RESUMEN
Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67â³ N; 108°40'43.24â³ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 µm, stylet lengths = 15.1 ± 0.9 µm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 µm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 µm, stylet lengths = 14.7 ± 0.5 µm, DGO = 3.5 ± 0.4 µm, tail lengths averaged = 43.6 ± 9.7 µm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ËC. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.
RESUMEN
Rationale: Although it is clear that cystic fibrosis (CF) airway disease begins at a very young age, the early and subsequent steps in disease pathogenesis and the relative contribution of infection, mucus, and inflammation are not well understood. Objectives: As one approach to assessing the early contribution of infection, we tested the hypothesis that early and continuous antibiotics would decrease the airway bacterial burden. We believed that, if they do, this might reveal aspects of the disease that are more or less sensitive to decreasing infection. Methods: Three groups of pigs were studied from birth until â¼3 weeks of age: 1) wild-type, 2) CF, and 3) CF pigs treated continuously with broad-spectrum antibiotics from birth until study completion. Disease was assessed with chest computed tomography, histopathology, microbiology, and BAL. Measurements and Main Results: Disease was present by 3 weeks of age in CF pigs. Continuous antibiotics from birth improved chest computed tomography imaging abnormalities and airway mucus accumulation but not airway inflammation in the CF pig model. However, reducing bacterial infection did not improve two disease features already present at birth in CF pigs: air trapping and submucosal gland duct plugging. In the CF sinuses, antibiotics did not prevent the development of infection or disease or the number of bacteria but did alter the bacterial species. Conclusions: These findings suggest that CF airway disease begins immediately after birth and that early and continuous antibiotics impact some, but not all, aspects of CF lung disease development.
Asunto(s)
Antibacterianos/farmacología , Bacterias/efectos de los fármacos , Fibrosis Quística/tratamiento farmacológico , Fibrosis Quística/microbiología , Pulmón/efectos de los fármacos , Mucosa Respiratoria/efectos de los fármacos , Animales , Antibacterianos/uso terapéutico , Bacterias/aislamiento & purificación , Líquido del Lavado Bronquioalveolar/microbiología , Fibrosis Quística/diagnóstico por imagen , Fibrosis Quística/patología , Pulmón/diagnóstico por imagen , Pulmón/microbiología , Pulmón/patología , Tomografía Computarizada Multidetector , Mucosa Respiratoria/microbiología , Mucosa Respiratoria/patología , PorcinosRESUMEN
BACKGROUND: The use of cognitive-enhancing medications and supplements among healthy adults continues to rise. Limited data exists on their use among resident physicians. Given their highly competitive and stressful lifestyle, we sought to evaluate the prevalence, motivations, and side effects of using cognitive-enhancing supplements and medications among resident physicians at a large United States academic institution. METHODS: An anonymous web-based survey was circulated to resident physicians inquiring about using cognitive-enhancing supplements and medications, as well as personal characteristics such as gender, marital and parental status, medical diagnoses, and medical specialty. Before circulation, we performed a pilot study. Weighted logistic regression analyses estimated the impact of personal characteristics on the probability of using both supplements and medications. RESULTS: Survey response rate was 46.4%. Of respondents, 48.6% were female, 45.9% were married, 70.9% were without children, and 67.2% were in a non-surgical medical specialty. Few respondents had a related medical diagnosis, with attention deficit hyperactivity disorder being the most common (7.1%). Male, non-married, surgical residents were more likely to take supplements (odds ratio (OR) = 1.06, 1.05, and 1.05). Males, without children, and those who felt pressure to perform well, were afraid of being left behind, felt pressure because colleagues take them, or felt they could not reach their current level of training without medications were more likely to take medications (OR = 1.11, 1.04, 1.05, and 1.08). Adverse effects with medications were common. CONCLUSION: Supplement and medication use for cognitive enhancement was high among resident physicians at a single institution despite few having a related medical diagnosis. This study raises awareness of the growing pressure in competitive residency environments to use cognitive enhancement regardless of the potential side effects.
