Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 88
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Proc Natl Acad Sci U S A ; 119(43): e2208506119, 2022 10 25.
Artículo en Inglés | MEDLINE | ID: mdl-36256824

RESUMEN

DNA-damaging treatments such as radiotherapy (RT) have become promising to improve the efficacy of immune checkpoint inhibitors by enhancing tumor immunogenicity. However, accompanying treatment-related detrimental events in normal tissues have posed a major obstacle to radioimmunotherapy and present new challenges to the dose delivery mode of clinical RT. In the present study, ultrahigh dose rate FLASH X-ray irradiation was applied to counteract the intestinal toxicity in the radioimmunotherapy. In the context of programmed cell death ligand-1 (PD-L1) blockade, FLASH X-ray minimized mouse enteritis by alleviating CD8+ T cell-mediated deleterious immune response compared with conventional dose rate (CONV) irradiation. Mechanistically, FLASH irradiation was less efficient than CONV X-ray in eliciting cytoplasmic double-stranded DNA (dsDNA) and in activating cyclic GMP-AMP synthase (cGAS) in the intestinal crypts, resulting in the suppression of the cascade feedback consisting of CD8+ T cell chemotaxis and gasdermin E-mediated intestinal pyroptosis in the case of PD-L1 blocking. Meanwhile, FLASH X-ray was as competent as CONV RT in boosting the antitumor immune response initiated by cGAS activation and achieved equal tumor control in metastasis burdens when combined with anti-PD-L1 administration. Together, the present study revealed an encouraging protective effect of FLASH X-ray upon the normal tissue without compromising the systemic antitumor response when combined with immunological checkpoint inhibitors, providing the rationale for testing this combination as a clinical application in radioimmunotherapy.


Asunto(s)
Neoplasias , Radioinmunoterapia , Ratones , Animales , Rayos X , Piroptosis , Inhibidores de Puntos de Control Inmunológico , Ligandos , Nucleotidiltransferasas/metabolismo
2.
J Am Chem Soc ; 146(21): 14600-14609, 2024 May 29.
Artículo en Inglés | MEDLINE | ID: mdl-38748814

RESUMEN

We constructed a photoanode comprising the homogeneous water oxidation catalyst (WOC) Na8K8[Co9(H2O)6(OH)3(HPO4)2(PW9O34)3] (Co9POM) and nanoporous n-type TiO2 photoelectrodes (henceforth "TiO2-Co9POM") by first anchoring the cationic 3-aminopropyltrimethoxysilane (APS) ligand on a metal oxide light absorber, followed by treatment of the metal oxide-APS with a solution of the polyoxometalate WOC. The resulting TiO2-Co9POM photoelectrode exhibits a 3-fold oxygen evolution photocurrent enhancement compared to bare TiO2 in aqueous acidic conditions. Three-element (Co 2p, W 4f, and O 1s) X-ray photoelectron spectroscopy and Raman spectroscopy studies before and after use indicate that surface-bound Co9POM retains its structural integrity throughout all photoelectrochemical water oxidation studies reported here. Extensive charge-transfer mechanistic studies by photoelectrochemical techniques and transient absorption spectroscopy elucidate that Co9POM serves as an efficient WOC, extracting photogenerated holes from TiO2 on the picosecond time scale. This is the first comprehensive mechanistic investigation elucidating the roles of polyoxometalates in POM-photoelectrode hybrid oxygen evolution reaction systems.

3.
Small ; 20(30): e2400059, 2024 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-38429240

RESUMEN

This work introduces a mixed-transducer micro-origami to achieve efficient vibration, controllable motion, and decoupled sensing. Existing micro-origami systems tend to have only one type of transducer (actuator/sensor), which limits their versatility and functionality because any given transducer system has a narrow range of advantageous working conditions. However, it is possible to harness the benefit of different micro-transducer systems to enhance the performance of functional micro-origami. More specifically, this work introduces a micro-origami system that can integrate the advantages of three transducer systems: strained morph (SM) systems, polymer based electro-thermal (ET) systems, and thin-film lead zirconate titanate (PZT) systems. A versatile photolithography fabrication process is introduced to build this mixed-transducer micro-origami system, and their performance is investigated through experiments and simulation models. This work shows that mixed-transducer micro-origami can achieve power efficient vibration with high frequency, large vibration ranges, and little degradation; can produce decoupled folding motion with good controllability; and can accomplish simultaneous sensing and actuation to detect and interact with external environments and small-scale samples. The superior performance of mixed-transducer micro-origami systems makes them promising tools for micro-manipulation, micro-assembly, biomedical probes, self-sensing metamaterials, and more.

