JGI Plant Gene Atlas: an updateable transcriptome resource to improve functional gene descriptions across the plant kingdom.

Gene functional descriptions offer a crucial line of evidence for candidate genes underlying trait variation. Conversely, plant responses to environmental cues represent important resources to decipher gene function and subsequently provide molecular targets for plant improvement through gene editing. However, biological roles of large proportions of genes across the plant phylogeny are poorly annotated. Here we describe the Joint Genome Institute (JGI) Plant Gene Atlas, an updateable data resource consisting of transcript abundance assays spanning 18 diverse species. To integrate across these diverse genotypes, we analyzed expression profiles, built gene clusters that exhibited tissue/condition specific expression, and tested for transcriptional response to environmental queues. We discovered extensive phylogenetically constrained and condition-specific expression profiles for genes without any previously documented functional annotation. Such conserved expression patterns and tightly co-expressed gene clusters let us assign expression derived additional biological information to 64 495 genes with otherwise unknown functions. The ever-expanding Gene Atlas resource is available at JGI Plant Gene Atlas (https://plantgeneatlas.jgi.doe.gov) and Phytozome (https://phytozome.jgi.doe.gov/), providing bulk access to data and user-specified queries of gene sets. Combined, these web interfaces let users access differentially expressed genes, track orthologs across the Gene Atlas plants, graphically represent co-expressed genes, and visualize gene ontology and pathway enrichments.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Drought stress-inducible synthetic promoters designed for poplar are functional in rice.

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

Engineered gamma radiation phytosensors for environmental monitoring.

Nuclear energy, already a practical solution for supplying energy on a scale similar to fossil fuels, will likely increase its footprint over the next several decades to meet current climate goals. Gamma radiation is produced during fission in existing nuclear reactors and thus the need to detect leakage from nuclear plants, and effects of such leakage on ecosystems will likely also increase. At present, gamma radiation is detected using mechanical sensors that have several drawbacks, including: (i) limited availability; (ii) reliance on power supply; and (iii) requirement of human presence in dangerous areas. To overcome these limitations, we have developed a plant biosensor (phytosensor) to detect low-dose ionizing radiation. The system utilizes synthetic biology to engineer a dosimetric switch into potato utilizing the plant's native DNA damage response (DDR) machinery to produce a fluorescent output. In this work, the radiation phytosensor was shown to respond to a wide range of gamma radiation exposure (10-80 Grey) producing a reporter signal that was detectable at >3 m. Further, a pressure test of the top radiation phytosensor in a complex mesocosm demonstrated full function of the system in a 'real world' scenario.

Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements.

Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

Association mapping, transcriptomics, and transient expression identify candidate genes mediating plant-pathogen interactions in a tree.

Invasive microbes causing diseases such as sudden oak death negatively affect ecosystems and economies around the world. The deployment of resistant genotypes for combating introduced diseases typically relies on breeding programs that can take decades to complete. To demonstrate how this process can be accelerated, we employed a genome-wide association mapping of ca 1,000 resequenced Populus trichocarpa trees individually challenged with Sphaerulina musiva, an invasive fungal pathogen. Among significant associations, three loci associated with resistance were identified and predicted to encode one putative membrane-bound L-type receptor-like kinase and two receptor-like proteins. A susceptibility-associated locus was predicted to encode a putative G-type D-mannose-binding receptor-like kinase. Multiple lines of evidence, including allele analysis, transcriptomics, binding assays, and overexpression, support the hypothesized function of these candidate genes in the P. trichocarpa response to S. musiva.

PdWND3A, a wood-associated NAC domain-containing protein, affects lignin biosynthesis and composition in Populus.