Asunto(s)
Internado y Residencia , Médicos , Adulto , Niño , Masculino , Estados Unidos , Humanos , Femenino , Proyectos Piloto , Encuestas y Cuestionarios , Médicos/psicología , CogniciónRESUMEN
OBJECTIVES: Thrombocytopenia is common in critically ill patients treated with continuous renal replacement therapy and decreases in platelets following continuous renal replacement therapy initiation have been associated with increased mortality. Platelets play a role in innate and adaptive immunity, making it plausible that decreases in platelets following continuous renal replacement therapy initiation predispose patients to development of infection. Our objective was to determine if greater decreases in platelets following continuous renal replacement therapy correlate with increased rates of secondary infection. DESIGN: Retrospectivecohort analysis. SETTING: This study uses a continuous renal replacement therapy database from Mayo Clinic (Rochester, MN), a tertiary academic center. PARTICIPANTS: Adult patients who survived until ICU discharge and were on continuous renal replacement therapy for less than 30 days were included. A subgroup analysis was also performed in patients with thrombocytopenia (platelets < 100 × 103/µL) at continuous renal replacement therapy initiation. MEASUREMENTS AND MAIN RESULTS: The primary predictor variable was a decrease in platelets from precontinuous renal replacement therapy levels of greater than 40% or less than or equal to 40%, although multiple cut points were analyzed. The primary outcome was infection after ICU discharge, and secondary endpoints included post-ICU septic shock and post-ICU mortality. Univariable, multivariable, and propensity-adjusted analyses were used to determine associations between the predictor variable and the outcomes. RESULTS: Among 797 eligible patients, 253 had thrombocytopenia at continuous renal replacement therapy initiation. A greater than 40% decrease in platelets after continuous renal replacement therapy initiation was associated in the multivariable-adjusted models with increased odds of post-ICU infection in the full cohort (odds ratio, 1.49; CI, 1.02-2.16) and in the thrombocytopenia cohort (odds ratio, 2.63; CI, 1.35-5.15) cohorts. CONCLUSIONS: Platelet count drop by greater than 40% following continuous renal replacement therapy initiation is associated with an increased risk of secondary infection, particularly in patients with thrombocytopenia at the time of continuous renal replacement therapy initiation. Further research is needed to evaluate the impact of both continuous renal replacement therapy and platelet loss on subsequent infection risk.
Asunto(s)
Lesión Renal Aguda/terapia , Terapia de Reemplazo Renal Continuo/efectos adversos , Enfermedad Crítica/terapia , Terapia de Reemplazo Renal/efectos adversos , Trombocitopenia/fisiopatología , Lesión Renal Aguda/fisiopatología , Adulto , Anciano , Biomarcadores/sangre , Humanos , Unidades de Cuidados Intensivos , Masculino , Persona de Mediana Edad , Recuento de Plaquetas , Estudios Retrospectivos , Factores de Riesgo , Trombocitopenia/sangreRESUMEN
INTRODUCTION: We use multilevel modeling to parse out the effects of time-varying smoking abstinence and baseline depression (history and severity) on depression severity over 1 year. AIMS AND METHODS: Participants were 1000 smokers recruited worldwide for an online randomized controlled tobacco cessation trial. We examined whether changes in depression severity over time were associated with self-reported 7-day point prevalence smoking status assessed at 1-, 3-, 6-, and 12-month follow-up (FU) using baseline major depressive episode (MDE) history and baseline depression severity as time-invariant covariates. We present depression severity means and smoking abstinence at each FU. RESULTS: Regardless of concurrent abstinence status, baseline MDE history was significantly related to depression severity over time: those reporting a past MDE had worse depressive symptoms over time compared with those reporting no MDE history. Baseline depression severity interacted significantly with time-varying abstinence status: for every 1-unit increase in baseline scores on the Center for Epidemiological Studies-Depression Scale (CES-D), individuals who were smoking at FU reported CES-D scores that were 0.17 points higher than those who were abstinent. In this context, nicotine dependence, gender, age, or marital status did not affect depression severity. CONCLUSIONS: In the context of cessation, having an MDE history plays a significant role in the trajectory of depression severity over the course of 1 year, regardless of abstinence status. Abstinence is related to lower depressive symptoms at each FU, and this effect was stronger at higher levels of baseline depression severity. IMPLICATIONS: This study indicates that depressive symptoms are not exacerbated among individuals who are quitting smoking at 1-, 3-, 6-, and 12-month FUs. Depression severity is worse with a baseline history of MDE. Further, those with high baseline depression severity who continue smoking have worse depressive symptoms throughout a 1-year period compared with their abstinent counterparts.