4.
Stem Cells ; 41(1): 11-25, 2023 01 30.
Artículo en Inglés | MEDLINE | ID: mdl-36318802

RESUMEN

As crucial epigenetic regulators, long noncoding RNAs (lncRNAs) play critical functions in development processes and various diseases. However, the regulatory mechanism of lncRNAs in early heart development is still limited. In this study, we identified cardiac mesoderm-related lncRNA (LncCMRR). Knockout (KO) of LncCMRR decreased the formation potential of cardiac mesoderm and cardiomyocytes during embryoid body differentiation of mouse embryonic stem (ES) cells. Mechanistic analyses showed that LncCMRR functionally interacted with the transcription suppressor PURB and inhibited its binding potential at the promoter region of Flk1, which safeguarded the transcription of Flk1 during cardiac mesoderm formation. We also carried out gene ontology term and signaling pathway enrichment analyses for the differentially expressed genes after KO of LncCMRR, and found significant correlation of LncCMRR with cardiac muscle contraction, dilated cardiomyopathy, and hypertrophic cardiomyopathy. Consistently, the expression level of Flk1 at E7.75 and the thickness of myocardium at E17.5 were significantly decreased after KO of LncCMRR, and the survival rate and heart function index of LncCMRR-KO mice were also significantly decreased as compared with the wild-type group. These findings indicated that the defects in early heart development led to functional abnormalities in adulthood heart of LncCMRR-KO mice. Conclusively, our findings elucidate the main function and regulatory mechanism of LncCMRR in cardiac mesoderm formation, and provide new insights into lncRNA-mediated regulatory network of mouse ES cell differentiation.


Asunto(s)
ARN Largo no Codificante , Animales , Ratones , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Ratones Noqueados , Diferenciación Celular/genética , Miocardio , Miocitos Cardíacos , Mesodermo/metabolismo
5.
Plant Dis ; 2024 Jul 06.
Artículo en Inglés | MEDLINE | ID: mdl-38971963

RESUMEN

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

6.
J Appl Clin Med Phys ; 25(6): e14292, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38286001

RESUMEN

BACKGROUND: To determine whether a dual-isocenter volumetrically modulated arc therapy (VMAT) technique results in lower normal pulmonary dosage compared to a traditional single isocenter technique for boot-shaped lung cancer. METHODS: A cohort of 15 patients with advanced peripheral or central lung cancer who had metastases in the mediastinum and supraclavicular lymph nodes was randomly selected for this retrospective study. VMAT plans were generated for each patient using two different beam alignment techniques with the 6-MV flattening filter-free (FFF) photon beam: single-isocenter jaw-tracking VMAT based on the Varian TrueBeam linear accelerator (S-TV), and dual-isocenter VMAT based on both TrueBeam (D-TV) and Halcyon linear accelerator (D-HV). For all 45 treatment plans, planning target volume (PTV) dose coverage, conformity/homogeneity index (CI/HI), mean heart dose (MHD), mean lung dose (MLD) and the total lung tissue receiving 5, 20, 30 Gy (V5, V20, V30) were evaluated. The monitor units (MUs), delivery time, and plan quality assurance (QA) results were recorded. RESULTS: The quality of the objectives of the three plans was comparable to each other. In comparison with S-TV, D-TV and D-HV improved the CI and HI of the PTV (p < 0.05). The MLD was 13.84 ± 1.44 Gy (mean ± SD) for D-TV, 14.22 ± 1.30 Gy and 14.16 ± 1.42 Gy for S-TV and D-HV, respectively. Lungs-V5Gy was 50.78 ± 6.24%, 52.00 ± 7.32% and 53.36 ± 8.48%, Lungs-V20Gy was 23.72 ± 2.27%, 26.18 ± 2.86% and 24.96 ± 3.09%, Lungs-V30Gy was 15.69 ± 1.76%, 17.20 ± 1.72% and 16.52 ± 2.07%. Compared to S-TV, D-TV provided statistically significant better protection for the total lung, with the exception of the lungs-V5. All plans passed QA according the gamma criteria of 3%/3 mm. CONCLUSIONS: Taking into account the dosimetric results and published clinical data on radiation-induced pulmonary injury, dual-isocenter jaw-tracking VMAT may be the optimal choice for treating boot-shaped lung cancer.


