers, BMVC and BMVC4, raises the melting temperature of the oligonucleotide formed by the WNT1 promoter G-rich sequences. Significantly, the expression of WNT1 was repressed by BMVC or BMVC4 in a G-quadruplex-dependent manner, suggesting that they can be used to modulate WNT1 expression. The role of G-quadruplex stabilizers on Wnt1-mediated cancer migration and invasion was further analyzed. The protein levels of ß-catenin, a mediator of the Wnt-mediated signaling pathway, and the downstream targets MMP7 and survivin were down-regulated upon BMVC or BMVC4 treatments. Moreover, the migration and invasion activities of cancer cells were inhibited by BMVC and BMVC4, and the inhibitory effects can be reversed by WNT1-overexpression. Thus the Wnt1 expression and its downstream signaling pathways can be regulated through the G-quadruplex sequences located at its promoter region. These findings provide a novel approach for future drug development to inhibit migration and invasion of cancer cells.

Conformational transition of a hairpin structure to G-quadruplex within the WNT1 gene promoter.

The role of G-quadruplexes (G4s) in biological systems has been widely studied. It is found that they have an important function in gene transcription and regulation. In this work, we have identified two topologies of hairpin and G4 structures formed by a native G-rich sequence (WT22: 5'-GGGCCACCGGGCAGGGGGCGGG-3') from the WNT1 promoter region using nuclear magnetic resonance (NMR) spectroscopy. With the help of site-specific isotope labeling, the topologies of these two structures are unambiguously characterized. Circular dichroism and NMR results are analyzed to determine the kinetics associated with the potassium ion-induced hairpin-to-G4 transition, which is very slow-on the time scale of 4800 s-compared to the previously reported folding kinetics of G4 formation. In addition, the free energies of the unfolding of these two structures are obtained using differential scanning calorimetry. Combining the kinetic and thermodynamic data, we have established the free energy landscape of this two-state folding system. Considering that similar conformational change may exist in other native G-rich sequences, this work highlights an important hairpin to G4 conformational transition which can be used in manipulation of gene regulation or ligand modulation in vivo.

In-cell optical imaging of exogenous G-quadruplex DNA by fluorogenic ligands.

Guanine-rich oligonucleotides (GROs) are promising therapeutic candidate for cancer treatment and other biomedical application. We have introduced a G-quadruplex (G4) ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide, to monitor the cellular uptake of naked GROs and map their intracellular localizations in living cells by using confocal microscopy. The GROs that form parallel G4 structures, such as PU22, T40214 and AS1411, are detected mainly in the lysosome of CL1-0 lung cancer cells after incubation for 2 h. On the contrary, the GROs that form non-parallel G4 structures, such as human telomeres (HT23) and thrombin binding aptamer (TBA), are rarely detected in the lysosome, but found mainly in the mitochondria. Moreover, the fluorescence resonant energy transfer studies of fluorophore-labeled GROs show that the parallel G4 structures can be retained in CL1-0 cells, whereas the non-parallel G4 structures are likely distorted in CL1-0 cells after cellular uptake. Of interest is that the distorted G4 structure of HT23 from the non-parallel G4 structure can reform to a probable parallel G4 structure induced by a G4 ligand in CL1-0 living cells. These findings are valuable to the design and rationale behind the possible targeted drug delivery to specific cellular organelles using GROs.

Cyclic anthraquinone derivatives, unique G-quadruplex binders, selectively induce cancer cell apoptosis and inhibit tumor growth.

Cyclic anthraquinone derivatives (cAQs), which link two side chains of 1,5-disubstituted anthraquinone as a threading DNA intercalator, have been developed as G-quartet (G4) DNA-specific ligands. Among the cAQs, cAQ-mBen linked through the 1,3-position of benzene had the strongest affinity for G4 recognition and stabilization in vitro and was confirmed to bind to the G4 structure in vivo, selectively inhibiting cancer cell proliferation in correlation with telomerase expression levels and triggering cell apoptosis. RNA-sequencing analysis further indicated that differentially expressed genes regulated by cAQ-mBen were profiled with more potential quadruplex-forming sequences. In the treatment of the tumor-bearing mouse model, cAQ-mBen could effectively reduce tumor tissue and had less adverse effects on healthy tissue. These results suggest that cAQ-mBen can be a potential cancer therapeutic agent as a G4 binder.

Pilot imaging study of o-BMVC foci for discrimination of indeterminate cytology in diagnosing fine-needle aspiration of thyroid nodules.