Asunto(s)
Depresión/epidemiología , Fumadores/psicología , Cese del Hábito de Fumar/psicología , Fumar Tabaco/efectos adversos , Cese del Uso de Tabaco/psicología , Tabaquismo/complicaciones , Adulto , Depresión/etiología , Femenino , Conductas Relacionadas con la Salud , Humanos , Masculino , Estados Unidos/epidemiologíaRESUMEN
BACKGROUND: ABO compatibility can affect platelet transfusion safety and efficacy, and ABO-incompatible (ABOi) platelets likely increases the risks of transfusion reactions though the magnitude of this risk is unclear. STUDY DESIGN AND METHODS: Data collected on all platelet transfusions administered over 36+ months were classified based on patient and product ABO blood group type and merged with a data set that included all transfusion reactions reported during that period. The transfusion reaction rates among various subsets was calculated. RESULTS: In patients greater than 1 year of age, the transfusion reaction rate in the ABO-compatible (ABO-identical) platelet group was 1.0%, while the ABOi platelet group had an elevated reaction rate of 1.7%. The increased reaction rate for ABOi platelets held true even if the analysis were limited to Centers for Disease Control and Prevention/National Healthcare Safety Network qualifying reactions or just allergic or febrile nonhemolytic reactions. The increased reaction rate with ABOi platelets was independent of unit age. Surprisingly, major-incompatible transfusions (A/B antigen incompatible) had the highest rate of reactions, at 2.0%. During the study period, three acute hemolytic reactions were reported out of 2522 plasma-incompatible platelet transfusions (0.12%). CONCLUSIONS: Our results find that compatible platelet transfusions have the lowest rate of transfusion reactions. While hemolytic reactions were observed with plasma-incompatible transfusions, the rate was low. Transfusion of ABO antigen-incompatible platelets had the highest rate of transfusion reactions and resulted in a transfusion reaction rate 1.5 to 2 times that of ABO compatible transfusions.
Asunto(s)
Sistema del Grupo Sanguíneo ABO/metabolismo , Incompatibilidad de Grupos Sanguíneos/metabolismo , Transfusión de Plaquetas/efectos adversos , Reacción a la Transfusión/metabolismo , Plaquetas/fisiología , Transfusión Sanguínea/métodos , Femenino , Hemólisis/fisiología , Humanos , MasculinoRESUMEN
PURPOSE: Patient engagement has been broadly defined as the process of actively involving and supporting patients in health care and treatment decision making. The aim of this study was to identify organizational factors that are associated with greater use of patient engagement care practices in Veterans Health Administration primary care clinics. METHODS: We conducted a cross-sectional analysis of data from the 2016 Patient-Aligned Care Team (PACT) national survey of direct care clinicians (primary care clinicians, registered nurses, and clinical associates). Exploratory factor analysis was used to group conceptually related patient engagement survey items into 3 subscales: planning and goal setting; motivational interviewing; and organizational strategies to promote self-management. Our independent variables included literature-based factors reported to promote team-based care and interdisciplinary collaboration in primary care. We used generalized estimating equations with multivariate logistic regression analysis to identify independent correlates of high performance on each patient engagement domain (top 25th vs bottom 25th percentile). RESULTS: A total of 2,478 direct care clinicians from 609 clinics completed all patient engagement items in the PACT survey. For all patient engagement sub-scales, respondents at high-performing clinics were more likely to report having regular team meetings to discuss performance improvement and having leadership responsible for implementing PACT. For 2 of 3 patient engagement subscales, high performance was also associated with having fully staffed PACT teams (≥3 team members per primary care clinician) and role clarity. CONCLUSIONS: Several desirable organizational and contextual factors were associated with high performance of patient engagement care practices. Strategies to improve the organizational functioning of primary care teams may enhance patient engagement in care.