BACKGROUND: Plant secondary cell wall is a renewable feedstock for biofuels and biomaterials production. Arabidopsis VASCULAR-RELATED NAC DOMAIN (VND) has been demonstrated to be a key transcription factor regulating secondary cell wall biosynthesis. However, less is known about its role in the woody species. RESULTS: Here we report the functional characterization of Populus deltoides WOOD-ASSOCIATED NAC DOMAIN protein 3 (PdWND3A), a sequence homolog of Arabidopsis VND4 and VND5 that are members of transcription factor networks regulating secondary cell wall biosynthesis. PdWND3A was expressed at higher level in the xylem than in other tissues. The stem tissues of transgenic P. deltoides overexpressing PdWND3A (OXPdWND3A) contained more vessel cells than that of wild-type plants. Furthermore, lignin content and lignin monomer syringyl and guaiacyl (S/G) ratio were higher in OXPdWND3A transgenic plants than in wild-type plants. Consistent with these observations, the expression of FERULATE 5-HYDROXYLASE1 (F5H1), encoding an enzyme involved in the biosynthesis of sinapyl alcohol (S unit monolignol), was elevated in OXPdWND3A transgenic plants. Saccharification analysis indicated that the rate of sugar release was reduced in the transgenic plants. In addition, OXPdWND3A transgenic plants produced lower amounts of biomass than wild-type plants. CONCLUSIONS: PdWND3A affects lignin biosynthesis and composition and negatively impacts sugar release and biomass production.

Genome-wide association studies and expression-based quantitative trait loci analyses reveal roles of HCT2 in caffeoylquinic acid biosynthesis and its regulation by defense-responsive transcription factors in Populus.

3-O-caffeoylquinic acid, also known as chlorogenic acid (CGA), functions as an intermediate in lignin biosynthesis in the phenylpropanoid pathway. It is widely distributed among numerous plant species and acts as an antioxidant in both plants and animals. Using GC-MS, we discovered consistent and extreme variation in CGA content across a population of 739 4-yr-old Populus trichocarpa accessions. We performed genome-wide association studies (GWAS) from 917 P. trichocarpa accessions and expression-based quantitative trait loci (eQTL) analyses to identify key regulators. The GWAS and eQTL analyses resolved an overlapped interval encompassing a hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl transferase 2 (PtHCT2) that was significantly associated with CGA and partially characterized metabolite abundances. PtHCT2 leaf expression was significantly correlated with CGA abundance and it was regulated by cis-eQTLs containing W-box for WRKY binding. Among all nine PtHCT homologs, PtHCT2 is the only one that responds to infection by the fungal pathogen Sphaerulina musiva (a Populus pathogen). Validation using protoplast-based transient expression system suggests that PtHCT2 is regulated by the defense-responsive WRKY. These results are consistent with reports of CGA functioning as an antioxidant in response to biotic stress. This study provides insights into data-driven and omics-based inference of gene function in woody species.

Selective sets of mRNAs localize to extracellular paramural bodies in a rice glup6 mutant.

The transport of rice glutelin storage proteins to the storage vacuoles requires the Rab5 GTPase and its related guanine nucleotide exchange factor (Rab5-GEF). Loss of function of these membrane vesicular trafficking factors results in the initial secretion of storage proteins and later their partial engulfment by the plasma membrane to form an extracellular paramural body (PMB), an aborted endosome complex. Here, we show that in the rice Rab5-GEF mutant glup6, glutelin RNAs are specifically mislocalized from their normal location on the cisternal endoplasmic reticulum (ER) to the protein body-ER, and are also apparently translocated to the PMBs. We substantiated the association of mRNAs with this aborted endosome complex by RNA-seq of PMBs purified by flow cytometry. Two PMB-associated groups of RNA were readily resolved: those that were specifically enriched in this aborted complex and those that were highly expressed in the cytoplasm. Examination of the PMB-enriched RNAs indicated that they were not a random sampling of the glup6 transcriptome but, instead, encompassed only a few functional mRNA classes. Although specific autophagy is also an alternative mechanism, our results support the view that RNA localization may co-opt membrane vesicular trafficking, and that many RNAs that share function or intracellular location are co-transported in developing rice seeds.

Genome-wide analysis of lectin receptor-like kinases in Populus.