Asunto(s)
Estudios de Factibilidad , Neoplasias Pulmonares , Órganos en Riesgo , Dosificación Radioterapéutica , Planificación de la Radioterapia Asistida por Computador , Radioterapia de Intensidad Modulada , Humanos , Radioterapia de Intensidad Modulada/métodos , Planificación de la Radioterapia Asistida por Computador/métodos , Neoplasias Pulmonares/radioterapia , Órganos en Riesgo/efectos de la radiación , Estudios Retrospectivos , Aceleradores de Partículas/instrumentación
7.
J Neurochem ; 167(5): 680-695, 2023 12.
Artículo en Inglés | MEDLINE | ID: mdl-37924268

RESUMEN

Membrane trafficking pathways mediate key microglial activities such as cell migration, cytokine secretion, and phagocytosis. However, the underlying molecular mechanism remains poorly understood. Previously, we found that synaptotagmin-11 (Syt11), a non-Ca2+ -binding Syt associated with Parkinson's disease (PD) and schizophrenia, inhibits cytokine release and phagocytosis in primary microglia. Here we reported the in vivo function of Syt11 in microglial immune responses using an inducible microglia-specific Syt11-conditional-knockout (cKO) mouse strain. Syt11-cKO resulted in activation of microglia and elevated mRNA levels of IL-6, TNF-α, IL-1ß, and iNOS in various brain regions under both resting state and LPS-induced acute inflammation state in adult mice. In a PD mouse model generated by microinjection of preformed α-synuclein fibrils into the striatum, a reduced number of microglia migrated toward the injection sites and an enhanced phagocytosis of α-synuclein fibrils by microglia were found in Syt11-cKO mice. To understand the molecular mechanism of Syt11 function, we identified its direct binding proteins vps10p-tail-interactor-1a (vti1a) and vti1b. The linker domain of Syt11 interacted with both proteins and a peptide derived from it competitively inhibited the interaction of Syt11 with vti1a/vti1b in vitro and in cells. Importantly, application of this peptide induced more cytokine secretion in wild-type microglia upon LPS treatment, phenocopying defects in Syt11 knockdown cells. Altogether, we propose that Syt11 inhibits microglial activation in vivo and regulates cytokine secretion through interactions with vti1a and vti1b.


Asunto(s)
Enfermedad de Parkinson , alfa-Sinucleína , Animales , Ratones , alfa-Sinucleína/metabolismo , Citocinas/metabolismo , Lipopolisacáridos/farmacología , Microglía/metabolismo , Enfermedad de Parkinson/metabolismo , Fagocitosis , Sinaptotagminas/genética
8.
Plant Dis ; 2023 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-36724032

RESUMEN

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it's more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

9.
J Appl Clin Med Phys ; 24(11): e14096, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37469242

RESUMEN

PURPOSE: To study the improved rotational robustness by using joint learning of spatially-correlated organ segmentation (SCOS) for thoracic organ delineation. The network structure is not our point. METHODS: The SCOS was implemented in a U-net-like model (abbr. SCOS-net) and evaluated on unseen rotated test sets. Two hundred sixty-seven patients with thoracic tumors (232 without rotation and 35 with rotation) were enrolled. The training and validation images came from 61 randomly chosen unrotated patients. The test data included two sets. One consisted of 3000 slices from the rest 171 unrotated patients. They were rotated by us by -30°âˆ¼30°. One was the images from the 35 rotated patients. The lung, heart, and spinal cord were delineated by experienced radiation oncologists and regarded as ground truth. The SCOS-net was compared with its single-task learning counterparts, two published multiple learning task settings, and rotation augmentation. Dice, 3 distance metrics (maximum and 95th percentile of Hausdorff distances and average surface distance (ASD)) and the number of cases where ASD = infinity were adopted. We analyzed the results using visualization techniques. RESULTS: In terms of no augmentation, the SCOS-net achieves the best lung and spinal cord segmentations and comparable heart delineation. With augmentation, SCOS performs better in some cases. CONCLUSION: The proposed SCOS can improve rotational robustness, and is promising in clinical applications for its low network capacity and computational cost.