Asunto(s)
Grupo de Atención al Paciente/organización & administración , Participación del Paciente/métodos , Atención Dirigida al Paciente/organización & administración , Pautas de la Práctica en Medicina/estadística & datos numéricos , Atención Primaria de Salud/organización & administración , Adulto , Estudios Transversales , Toma de Decisiones , Análisis Factorial , Femenino , Encuestas de Atención de la Salud , Humanos , Masculino , Persona de Mediana Edad , Estados Unidos , United States Department of Veterans AffairsRESUMEN
BACKGROUND: Inter-facility transfer is an important strategy for improving access to specialized health services, but transfers are complicated by over-triage, under-triage, travel burdens, and costs. The purpose of this study is to describe ED-based inter-facility transfer practices within the Veterans Health Administration (VHA) and to estimate the proportion of potentially avoidable transfers. METHODS: This observational cohort study included all patients treated in VHA EDs between 2012 and 2014 who were transferred to another VHA hospital. Potentially avoidable transfers were defined as patients who were either discharged from the receiving ED or admitted to the receiving hospital for ≤1 day without having an invasive procedure performed. We conducted facility- and diagnosis-level analyses to identify subgroups of patients for whom potentially avoidable transfers had increased prevalence. RESULTS: Of 6,173,189 ED visits during the 3-year study period, 18,852 (0.3%) were transferred from one VHA ED to another VHA facility. Rural residents were transferred three times as often as urban residents (0.6% vs. 0.2%, p < 0.001), and 22.8% of all VHA-to-VHA transfers were potentially avoidable transfers. The 3 disease categories most commonly associated with inter-facility transfer were mental health (34%), cardiac (12%), and digestive diagnoses (9%). CONCLUSIONS: VHA inter-facility transfer is commonly performed for mental health and cardiac evaluation, particularly for patients in rural settings. The proportion that are potentially avoidable is small. Future work should focus on improving capabilities to provide specialty evaluation locally for these conditions, possibly using telehealth solutions.
Asunto(s)
Servicio de Urgencia en Hospital , Transferencia de Pacientes/estadística & datos numéricos , United States Department of Veterans Affairs , Adulto , Anciano , Estudios de Cohortes , Femenino , Investigación sobre Servicios de Salud , Humanos , Masculino , Persona de Mediana Edad , Estados UnidosRESUMEN
Grey mold is one of the most serious and catastrophic diseases, causing significant yield losses in fruits and vegetables worldwide. Iprodione is a broad spectrum agrochemical used as a foliar application as well as a seed protectant against many fungal and nematode diseases of fruits and vegetables from the last thirty years. The extensive use of agrochemicals produces resistance in plant pathogens and is the most devastating issue in food and agriculture. However, the molecular mechanism (whole transcriptomic analysis) of a resistant mutant of B. cinerea against iprodione is still unknown. In the present study, mycelial growth, sporulation, virulence, osmotic potential, cell membrane permeability, enzymatic activity, and whole transcriptomic analysis of UV (ultraviolet) mutagenic mutant and its wild type were performed to compare the fitness. The EC50 (half maximal effective concentration that inhibits the growth of mycelium) value of iprodione for 112 isolates of B. cinerea ranged from 0.07 to 0.87 µg/mL with an average (0.47 µg/mL) collected from tomato field of Guangxi Province China. Results also revealed that, among iprodione sensitive strains, only B67 strain induced two mutants, M0 and M1 after UV application. The EC50 of these induced mutants were 1025.74 µg/mL and 674.48 µg/mL, respectively, as compared to its wild type 1.12 µg/mL. Furthermore, mutant M0 showed higher mycelial growth sclerotia formation, virulence, and enzymatic activity than wild type W0 and M1 on potato dextrose agar (PDA) medium. The bctubA gene in the mutant M0 replaced TTC and GAT codon at position 593 and 599 by TTA and GAA, resulting in replacement of phenyl alanine into leucine (transversion C/A) and aspartic acid into glutamic acid (transversion T/C) respectively. In contrast, in bctubB gene, GAT codon at position 646 is replaced by AAT and aspartic acid converted into asparagine (transition G/A). RNA sequencing of the mutant and its wild type was performed without (M0, W0) and with iprodione treatment (M-ipro, W-ipro). The differential gene expression (DEG) identified 720 unigenes in mutant M-ipro than W-ipro after iprodione treatment (FDR ≤ 0.05 and log2FC ≥ 1). Seven DEGs were randomly selected for quantitative real time polymerase chain reaction to validate the RNA sequencing genes expression (log fold 2 value). The gene ontology (GO) enrichment and Kyoto encyclopedia genes and genomes (KEGG) pathway functional analyses indicated that DEG's mainly associated with lysophopholipase, carbohydrate metabolism, amino acid metabolism, catalytic activity, multifunctional genes (MFO), glutathione-S transferase (GST), drug sensitivity, and cytochrome P450 related genes are upregulated in mutant type (M0, M-ipro) as compared to its wild type (W0, W-ipro), may be related to induce resistant in mutants of B. cinerea against iprodione.