BACKGROUND: Receptor-like kinases (RLKs) belong to a large protein family with over 600 members in Arabidopsis and over 1000 in rice. Among RLKs, the lectin receptor-like kinases (LecRLKs) possess a characteristic extracellular carbohydrate-binding lectin domain and play important roles in plant development and innate immunity. There are 75 and 173 LecRLKs in Arabidopsis and rice, respectively. However, little is known about LecRLKs in perennial woody plants. RESULTS: Here we report the genome-wide analysis of classification, domain architecture and expression of LecRLKs in the perennial woody model plant Populus. We found that the LecRLK family has expanded in Populus to a total of 231, including 180 G-type, 50 L-type and 1 C-type LecRLKs. Expansion of the Populus LecRLKs (PtLecRLKs) occurred partially through tandem duplication. Based on domain architecture and orientation features, we classified PtLecRLKs into eight different classes. RNA-seq-based transcriptomics analysis revealed diverse expression patterns of PtLecRLK genes among leaves, stems, roots, buds and reproductive tissues and organs. CONCLUSIONS: This study offers a comprehensive view of LecRLKs in the perennial woody model plant Populus and provides a foundation for functional characterization of this important family of receptor-like kinases.

Multiple RNA binding protein complexes interact with the rice prolamine RNA cis-localization zipcode sequences.

RNAs for the storage proteins, glutelins and prolamines, contain zipcode sequences, which target them to specific subdomains of the cortical endoplasmic reticulum in developing rice (Oryza sativa) seeds. Fifteen RNA binding proteins (RBPs) specifically bind to the prolamine zipcode sequences and are likely to play an important role in the transport and localization of this storage protein RNA. To understand the underlying basis for the binding of multiple protein species to the prolamine zipcode sequences, the relationship of five of these RBPs, RBP-A, RBP-I, RBP-J, RBP-K, and RBP-Q, were studied. These five RBPs, which belong to the heterogeneous nuclear ribonucleoprotein class, bind specifically to the 5' coding regions as well as to the 3' untranslated region zipcode RNAs but not to a control RNA sequence. Coimmunoprecipitation-immunoblot analyses in the presence or absence of ribonuclease showed that these five RBPs are assembled into three multiprotein complexes to form at least two zipcode RNA-protein assemblies. One cytoplasmic-localized zipcode assembly contained two multiprotein complexes sharing a common core consisting of RBP-J and RBP-K and either RBP-A (A-J-K) or RBP-I (I-J-K). A second zipcode assembly of possibly nuclear origin consists of a multiprotein complex containing RBP-Q and modified forms of the other protein complexes. These results suggest that prolamine RNA transport is initiated in the nucleus to form a zipcode-protein assembly, which is remodeled in the cytoplasm to target the RNA to its proper location on the cortical endoplasmic reticulum.

Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation.

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

Genome-Editing of FtsZ1 for Alteration of Starch Granule Size in Potato Tubers.

Genome-editing has enabled rapid improvement for staple food crops, such as potato, a key beneficiary of the technology. In potato, starch contained within tubers represents the primary product for use in food and non-food industries. Starch granules are produced in the plastids of tubers with plastid size correlated with the size of starch grana. The division of plastids is controlled by proteins, including the tubulin-like GTPase FtsZ1. The altered expression of FtsZ1 has been shown to disrupt plastid division, leading to the production of "macro-plastid"-containing plants. These macro-chloroplast plants are characterized by cells containing fewer and enlarged plastids. In this work, we utilize CRISPR/Cas9 to generate FtsZ1 edited potato lines to demonstrate that genome-editing can be used to increase the size of starch granules in tubers. Altered plastid morphology was comparable to the overexpression of FtsZ1 in previous work in potato and other crops. Several lines were generated with up to a 1.98-fold increase in starch granule size that was otherwise phenotypically indistinguishable from wild-type plants. Further, starch paste from one of the most promising lines showed a 2.07-fold increase in final viscosity. The advantages of enlarged starch granules and the potential of CRISPR/Cas9-based technologies for food crop improvement are further discussed.