Asunto(s)
Procesamiento de Imagen Asistido por Computador , Tórax , Humanos , Procesamiento de Imagen Asistido por Computador/métodos , Corazón/diagnóstico por imagen , Pulmón , Planificación de la Radioterapia Asistida por Computador/métodos
10.
J Insect Sci ; 23(2)2023 Mar 01.
Artículo en Inglés | MEDLINE | ID: mdl-37083941

RESUMEN

Pachyrhinus yasumatsui Kono et Morimoto is a major pest of Chinese jujube, which is widespread in northern China and causes severe economic losses in the jujube industry. Chemosensory genes play crucial roles in insect behaviors. Currently, little is known about chemosensory genes in P. yasumatsui. In the present study, antennal transcriptomes of female and male adult P. yasumatsui were annotated. In total, 113 genes involved in chemosensory functions were identified, including 41 odorant receptors, 28 odorant-binding proteins, 16 ionotropic receptors, 15 chemosensory proteins, 9 gustatory receptors, and 4 sensory neuron membrane proteins. Subsequently, the phylogenetic analyses of these olfactory-related proteins in P. yasumatsui were conducted using multiple sequence alignment. Furthermore, sex-specific expression levels of 113 genes were analyzed based on fragments per kilobase of transcript per million mapped reads (FPKM). Then, the quantitative real-time PCR (RT-qPCR) was used to quantify gene expression profiles of 28 P. yasumatsui OBPs (PyasOBPs) and 15 CSPs (PyasCSPs). The results revealed that 20 PyasOBPs and 13 PyasCSPs exhibited significantly higher expression in the antennae than in the bodies, suggesting that they might have functions in olfaction. Moreover, some OBPs and CSPs (PyasOBP6, PyasOBP7, PyasOBP16, PyasOBP21, and PyasCSP4) exhibited female-biased expression, indicating that they might take part in several female-specific behaviors. This study will promote the understanding of olfactory mechanism in P. yasumatsui, and our findings lay the groundwork for developing environmentally friendly pest management measures.


Asunto(s)
Escarabajos , Proteínas de Drosophila , Receptores Odorantes , Gorgojos , Femenino , Masculino , Animales , Transcriptoma , Escarabajos/genética , Gorgojos/genética , Gorgojos/metabolismo , Perfilación de la Expresión Génica , Filogenia , Proteínas de Insectos/genética , Proteínas de Insectos/metabolismo , Receptores Odorantes/genética , Receptores Odorantes/metabolismo , Proteínas de Drosophila/genética , Antenas de Artrópodos/metabolismo
11.
Nano Lett ; 22(2): 783-791, 2022 01 26.
Artículo en Inglés | MEDLINE | ID: mdl-35005958

RESUMEN

In situ monitoring of tissue regeneration progression is of primary importance to basic medical research and clinical transformation. Despite significant progress in the field of tissue engineering and regenerative medicine, few technologies have been established to in situ inspect the regenerative process. Here, we present an integrated second near-infrared (NIR-II, 1000-1700 nm) window in vivo imaging strategy based on 3D-printed bioactive glass scaffolds doped with NIR-II ratiometric lanthanide-dye hybrid nanoprobes, allowing for in situ monitoring of the early inflammation, angiogenesis, and implant degradation during mouse skull repair. The functional bioactive glass scaffolds contribute to more effective bone regeneration because of their excellent angiogenic and osteogenic activities. The reliability of ratiometric fluorescence imaging, coupled with low autofluoresence in the NIR-II window, facilitates the accuracy of in vivo inflammation detection and high-resolution visualization of neovascularization and implant degradation in deep tissue.