Asunto(s)
Aminoimidazol Carboxamida/análogos & derivados , Botrytis/efectos de los fármacos , Botrytis/genética , Farmacorresistencia Fúngica/genética , Hidantoínas/farmacología , Redes y Vías Metabólicas/genética , Solanum lycopersicum/microbiología , Transcriptoma/genética , Aminoimidazol Carboxamida/farmacología , Catálisis , Farmacorresistencia Fúngica/efectos de los fármacos , Frutas/microbiología , Fungicidas Industriales/farmacología , Micelio/efectos de los fármacos , Micelio/genética , Enfermedades de las Plantas/microbiología , Virulencia/genéticaRESUMEN
RATIONALE & OBJECTIVE: Clinical practice guidelines recommend delivering a continuous renal replacement therapy (CRRT) dose of 20 to 25mL/kg/h. However, practice patterns nationwide are highly variable; this inconsistent prescribing may lead to errors in medication dosing and increase rates of electrolyte and acid-base abnormalities. We describe an initiative to standardize CRRT practice patterns and reduce dosing variability. STUDY DESIGN: Quality improvement study. SETTING & PARTICIPANTS: Adult patients treated with CRRT at the University of Colorado Hospital between January 2016 and October 2017. QUALITY IMPROVEMENT ACTIVITIES: An assessment of the magnitude of the variability in CRRT dosing and the following specific interventions were implemented during the course of 1 year: (1) modification of the electronic medical record (EMR) to include calculated average 24-hour dose in real time, (2) modification of the CRRT procedure note to include comments on dosing, (3) modification of the CRRT order set to display calculations, and (4) yearly educational sessions for renal fellows outlining CRRT-specific dosing targets. OUTCOMES: The primary outcome was weekly percentage of CRRT treatments with an average delivered daily dose of 20 to 25mL/kg/h. Process and balancing outcomes included CRRT flowsheet accuracy, documentation of rates of delivered dose, and nursing satisfaction. ANALYTICAL APPROACH: Rates of weekly CRRT dosing in compliance with national guidelines were determined and used to create run charts showing compliance rates before and after the quality improvement interventions. RESULTS: Among 837 treatments before the intervention, 279 (33%) daily CRRT sessions achieved an average dose of 20 to 25mL/kg/h. Following implementation of interventions, 631 of 952 (66%) treatments achieved this goal. Week-to-week variation in dosing was significantly reduced. LIMITATIONS: A single-center study generating data that may not be generalizable to institutions with different CRRT nursing models or different EMR systems. CONCLUSIONS: Changes to the EMR and documentation templates and education of CRRT providers about dosing were associated with doubling of the rate of appropriate CRRT dosing and reduction in dosing variability.