Effects of mutations in the Arabidopsis Cold Shock Domain Protein 3 (AtCSP3) gene on leaf cell expansion.

The cold shock domain is among the most evolutionarily conserved nucleic acid binding domains from prokaryotes to higher eukaryotes, including plants. Although eukaryotic cold shock domain proteins have been extensively studied as transcriptional and post-transcriptional regulators during various developmental processes, their functional roles in plants remains poorly understood. In this study, AtCSP3 (At2g17870), which is one of four Arabidopsis thaliana c old s hock domain proteins (AtCSPs), was functionally characterized. Quantitative RT-PCR analysis confirmed high expression of AtCSP3 in reproductive and meristematic tissues. A homozygous atcsp3 loss-of-function mutant exhibits an overall reduced seedling size, stunted and orbicular rosette leaves, reduced petiole length, and curled leaf blades. Palisade mesophyll cells are smaller and more circular in atcsp3 leaves. Cell size analysis indicated that the reduced size of the circular mesophyll cells appears to be generated by a reduction of cell length along the leaf-length axis, resulting in an orbicular leaf shape. It was also determined that leaf cell expansion is impaired for lateral leaf development in the atcsp3 loss-of-function mutant, but leaf cell proliferation is not affected. AtCSP3 loss-of-function resulted in a dramatic reduction of LNG1 transcript, a gene that is involved in two-dimensional leaf polarity regulation. Transient subcellular localization of AtCSP3 in onion epidermal cells confirmed a nucleocytoplasmic localization pattern. Collectively, these data suggest that AtCSP3 is functionally linked to the regulation of leaf length by affecting LNG1 transcript accumulation during leaf development. A putative function of AtCSP3 as an RNA binding protein is also discussed in relation to leaf development.

Plant synthetic biology innovations for biofuels and bioproducts.

Plant-based biosynthesis of fuels, chemicals, and materials promotes environmental sustainability, which includes decreases in greenhouse gas emissions, water pollution, and loss of biodiversity. Advances in plant synthetic biology (synbio) should improve precision and efficacy of genetic engineering for sustainability. Applicable synbio innovations include genome editing, gene circuit design, synthetic promoter development, gene stacking technologies, and the design of environmental sensors. Moreover, recent advancements in developing spatially resolved and single-cell omics contribute to the discovery and characterization of cell-type-specific mechanisms and spatiotemporal gene regulations in distinct plant tissues for the expression of cell- and tissue-specific genes, resulting in improved bioproduction. This review highlights recent plant synbio progress and new single-cell molecular profiling towards sustainable biofuel and biomaterial production.

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba).

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

Overexpression of AtCSP4 affects late stages of embryo development in Arabidopsis.

Eukaryotic cold shock domain proteins are nucleic acid-binding proteins that are involved in transcription, translation via RNA chaperone activity, RNA editing, and DNA repair during tissue developmental processes and stress responses. Cold shock domain proteins have been functionally implicated in important developmental transitions, including embryogenesis, in both animals and plants. Arabidopsis thaliana cold shock domain protein 4 (AtCSP4) contains a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. Interestingly, a T-DNA insertion atcsp4 mutant does not exhibit any morphological abnormalities, suggesting that the related AtCSP2 gene is functionally redundant with AtCSP4. During silique development, AtCSP4 overexpression induced early browning and shrunken seed formation beginning with the late heart embryo stage. A 50% segregation ratio of the defective seed phenotype was consistent with the phenotype of endosperm development gene mutants. Transcripts of FUS3 and LEC1 genes, which regulate early embryo formation, were not altered in the AtCSP4 overexpression lines. On the other hand, MEA and FIS2 transcripts, which are involved in endosperm development, were affected by AtCSP4 overexpression. Additionally, AtCSP4 overexpression resulted in up-regulation of several MADS-box genes (AP1, CAL, AG, and SHP2) during early stages of silique development. Collectively, these data suggest that AtCSP4 plays an important role during the late stages of silique development by affecting the expression of several development-related genes.