Asunto(s)
Elementos de la Serie de los Lantanoides , Animales , Regeneración Ósea , Ratones , Imagen Óptica/métodos , Reproducibilidad de los Resultados , Ingeniería de Tejidos
12.
Angew Chem Int Ed Engl ; 62(23): e202301696, 2023 06 05.
Artículo en Inglés | MEDLINE | ID: mdl-37052894

RESUMEN

Early diagnosis of allograft rejection helps to improve the immune-related management of transplant recipients. The clinically-used core needle biopsy method is invasive and subject to sampling error. In vivo fluorescence imaging for monitoring immune-related processes has the advantages of non-invasiveness, fast feedback and high sensitivity. Herein, we report a responsive second near-infrared (NIR-II) fluorescent nanosensor (ErGZ) to detect early allograft rejection. ErGZ allows ratiometric in vivo fluorescence sensing of granzyme B, which is overexpressed in recipients' T cells during the onset of rejection. The sensor demonstrates efficacious detection of allograft rejection with high sensitivity and specificity, which accomplishes non-invasive diagnosis of rejection in skin and deep buried islets transplant mice models 2 d and 5 d earlier than biopsy, by in vivo fluorescence imaging and urinary detection, respectively, providing a valuable approach for therapeutical management.


Asunto(s)
Linfocitos T , Ratones , Animales , Granzimas , Trasplante Homólogo , Biopsia , Aloinjertos
13.
Anal Chem ; 94(8): 3661-3668, 2022 03 01.
Artículo en Inglés | MEDLINE | ID: mdl-35175033

RESUMEN

Multiplexed imaging in the second near-infrared (NIR-II, 1000-1700 nm) window, with much reduced tissue scattering and autofluorescence background noises, could offer comprehensive information for studying biological processes and accurate diagnosis. A critical requirement for harvesting the full potential of multiplexing is to develop fluorescent probes with emission profiles specifically tuned at distinct excitations toward their target applications. However, the lack of versatile probes with separated signals in this NIR-II window hinders the potential of in vivo multiplexed imaging. In this study, we designed three types of Nd3+-, Ho3+-, and Er3+-based down-shifting nanoparticles (DSNPs) with core-shell structures (csNd, csHo, and csEr). Excitation wavelengths of these nanoparticles were first screened and confirmed at 730, 915, and 655 nm. Under the new excitations, orthogonal three-color emissions in the NIR-II window (1060, 1180, and 1525 nm for csNd, csHo, and csEr, respectively) were efficiently achieved. These excitation-selective DSNPs were then demonstrated to be promising in encrypted anticounterfeiting applications with increased optical codes. By programmed administration of the DSNPs, anatomical rotation imaging can also be successfully performed to differentiate mouse bones, stomach, and blood vessels with high contrast and resolution in a fixed NIR-II channel (>1000 nm) by only switching the excitation wavelengths. This study suggests that the designed NIR-II excitation-selective DSNPs with orthogonal emissions may offer a powerful framework for spatially multiplexed imaging in biological and life sciences.


Asunto(s)
Elementos de la Serie de los Lantanoides , Nanopartículas , Animales , Diagnóstico por Imagen , Colorantes Fluorescentes , Elementos de la Serie de los Lantanoides/química , Ratones , Nanopartículas/química , Imagen Óptica/métodos
14.
Plant Dis ; 2022 Mar 09.
Artículo en Inglés | MEDLINE | ID: mdl-35263157

RESUMEN

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

15.
Plant Dis ; 2022 Apr 22.
Artículo en Inglés | MEDLINE | ID: mdl-35452253

RESUMEN

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) µm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) µm, stylet = 11.11 ± 0.73 (10.05-12.29) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) µm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) µm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) µm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) µm, BW = 28.44 ± 1.18 (26.59-29.83) µm, stylet = 18.27 ± 0.97 (16.57-19.28) µm, DGO = 4.89 ± 0.62 (3.82-5.68) µm, and spicule length = 24.04 ± 1.80 (21.30-26.71) µm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) µm, BW = 13.94 ± 0.70 (12.88-15.34) µm, stylet = 11.82 ± 0.49 (10.96-12.61) µm, DGO = 3.68 ± 0.42 (3.09-4.56) µm, tail length = 55.42 ± 5.81 (46.97-67.03) µm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) µm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