Asunto(s)
Lesión Renal Aguda/mortalidad , Lesión Renal Aguda/terapia , Terapia de Reemplazo Renal Continuo/métodos , Soluciones para Diálisis/administración & dosificación , Mejoramiento de la Calidad , Lesión Renal Aguda/diagnóstico , Adulto , Anciano , Colorado , Terapia de Reemplazo Renal Continuo/mortalidad , Enfermedad Crítica/mortalidad , Enfermedad Crítica/terapia , Esquema de Medicación , Femenino , Mortalidad Hospitalaria , Hospitales Universitarios , Humanos , Unidades de Cuidados Intensivos , Masculino , Persona de Mediana Edad , Medición de RiesgoAsunto(s)
Dermatología , Humanos , Utah , Wyoming , Estudios Retrospectivos , Accesibilidad a los Servicios de SaludAsunto(s)
Acné Vulgar , Dispositivos Intrauterinos , Alopecia , Andrógenos , Femenino , Hirsutismo , Humanos , Estudios Retrospectivos , PielRESUMEN
It is a common understanding that the 2019 coronavirus pandemic (COVID-19) significantly harmed mental health. However, findings on changes in overall life satisfaction have been mixed and inconclusive. To address this puzzling phenomenon, we draw upon the domain-specific perspective of well-being and research on catastrophe compassion and propose that the pandemic can have opposing effects on mental health and communal satisfaction, which then differently relate to people's overall life satisfaction. Longitudinal analyses of the Household, Income and Labour Dynamics (HILDA) Survey of Australia (N = 12,093) showed that while there was a greater decrease in mental health in the first COVID-19 pandemic year (2019-2020) than in the previous years (2017-2019), an increase in communal satisfaction also occurred, demonstrating a potential silver lining effect of the pandemic on people's satisfaction with family, community, and neighborhood. Moreover, consistent with socioemotional selectivity theory, changes in mental health, communal satisfaction, and life satisfaction were related to age, such that older adults generally reported less harmful and more beneficial psychological changes. We further found that age was associated with stronger associations of mental health and communal satisfaction with life satisfaction during the pandemic year. Overall, our findings speak to the importance of communal life in life satisfaction during the pandemic and age-related differences in the process, shedding light on the need to devise customized support to address inequalities in pandemic effects on public well-being. (PsycInfo Database Record (c) 2024 APA, all rights reserved).
Asunto(s)
COVID-19 , Humanos , Anciano , Pandemias , Emociones , Satisfacción Personal , Australia/epidemiologíaRESUMEN
BACKGROUND: Medical hospitalizations are relatively common among individuals who have substance use disorders (SUDs) and represent opportunities for patient engagement and treatment. Posthospitalization transitions of care are an important element of providing full-spectrum inpatient SUD care; however, little is known about clinicians' experiences with postdischarge care transitions. METHODS: We conducted a cross-sectional study surveying hospital-based medical clinicians (ie, "hospitalists") across 2 large health systems in the state of Utah to assess current practices, barriers, facilitators, and perceptions toward posthospitalization care transitions for patients with SUDs. We used Wilcoxon signed-rank tests to identify the most impactful barriers and facilitators among all respondents. We used logistic regression models to explore the influence of hospitalists' attitudes toward providing SUD care on perceived barriers and facilitators. RESULTS: The survey was distributed to 429 individuals across 15 hospitals. Eighty-two hospitalists responded to the survey (response rate, 21.4%). Most respondents frequently cared for hospitalized patients with SUDs (n = 63, 77%) and prescribed medications for SUDs (n = 44, 56%). Four respondents (5%) felt that patients received adequate support during care transitions. Lack of social support ( P < 0.001) and social factors such as lack of transportation ( P < 0.001) were perceived as the largest barriers to successful care transitions. Conversely, a partnering outpatient clinic/clinician ( P < 0.001) and outpatient-based care coordination ( P < 0.001) were perceived as the strongest facilitators. Respondents' attitudes toward people with SUDs had a modest effect on perceived barriers and facilitators. CONCLUSIONS: Hospitalists perceived increased outpatient SUD treatment infrastructure and transitional care supports as most important in facilitating posthospitalization care transitions for patients with SUDs.