Novel Candidate Genes Differentially Expressed in Glyphosate-Treated Horseweed (Conyza canadensis).

The evolution of herbicide-resistant weed species is a serious threat for weed control. Therefore, we need an improved understanding of how gene regulation confers herbicide resistance in order to slow the evolution of resistance. The present study analyzed differentially expressed genes after glyphosate treatment on a glyphosate-resistant Tennessee ecotype (TNR) of horseweed (Conyza canadensis), compared to a susceptible biotype (TNS). A read size of 100.2 M was sequenced on the Illumina platform and subjected to de novo assembly, resulting in 77,072 gene-level contigs, of which 32,493 were uniquely annotated by a BlastX alignment of protein sequence similarity. The most differentially expressed genes were enriched in the gene ontology (GO) term of the transmembrane transport protein. In addition, fifteen upregulated genes were identified in TNR after glyphosate treatment but were not detected in TNS. Ten of these upregulated genes were transmembrane transporter or kinase receptor proteins. Therefore, a combination of changes in gene expression among transmembrane receptor and kinase receptor proteins may be important for endowing non-target-site glyphosate-resistant C. canadensis.

Transcriptomic Analysis Identifies New Non-Target Site Glyphosate-Resistance Genes in Conyza bonariensis.

Conyza bonariensis (hairy fleabane) is one of the most problematic and widespread glyphosate-resistant weeds in the world. This highly competitive weed species significantly interferes with crop growth and substantially decreases crop yield. Despite its agricultural importance, the molecular mechanisms of glyphosate resistance are still unknown. The present RNA-Seq study was performed with the goal of identifying differentially expressed candidate transcripts (genes) related to metabolism-based non-target site glyphosate resistance in C. bonariensis. The whole-transcriptome was de novo assembled from glyphosate-resistant and -sensitive biotypes of C. bonariensis from Southern Brazil. The RNA was extracted from untreated and glyphosate-treated plants at several timepoints up to 288 h after treatment in both biotypes. The transcriptome assembly produced 90,124 contigs with an average length of 777 bp and N50 of 1118 bp. In response to glyphosate treatment, differential gene expression analysis was performed on glyphosate-resistant and -sensitive biotypes. A total of 9622 genes were differentially expressed as a response to glyphosate treatment in both biotypes, 4297 (44.6%) being up- and 5325 (55.4%) down-regulated. The resistant biotype presented 1770 up- and 2333 down-regulated genes while the sensitive biotype had 2335 and 2800 up- and down-regulated genes, respectively. Among them, 974 up- and 1290 down-regulated genes were co-expressed in both biotypes. In the present work, we identified 41 new candidate target genes from five families related to herbicide transport and metabolism: 19 ABC transporters, 10 CYP450s, one glutathione S-transferase (GST), five glycosyltransferases (GT), and six genes related to antioxidant enzyme catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD). The candidate genes may participate in metabolic-based glyphosate resistance via oxidation, conjugation, transport, and degradation, plus antioxidation. One or more of these genes might 'rescue' resistant plants from irreversible damage after glyphosate treatment. The 41 target genes we report in the present study may inform further functional genomics studies, including gene editing approaches to elucidate glyphosate-resistance mechanisms in C. bonariensis.

Mediation of plant-mycorrhizal interaction by a lectin receptor-like kinase.

The molecular mechanisms underlying mycorrhizal symbioses, the most ubiquitous and impactful mutualistic plant-microbial interaction in nature, are largely unknown. Through genetic mapping, resequencing and molecular validation, we demonstrate that a G-type lectin receptor-like kinase (lecRLK) mediates the symbiotic interaction between Populus and the ectomycorrhizal fungus Laccaria bicolor. This finding uncovers an important molecular step in the establishment of symbiotic plant-fungal associations and provides a molecular target for engineering beneficial mycorrhizal relationships.