Fluorescence lifetime imaging microscopy of a fluorescence probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), provides an objective method for preoperative diagnosis of fine-needle aspiration (FNA) of thyroid nodules. The key of this o-BMVC test of FNA smears is the measurement of the digital number of o-BMVC foci in the nucleus. Thus, there are three categories classified in the o-BMVC test, which are nondiagnostic for unsatisfactory samples, benign for less numbers of o-BMVC foci, and malignant for more numbers of o-BMVC foci. The discrimination of indeterminate (including atypia, follicular neoplasm, suspicious) cytology into benign or malignant cases can reduce diagnostic uncertainty and benefit clinical decision making. This pilot study strongly suggests that the o-BMVC test is an invaluable method for diagnosing FNA samples. Particularly, the combination of FNA cytology and the o-BMVC test holds great promise to improve the efficacy of diagnosis and reduce the healthcare costs.

Comparison and Elucidation of Structural Diversity and Variation of G-Rich Sequences with a Single G-Base Difference.

Previously, we found the structural diversity of a mitochondrial sequence mt10251 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism. In this work, we investigate the diverse G4 topologies of mt10251 and structural variation of its mutants. Using circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE), we first illustrate an unusual tetrameric G4 structure together with hairpin bulges formed by four strands of mt10251-d30 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGG). Of interest is that the structural conversion from a hairpin structure to diverse G4 structures in mt10251 is negligible in mt10251-d30 after the addition of 20 mM K+. Further kinetic and thermal studies of mt10251, mt10251-d30, and their mutants reveal the major factors in determining the transition from a hairpin structure to diverse G4 structures of mt10251 and the structural variation of their mutants after the addition of 20 mM K+.

The G-quadruplex fluorescent probe 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide as a biosensor for human cancers.

Using time-gated fluorescence lifetime imaging microscopy, significantly more signals from 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide (o-BMVC) foci, characterized by the longer fluorescent decay time of o-BMVC, were detected in six types of cancer cells than in three types of normal cells. Accumulating evidence suggested that the o-BMVC foci are mainly the G-quadruplex foci. The large contrast in the number of o-BMVC foci can be considered as a common signature to distinguish cancer cells from normal cells. Further study of tissue biopsy showed that the o-BMVC test provides a high accuracy for clinical detection of head and neck cancers.

Fluorescent probe for visualizing guanine-quadruplex DNA by fluorescence lifetime imaging microscopy.

The importance of guanine-quadruplex (G4) is not only in protecting the ends of chromosomes for human telomeres but also in regulating gene expression for several gene promoters. However, the existence of G4 structures in living cells is still in debate. A fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), for differentiating G4 structures from duplexes is characterized. o-BMVC has a large contrast in fluorescence decay time, binding affinity, and fluorescent intensity between G4 structures and duplexes, which makes it a good candidate for probing G4 DNA structures. The fluorescence decay time of o-BMVC upon interaction with G4 structures of telomeric G-rich sequences is ∼2.8 ns and that of interaction with the duplex structure of a calf thymus is ∼1.2 ns. By analyzing its fluorescence decay time and histogram, we were able to detect one G4 out of 1000 duplexes in vitro. Furthermore, by using fluorescence lifetime imaging microscopy, we demonstrated an innovative methodology for visualizing the localization of G4 structures as well as mapping the localization of different G4 structures in living cells.

Structural conversion of intramolecular and intermolecular G-quadruplexes of bcl2mid: the effect of potassium concentration and ion exchange.

The gel assay, circular dichroism, and differential scanning calorimetry results all demonstrate that a major monomer component of bcl2mid exists at low [K(+)] and an additional dimer component appears at high [K(+)]. This implies that bcl2mid is a good candidate for elucidating the mechanisms of structural conversion between different G-quadruplexes. We further discovered that the conversion between the monomer and dimer forms of bcl2mid does not occur at room temperature but is detected when heated above the melting point. In addition, the use of the lithium cation to keep the same ionic strength in a K(+) solution favors the formation of the bcl2mid dimer. We also found that the bcl2mid dimer is more stable than the monomer. However, after the bcl2mid monomer is formed in a K(+) solution, there is no appreciable structural conversion from the monomer to the dimer detected with addition of Li(+) at room temperature. Furthermore, the spectral changes of bcl2mid when transitioning from sodium form to potassium form take place upon K(+) titration. The absence of the dimer form for bcl2mid after the direct addition of 150 mM [K(+)] at room temperature suggests that the spectral changes are not due to rapid unfolding and refolding. In addition, this work reveals the conditions that would be useful for NMR studies of G-quadruplexes.