Asunto(s)
Actitud del Personal de Salud , Médicos Hospitalarios , Trastornos Relacionados con Sustancias , Humanos , Estudios Transversales , Trastornos Relacionados con Sustancias/terapia , Médicos Hospitalarios/psicología , Masculino , Femenino , Adulto , Persona de Mediana Edad , Utah , Alta del Paciente , Continuidad de la Atención al Paciente , Transferencia de Pacientes , Cuidados PosterioresRESUMEN
BACKGROUND: Comanagement of orthopedic surgery patients by internal medicine hospitalists is associated with improvements in clinical outcomes including complications, length of stay, and cost. Clinical outcomes of orthopedic comanagement performed solely by internal medicine advanced practice clinicians have not been reported. Our objecyive was to compare clinical outcomes between advanced practice clinician-based comanagement and usual orthopedic care. METHODS: This is a retrospective cohort study in patients 18 years or older, hospitalized for orthopedic joint or spine surgery between May 1, 2014 and January 1, 2022. Outcomes assessed were length of stay, intensive care unit (ICU) transfer, return to operating room, in-hospital and 30-day mortality, 30-day readmission, and total direct cost, excluding surgical implants. Generalized boosted regression and propensity score weighting was used to compare clinical outcomes and health care cost between usual care and advanced practice clinician comanagement. RESULTS: Advanced practice clinician comanagement was associated with a 5% reduction in mean length of stay (rate ratio = 0.95, P = .009), decreased odds of returning to the operating room (odds ratio [OR] 0.51, P = .002), and a significant reduction in 30-day mortality (OR 0.32, P = .037) compared with usual orthopedic care in a weighted analysis. Need for ICU transfer was higher with advanced practice clinician comanagement (OR 1.54, P = .009), without significant differences in 30-day readmission or in-hospital mortality. CONCLUSIONS: We observed reductions in length of stay, health care costs, return to the operating room, and 30-day mortality with advanced practice clinician comanagement compared with usual orthopedic care. Our findings suggest that advanced practice clinician-based comanagement may represent a safe and cost-effective model for orthopedic comanagement.
RESUMEN
BACKGROUND: There is need for interventions that can assist with long-term maintenance of healthy body weight and be sustainably integrated into existing primary care teams. The goal of MAINTAIN PRIME (Promoting Real (World) IMplEmentation) is to evaluate whether a successful electronic health record (EHR)-based weight maintenance intervention can be adapted to a new clinical setting with primary care staff serving as coaches. METHODS: EHR tools include tracking tools, standardized surveys, and standardized "SmartPhrases" for coaching. Inclusion criteria were age 18-75 years, voluntary 5% weight loss in the past 2 years with prior BMI ≥ 25 kg/m2, and no bariatric procedures in past 2 years. Participants were randomized 1:1 to tailored online coaching with EHR tracking tools (coaching) or EHR tracking tools alone (tracking). RESULTS: We screened 405 individuals between September 2021 and April 2023; 269 participants enrolled (134 coaching; 135 tracking). The most common reason for not enrolling was ineligibility (55%). At baseline, participants were 50.3 (SD 15.02) years old, 66.4% female, and 84% White; 83.7% reported moderate physical activity. Average weight and BMI at baseline were 205.0 (SD 48.9) lbs. and 33.2 (6.8) kg/m2, respectively. Participants lost an average of 10.7% (SD 5.2) of their body weight before enrolling. We recruited 39 primary care coaches over the same period. Conclusion The study successfully identified and recruited primary care patients with recent intentional weight loss for participation in a weight maintenance program that uses EHR-based tools. We also successfully recruited and trained primary care staff as coaches.
Asunto(s)
Registros Electrónicos de Salud , Atención Primaria de Salud , Humanos , Atención Primaria de Salud/organización & administración , Femenino , Persona de Mediana Edad , Masculino , Registros Electrónicos de Salud/organización & administración , Adulto , Mantenimiento del Peso Corporal , Tutoría/métodos , Tutoría/organización & administración , Anciano , Índice de Masa Corporal , Pérdida de Peso , Adolescente , Programas de Reducción de Peso/métodos , Programas de Reducción de Peso/organización & administraciónRESUMEN
[This corrects the article DOI: 10.1371/journal.pone.0278550.].