16.
Angew Chem Int Ed Engl ; 61(5): e202114273, 2022 01 26.
Artículo en Inglés | MEDLINE | ID: mdl-34850517

RESUMEN

Early detection of kidney disease is of vital importance due to its current prevalence worldwide. Fluorescence imaging, especially in the second near-infrared window (NIR-II) has been regarded as a promising technique for the early diagnosis of kidney disease due to the superior resolution and sensitivity. However, the reported NIR-II organic renal-clearable probes are hampered by their low brightness (ϵmax Φf>1000 nm <10 M-1 cm-1 ) and limited blood circulation time (t1/2 <2 h), which impede the targeted imaging performance. Herein, we develop the aza-boron-dipyrromethene (aza-BODIPY) brush macromolecular probes (Fudan BDIPY Probes (FBP 912)) with high brightness (ϵmax Φf>1000 nm ≈60 M-1 cm-1 ), which is about 10-fold higher than that of previously reported NIR-II renal-clearable organic probes. FBP 912 exhibits an average diameter of ≈4 nm and high renal clearance efficiency (≈65 % excretion through the kidney within 12 h), showing superior performance for non-invasively diagnosis of renal ischemia-reperfusion injury (RIR) earlier than clinical serum-based protocols. Additionally, the high molecular weight polymer brush enables FBP 912 with prolonged circulation time (t1/2 ≈6.1 h) and higher brightness than traditional PEGylated renal-clearable control fluorophores (t1/2 <2 h), facilitating for 4T1 tumor passive targeted imaging and renal cell carcinoma active targeted imaging with higher signal-to-noise ratio and extended retention time.


Asunto(s)
Tiempo de Circulación Sanguínea
17.
Stem Cells ; 38(7): 834-848, 2020 07.
Artículo en Inglés | MEDLINE | ID: mdl-32277787

RESUMEN

Large intergenic noncoding RNAs (lincRNAs) in ESCs may play an important role in the maintenance of pluripotency. The identification of stem cell-specific lincRNAs and their interacting partners will deepen our understanding of the maintenance of stem cell pluripotency. We identified a lincRNA, LincQ, which is specifically expressed in ESCs and is regulated by core pluripotent transcription factors. It was rapidly downregulated during the differentiation process. Knockdown of LincQ in ESCs led to differentiation, downregulation of pluripotency-related genes, and upregulation of differentiation-related genes. We found that exon 1 of LincQ can specifically bind to Sox2. The Soxp region in Sox2, rather than the high mobility group domain, is responsible for LincQ binding. Importantly, the interaction between LincQ and Sox2 is required for the maintenance of pluripotency in ESCs and the transcription of pluripotency genes. Esrrb and Tfcp2l1 are key downstream targets of LincQ and Sox2, since overexpression of Esrrb and Tfcp2l1 can restore the loss of ESC pluripotency that is induced by LincQ depletion. In summary, we found that LincQ specifically interacts with Sox2 and contributes to the maintenance of pluripotency, highlighting the critical role of lincRNA in the pluripotency regulatory network.


Asunto(s)
Células Madre Embrionarias de Ratones , ARN Largo no Codificante , Animales , Diferenciación Celular/genética , Células Madre Embrionarias/metabolismo , Ratones , Células Madre Embrionarias de Ratones/metabolismo , Factor 3 de Transcripción de Unión a Octámeros/metabolismo , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , Factores de Transcripción SOXB1/genética , Factores de Transcripción SOXB1/metabolismo , Factores de Transcripción/metabolismo
18.
Stem Cells ; 2020 Sep 30.
Artículo en Inglés | MEDLINE | ID: mdl-32997855

RESUMEN

Embryonic stem (ES) cells have the property of self-renewal and multi-directional differentiation, and provide an ideal model for studying early embryo development in vitro. Wnt3, as Wnt family member 3, plays a vital role during ES cell differentiation. However, the exact regulatory mechanism of Wnt3 remains to be elucidated. MicroRNAs can directly regulate gene expression at the post-transcriptional level and play critical function in cell fate determination. Here, we found the expression level of miR-184 decreased when ES cells differentiated into cardiac mesoderm then increased during the process as differentiated into cardiomyocytes, which negatively correlated with the expression of Wnt3. Overexpression of miR-184 during the process of ES cell differentiation into cardiac mesoderm repressed cardiac mesoderm differentiation and cardiomyocyte formation. Bioinformatics prediction and mechanism studies showed that miR-184 directly bound to the 3'UTR region of Wnt3 and inhibited the expression level of Wnt3. Consistently, knockdown of Wnt3 mimicked the effects of miR-184-overexpression on ES cell differentiation into cardiac mesoderm, whereas overexpression of Wnt3 rescued the inhibition effects of miR-184 overexpression on ES cell differentiation. These findings demonstrated that miR-184 is a direct regulator of Wnt3 during the differentiation process of ES cells, further enriched the epigenetic regulatory network of ES cell differentiation into cardiac mesoderm and cardiomyocytes.