RESUMEN
OBJECTIVE: To assess association of pharmacist gender with acceptance of antibiotic stewardship recommendations. DESIGN: A retrospective evaluation of the Reducing Overuse of Antibiotics at Discharge (ROAD) Home intervention. SETTING: The study was conducted from May to October 2019 in a single academic medical center. PARTICIPANTS: The study included patients receiving antibiotics on a hospitalist service who were nearing discharge. METHODS: During the intervention, clinical pharmacists (none who had specialist postgraduate infectious disease residency training) reviewed patients on antibiotics and led an antibiotic timeout (ie, structured conversation) prior to discharge to improve discharge antibiotic prescribing. We assessed the association of pharmacist gender with acceptance of timeout recommendations by hospitalists using logistic regression controlling for patient characteristics. RESULTS: Over 6 months, pharmacists conducted 295 timeouts: 158 timeouts (53.6%) were conducted by 12 women, 137 (46.4%) were conducted by 8 men. Pharmacists recommended an antibiotic change in 82 timeouts (27.8%), of which 51 (62.2%) were accepted. Compared to male pharmacists, female pharmacists were less likely to recommend a discharge antibiotic change: 30 (19.0%) of 158 versus 52 (38.0%) of 137 (P < .001). Female pharmacists were also less likely to have a recommendation accepted: 10 (33.3%) of 30 versus 41 (8.8%) of 52 (P < .001). Thus, timeouts conducted by female versus male pharmacists were less likely to result in an antibiotic change: 10 (6.3%) of 158 versus 41 (29.9%) of 137 (P < .001). After adjustments, pharmacist gender remained significantly associated with whether recommended changes were accepted (adjusted odds ratio [aOR], 0.10; 95%confidence interval [CI], 0.03-0.36 for female versus male pharmacists). CONCLUSIONS: Antibiotic stewardship recommendations made by female clinical pharmacists were less likely to be accepted by hospitalists. Gender bias may play a role in the acceptance of clinical pharmacist recommendations, which could affect patient care and outcomes.
Asunto(s)
Programas de Optimización del Uso de los Antimicrobianos , Médicos Hospitalarios , Humanos , Masculino , Femenino , Farmacéuticos , Antibacterianos/uso terapéutico , Alta del Paciente , Estudios Retrospectivos , SexismoRESUMEN
INTRODUCTION: Few pediatric urologists believe patients require a majority of the doses of opioids prescribed to them postoperatively. Seeking a better understanding of postoperative pain and analgesia in pediatric urology patients may help reduce opioid over prescription while still adequately managing postoperative pain. OBJECTIVE: We sought to better understand: 1) the postoperative pain levels experienced by pediatric urology patients, 2) the factors that correlate with postoperative pain and number of opioids consumed following pediatric urologic procedures, and 3) the patients who do not require opioids after surgery. STUDY DESIGN: Pediatric patients undergoing circumcision, inguinal hernia repair, orchidopexy, or hypospadias repair were eligible to participate. Patients were enrolled in the prospective cohort on the day of the procedure. For each of the first 7 postoperative days, patients' parents completed a text message-based questionnaire, quantifying their child's pain level and the doses of pain medication the child consumed. RESULTS: 165 participants were enrolled. 57 patients underwent circumcision, 54 underwent orchiopexy, 32 underwent hypospadias repair, and 22 underwent inguinal hernia repair. For all procedure types, pain scores (p < 0.01) and doses of oxycodone consumed were highest on postoperative day one and steadily declined thereafter. Overall, average 7-day pain score (2.02; 0.86-5.14) and doses of narcotics consumed (3.50; 0-5) were low. Patients in each surgical subgroup were prescribed narcotics in excess of what was consumed. There was an average excess of 10.9 doses (0-39.0) for hypospadias repair, 8.6 (1.0-30.0) for circumcision, 9.0 (3.0-21.0) for inguinal hernia repair, and 6.1 (0-22.0) for orchiopexy. DISCUSSION: Overall, reported pain scores and number of narcotics consumed were low regardless of surgery type. Opioids were overprescribed regardless of surgery type. CONCLUSIONS: Our findings indicate that level of pain and opioid use varies by procedure type, but that number of narcotics prescribed greatly exceeds number needed.