19.
Stem Cells ; 38(3): 340-351, 2020 03.
Artículo en Inglés | MEDLINE | ID: mdl-31778238

RESUMEN

Embryonic stem cells (ESCs) have self-renewal and multi-lineage differentiation potential and perform critical functions in development and biomedicine. Several long noncoding RNAs (lncRNAs) have been reported as key regulators of stem cell pluripotency and differentiation. However, the function and regulatory mechanism of lncRNAs during the initiation of ESC differentiation remains unclear. Here, we found that linc1557 was highly expressed in mouse ESCs and required for the initiation of ESC differentiation. Knockdown of linc1557 increased the expression and phosphorylation levels of signal transducer and activator of transcription 3 (STAT3), a key factor in the leukemia inhibitory factor (LIF)/STAT3 signaling pathway. Furthermore, we found that linc1557 directly bound to Stat3 mRNA and affected its stability. The differentially expressed transcriptome after linc1557 knockdown in ESCs was involved primarily in multicellular organism development and cell differentiation as similar to that after Stat3 knockdown. Moreover, either knockdown of Stat3 or addition of a LIF/STAT3 signaling inhibitor rescued the suppressive effects of linc1557 knockdown on the initiation of mouse ESC differentiation. These findings not only elucidated the critical function of linc1557 in the initiation of mouse ESC differentiation but also clarified that its specific mechanism as directly affecting Stat3 mRNA stability, which enhanced the understanding of the lncRNA-mediated regulatory mechanism for mRNA stability and key signaling pathways in ESC pluripotency and differentiation.


Asunto(s)
Factor Inhibidor de Leucemia/metabolismo , Células Madre Embrionarias de Ratones/metabolismo , Animales , Diferenciación Celular , Ratones , Factor de Transcripción STAT3 , Transducción de Señal
20.
Exp Lung Res ; 47(6): 261-279, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-33908819

RESUMEN

PURPOSE: Non-small lung (NSCLC) is the deadliest cancer, with survival measured in months. Earlier diagnosis using a robust biomarker would likely improve survival. This study aims to determine whether blood levels of the extracellular sulfatases (SULF1 and SULF2) and their bio-activity can serve as novel biomarkers for NSCLC early detection. MATERIALS AND METHODS: Using human plasma specimens from NSCLC patients, nonmalignant COPD patients, and healthy individuals, we determined the association between plasma SULF levels and the presence of NSCLC. We assessed the plasma SULF levels as a function of sex and age. We also evaluated the plasma levels of heparin-binding factors potentially mobilized by the SULFs. To increase test specificity of blood SULF2 as a biomarker for the early diagnosis of NSCLC, we investigated the presence of a tumor-specific SULF2 isoform released in the blood, which could be used as a biomarker alone or in multiplex assays. RESULTS: The median level of plasma SULF2 was significantly elevated in NSCLC patients than in healthy controls (∼2 fold). However, these data were confounded by age. Surprisingly, COPD patients also showed a dramatically increased SULF2 plasma level. We showed a significant increase in the median plasma levels of several HSPG-binding factors in early-stage NSCLC patients compared to controls. Furthermore, we revealed a significant positive correlation of the SULF2 protein level with the plasma levels of two HSPG-binding factors IL6 and IL8. We demonstrated that NSCLC cancer cells and tissues overexpress a SULF2 splice variant. We determined the presence of a SULF2 splice variant form in NSCLC plasma, which was not detectable in COPD and control plasmas. CONCLUSION: Our findings highlight the potential for the plasma levels of SULF2 protein and its bio-activity as novel blood biomarkers for early diagnosis of NSCLC.


Asunto(s)
Neoplasias Pulmonares , Sulfatasas/sangre , Biomarcadores/sangre , Detección Precoz del Cáncer , Humanos , Neoplasias Pulmonares/diagnóstico
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA