Revealing the Synergistic Effect of Cation and Anion Vacancies on Enhanced Fenton-Like Reaction: The Electron Density Modulation of O 2p-Co 3d Bands.

Defect engineering is considered as a flexible and effective mean to improve the performance of Fenton-like reactions. Herein, a simple method is employed to synthesize Co3O4 catalysts with Co-O vacancy pairs (VP) for peroxymonosulfate (PMS) activation. Multi-scaled characterization, experimental, and simulation results jointly revealed that the cation vacancies-VCo contributed to enhanced conductivity and anion vacancies-VO provided a new active center for the 1O2 generation. Co3O4-VP can optimize the O 2p and Co 3d bands with the strong assistance of synergistic double vacancies to reduce the reaction energy barrier of the "PMS → Co(IV) = O → 1O2" pathway, ultimately triggering the stable transition of mechanism. Co3O4-VP catalysts with radical-nonradical collaborative mechanism achieve the synchronous improvement of activity and stability, and have good environmental robustness to favor water decontamination applications. This result highlights the possibility of utilizing anion and cation vacancy engineering strategies to rational design Co3O4-based materials widely used in catalytic reactions.

Novel roles of an intragenic G-quadruplex in controlling microRNA expression and cardiac function.

Simultaneous dysregulation of multiple microRNAs (miRs) affects various pathological pathways related to cardiac failure. In addition to being potential cardiac disease-specific markers, miR-23b/27b/24-1 were reported to be responsible for conferring cardiac pathophysiological processes. In this study, we identified a conserved guanine-rich RNA motif within the miR-23b/27b/24-1 cluster that can form an RNA G-quadruplex (rG4) in vitro and in cells. Disruption of this intragenic rG4 significantly increased the production of all three miRs. Conversely, a G4-binding ligand tetrandrine (TET) stabilized the rG4 and suppressed miRs production in human and rodent cardiomyocytes. Our further study showed that the rG4 prevented Drosha-DGCR8 binding and processing of the pri-miR, suppressing the biogenesis of all three miRs. Moreover, CRISPR/Cas9-mediated G4 deletion in the rat genome aberrantly elevated all three miRs in the heart in vivo, leading to cardiac contractile dysfunction. Importantly, loss of the G4 resulted in reduced targets for the aforementioned miRs critical for normal heart function and defects in the L-type Ca2+ channel-ryanodine receptor (LCC-RyR) coupling in cardiomyocytes. Our results reveal a novel mechanism for G4-dependent regulation of miR biogenesis, which is essential for maintaining normal heart function.

Exploration of the Hsa-miR-1587-Protein Interaction and the Inhibition to CASK.

Hsa-miR-1587 has been found to be capable of forming G-quadruplex structures and is overexpressed in multiple cancer cell lines. Here, we explored the interactions between miR-1587 and proteins. HuProt™ human proteome microarray was utilized to screen the binding proteins, and it was discovered that CASK could bind to miR-1587 on the base of the G-quadruplex structure. Moreover, reelin and p21, which are downstream of CASK, were downregulated both transcriptionally and translationally by miR-1587, uncovered by q-RT-PCR and Western blot assays. Bioinformatic analysis was performed on STRING and Panther platforms, leading to the discovery that miR-1587 may be involved in intracellular metabolic and transcriptional physiological processes. This study explores the interaction of hsa-miR-1587 with proteins and provides a new strategy for the regulation of G-rich microRNA's function.

Investigation of G-quadruplex formation in the FGFR2 promoter region and its transcriptional regulation by liensinine.

BACKGROUND: Fibroblast growth factor receptor 2 (FGFR2) is overexpressed in breast cancer tissues and cells, and has been shown to be a susceptibility factor for breast cancer. In this study, we found that the G-rich sequences in the FGFR2 promoter region can form G-quadruplexes, which could be the target and inhibitor of the FGFR2 gene. METHODS: Initially, the formation of G-quadruplexes was confirmed by ESI-MS and CD, and DMS footprinting experiments gave the folding pattern of the G-quadruplexes. After luciferase reporter assays revealed that the G-quadruplex could inhibit the activity of the FGFR2 promoter, MS and SPR showed binding affinity and selectivity of the ligand. Then cell culture experiments and ChIP assay showed the bioactivity of the ligand. RESULTS: We found that three G-rich sequences (S1-S3) in the FGFR2 promoter region can form G-quadruplex structures. And a natural alkaloid, liensinine, was found to bind to the S1 G-quadruplex with relative high affinity and selectivity. Cell culture experiments showed that liensinine inhibits FGFR2 activity at both the transcriptional and translational levels. Moreover, chromatin immunoprecipitation assay (ChIP) results showed that liensinine blocks the binding of E2F1 at the transcription factor binding site (TFBS) in the S1 sequence, which is the mechanism through which liensinine inhibits the FGFR2 gene. CONCLUSIONS: A natural alkaloid was discovered to selectively bind to the S1 G-quadruplex with relative high affinity, and therefore inhibited FGFR2 transcription and translation. GENERAL SIGNIFICANCE: Our discovery offers a useful strategy to inhibit FGFR2 transcription, i.e., targeting the G-quadruplex with a natural alkaloid.

Exploration of binding affinity and selectivity of brucine with G-quadruplex in the c-myb proto-oncogene by electrospray ionization mass spectrometry.

RATIONALE: The c-myb gene is a potential therapeutic target for human tumors and leukemias. Active ingredients from natural products may be used as drugs in chemotherapy for human cancers. Here, electrospray ionization mass spectrometry (ESI-MS) was used to probe the formation and recognition of the G-quadruplex structure from the G-rich sequence that is found in the c-myb gene promoter, 5'-GGGCTGGGCTGGGCGGGG-3'. The aim of our study is to evaluate a potential binder for the c-myb gene from natural products, and thereby to modulate c-myb gene expression. METHODS: ESI-MS, as an effective method, was utilized not only to characterize the formation of the G-quadruplex in the c-myb oncogene, but also as a tool to probe the binding characteristics of alkaloid molecules with the target G-quadruplex DNA. RESULTS: ESI-MS results with the support of circular dichroism (CD) spectra demonstrated the formation of an intramolecular parallel-stranded G-quadruplex in the c-myb oncogene promoter. A screening of six alkaloid molecules showed that brucine (P1) had a strong binding affinity to the c-myb G-quadruplex DNA. It is notable that P1 can bind selectively to the c-myb G-quadruplex with respect to duplex DNAs, as well as to G-quadruplexes in other types of gene sequences. According to ESI-MS results, in which the stability was tested by capillary heating and collision-induced dissociation, the binding of P1 could thermally stabilize the c-myb G-quadruplex DNA. CONCLUSIONS: In this work, brucine (P1), an alkaloid molecule, has been found to bind to the intramolecular parallel G-quadruplex in the c-myb oncogene promoter with high affinity and selectivity, and could thermally stabilize the c-myb G-quadruplex DNA, indicating that the binding of P1 has the potential to modulate c-myb gene expression. Copyright © 2015 John Wiley & Sons, Ltd.

Study of G-quadruplexes in the STAT3 gene using electrospray ionization mass spectrometry.

RATIONALE: As a key signal transducer and transcription activator, STAT3 plays a very important role in many cell processes. We found that there were many G-rich sequences existing in the STAT3 gene including its promoter, intron, exon and 3'-flanking regions. These G-rich tracts can form G-quadruplexes under near physiological conditions. In this research, we systemically studied the G-quadruplexes in the STAT3 gene at a whole gene scale for the first time. METHODS: In this research, the formation of G-quadruplexes in the STAT3 gene was probed by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD). Their structures were constructed and refined by a molecular modeling method. We also used ESI-MS to study the recognition of the G-quadruplexes in the promoter of the STAT3 gene by flexible molecules which do not have a planar core like the other common quadruplex ligands. RESULTS: The results based on ESI-MS suggested that the G-quadruplexes in the promoter of the STAT3 gene formed and were further recognized by some small molecules. CONCLUSION: Our research proved that the G-rich sequences in the STAT3 gene could form G-quadruplexes under near physiological conditions. This provides a promising target to study the regulation of cell signal transduction in vivo and drug design that aims to target STAT3 G-quadruplexes. Copyright © 2016 John Wiley & Sons, Ltd.

Associations between recent gay-related stressful events, emotional distress, social support and unprotected anal intercourse behavior among Chinese men who have sex with men.

BACKGROUND: This study was designed to assess the levels of and associations between gay-related stressful events, social support, emotional distress and the number of unprotected anal intercourse partners among Chinese men who have sex with men. METHODS: Using a respondent-driven sampling method, 807 men who have sex with men were recruited in urban areas of northeast China and data were collected via face-to-face interviews. Gay-related stressful events were measured using the Gay-Related Stressful Life Events Scale; levels of depression, anxiety symptoms and social support were measured using the Self-Rating Depression Scale, the Self-Rating Anxiety Scale and the Social Support Rating Scale, respectively. RESULTS: Over a quarter of study participants experienced gay-related stressful events during the preceding 3 months. Their average Self-Rating Depression Scale, Self-Rating Anxiety Scale and Social Support scores differed significantly from the national norm. Gay-related stressful events significantly correlated with anxiety (r = 0.167, p < 0.001), depression (r = 0.165, p < 0.001), social support (r = -0.107, p = 0.002) and number of unprotected anal intercourse partners (r = 0.13, p < 0.001), showing a clear dose-response relationship. CONCLUSION: Gay-related stressful events are common and are significantly associated with emotional distress, lack of social support and high-risk sexual behaviors among Chinese men who have sex with men. Multifaceted approaches are warranted to increase social support and reduce intolerance toward homosexual behaviors and to reduce risky sexual behaviors related to the rapid HIV epidemic among men who have sex with men population in China.

Exploration of the selective recognition of the G-quadruplex in the N-myc oncogene by electrospray ionization mass spectrometry.

RATIONALE: The N-myc gene is a member of the MYC family and its amplification is highly correlated with the pathophysiology of cancers. The G-rich sequence, d(AG3CG3AG3AG3A), in the first intron of N-myc can form a G-quadruplex structure. Small molecules binding to it with high affinity and selectivity may provide a potential approach to modulate the expression of the N-myc gene. METHODS: Electrospray ionization (ESI) mass spectrometry was used to analyze the G-quadruplex formation of the d(AG3CG3AG3AG3A) sequence, and to evaluate the binding affinities and selectivities of natural small molecules with the N-myc G-quadruplex. RESULTS: Enniatin B was found to have the highest binding affinity with this G-quadruplex within the 12 small molecules. Moreover, it also showed a biased selectivity toward the N-myc G-quadruplex compared with the other five G-quadruplexes derived from C-myc, Bcl2, Chl1, c-kit promoters and telomere G-rich sequences. CONCLUSIONS: In this study, we found a natural small molecule, enniatin B, which could bind to the G-quadruplex of the d(AG3CG3AG3AG3A) sequence from the first intron of the N-myc gene with high affinity and selectivity, which may lead to a potential modulation of the N-myc gene.

The genomic sequences near the mir-23b-27b-24-1 cluster form G-quadruplexes and are selectively bound by the natural alkaloid tetrandrine.

RATIONALE: Although the microRNAs miR-23b, miR-27b and miR-24 are located in the same cluster, their expressions in various pathological states are not always comparable. By searching the genomic sequence around mir23b-27b-24-1 in rat, we identified three potential G-quadruplex sequences (PQS) which can fold into different types of G-quadruplexes, including parallel or antiparallel. Natural alkaloids, tetrandrine (TET), displayed different binding affinity with the three G-quadruplexes which may potentially regulate the expression of mir23b-27b-24-1 cluster members. METHODS: Both electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were utilized to detect the formation of G-quadruplexes. Six small molecules were screened by ESI-MS for their binding affinity with three G-quadruplexes, which were evaluated by their IRa values. RESULTS: The results of ESI-MS and CD experiments confirmed the formation of three G-quadruplexes neighboring the mir23b-27b-24-1 cluster; two of them adopted antiparallel G-quadruplexes, another adopted a parallel G-quadruplex. Screening of small molecules by ESI-MS showed tetrandrine had selective binding affinity for the parallel G-quadruplex. G-quadruplex stabilization by tetrandrine was verified by CD variable temperature measurements. CONCLUSIONS: The gene of the mir23b-27b-24-1 cluster harbors three G-quadruplexes with typical sequences and structures. Tetrandrine had a selective binding affinity to the parallel G-quadruplex and stabilized it significantly. Copyright © 2015 John Wiley & Sons, Ltd.

Exploring the formation and recognition of an important G-quadruplex in a HIF1α promoter and its transcriptional inhibition by a benzo[c]phenanthridine derivative.

Four putative G-quadruplex sequences (PGSs) in the HIF1α promoter and the 5'UTR were evaluated for their G-quadruplex-forming potential using ESI-MS, CD, FRET, DMS footprinting, and a polymerase stop assay. An important G-quadruplex (S1) has been proven to inhibit HIF1α transcription by blocking AP2 binding. A benzo[c]phenanthridine derivative was found to target the S1 G-quadruplex and induce its conformational conversion from antiparallel to parallel orientation. The transcriptional suppression of HIF1α by this compound was demonstrated using western blotting, Q-RT-PCR, luciferase assay, and ChIP. Our new findings provided a novel strategy for HIF1α regulation and potential insight for cancer therapy.

Electrospray ionization mass spectrometry probing of binding affinity of berbamine, a flexible cyclic alkaloid from traditional Chinese medicine, with G-quadruplex DNA.

RATIONALE: Classic G-quadruplex binders typically have a large aromatic core and interact with G-quadruplexes through π-π stacking with the quartets. There are rather few reports on natural flexible cyclic molecule from traditional Chinese medicine which has high binding affinity with G-quadruplex. METHODS: Electrospray ionization mass spectrometry (ESI-MS) experiments were performed to evaluate the binding affinities of a natural alkaloid, berbamine, with seven G-quadruplexes. Furthermore, we utilized autodock4 analysis to uncover the binding mode of berbamine with the G-quadruplex. RESULTS: ESI-MS experiments showed that berbamine has the best binding affinity toward the (GGA)8 G-quadruplex compared with the other six G-quadruplexes. Autodock4 analysis indicated that berbamine interacted with the (GGA)8 G-quadruplex through hydrogen bonding and van der Waals forces with a binding site at the lateral groove formed by DG8-DA9-DA15-DG16. CONCLUSIONS: In this study, we discovered a novel G-quadruplex binder, berbamine, which has high binding affinity toward the (GGA)8 G-quadruplex. This study provided important clues regarding the probing of small molecule from traditional Chinese medicine which can target the G-quadruplex with high affinity.

Analysis of urinary methylated nucleosides of patients with coronary artery disease by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry.

RATIONALE: In recent years, methylated nucleosides have been considered to be potential biomarkers to human diseases. The early diagnosis of coronary artery disease (CAD) is an unsolved problem in clinical cardiology. The aim of our study is to evaluate whether urinary methylated nucleosides can serve as useful biomarkers for CAD. METHODS: A solid-phase extraction (SPE) column was used for extraction and purification of methylated nucleosides in urine, and high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ESI-MS/MS) was employed for specific, sensitive and rapid determination of the urinary methylated nucleosides from patients with cardiac events. RESULTS: We have analyzed six methylated nucleosides (N(3)-methylcytidine, N(1)-methyladenosine, N(6)-methyladenosine, N(2)-methylguanosine, N(1)-methylguanosine and N(2),N(2)-dimethylguanosine) in urine from 51 patients with CAD and 25 non-CAD controls by HPLC/ESI-MS/MS using selective reaction monitoring (SRM). Our results have shown that there were significant differences in the N(6)-methyladenosine levels from the patients and the non-CAD controls in the urine analyzed. CONCLUSIONS: The results have indicated that HPLC/ESI-MS/MS is a highly specific and sensitive tool to measure urinary methylated nucleosides for analysis of CAD. Our result has revealed that the evaluation of urinary methylated nucleosides might be helpful in the analysis of CAD by liquid chromatography/mass spectrometry. Therefore, this N(6)-methyladenosine is worthy of further studies in the near future.

A perylene derivative regulates HIF-1α and Stat3 signaling pathways.

It is becoming increasingly evident that improving the cure rate of many cancers will require treatment regimens hit more than one validated tumor targets. Developing an anti-cancer agent that targets two oncoproteins simultaneously is a promising strategy for accomplishing this goal. It would be expected to promote drug efficacy, reduce therapy-resistant without introducing additional toxic side effects. HIF-1α is a key regulator of the cellular response to hypoxia and is involved in tumor angiogenesis and cancer cell survival, glucose metabolism, and invasion. Stat3 has several oncogenic functions, including suppression of anti-tumor immune responses and promotion of inflammation. Recently, we have identified the perylene derivative, TEL03, as a dual inhibitor that targets both HIF-1α and Stat3. TEL03 blocks the expression of both HIF-1α and Stat3, regulated oncogenes (e.g., Bcl-2, VEGF, Glut1, and others) in cancer cells, and induces cancer cell apoptosis. The results demonstrated that: (i) TEL03 blocks Stat3 phosphorylation, and inhibits Stat3 transcriptional activity; and (ii) interferes the binding of HIF-1α to p300/CBP inducing its degradation by proteasomes under hypoxic conditions. Our in vivo tests showed that as a dual inhibitor, TEL03 dramatically inhibited tumor growth, and provided the evidence that targeting both HIF-1α and Stat3 simultaneously could be a promising strategy for breast and pancreatic cancer therapies.

[The Detections, functions and regulations of G-quadruplex].

G-quadruplex structure was found recently as a special secondary structure of Nucleic acid. It can be formed easily and widely in vivo and has important biological functions. Researchers have detected the formation of G-quadruplex in vitro and solved its crystal structure by using specific fluorescent probes, antibodies, etc., which are constantly discovered or synthesized. G-quadruplex structures are distributed widely not only in the significantly functional region as telomere, promoter, gene extron, but also in the 5 'untranslated region (5'UTR), intron and 3'flanking region (3'UTR) of RNA. They play vital roles in the extension of telomeres, DNA replication, transcription, meiosis, recombination, and otherpivotal life processes. Additionally, they can exert anti-tumor, anti-virus, inhibiting angiogenesis and other important functions. Currently anticancer drugs based on G-quadruplex structure have entered clinical trials and obtained good curative effects. G-quadruplex can be regulated endogenously by the methylation and the interaction with many proteins and stays in a balanced content and morphology. Some exogenous small molecules can also play such regulatory roles. This paper will systematically summarize detection methods, special functions and regulation of G-quadruplex in the fields of chemistry, biology and medicine.

Insight into the fate of nitrogen during char thermal conversion and the influence mechanism of potassium: A theoretical research.

Nitrogen oxides (NOₓ) are primary pollutants produced during biomass combustion. During the devolatilization stage, char nitrogen (char(N)) is formed. In the subsequent char combustion stage, char(N) can decompose directly into NOx precursors or engage in heterogeneous reactions with O2 or NO to form NO and N2. Nonetheless, a comprehensive understanding of the reaction mechanisms and competitiveness of char(N) migration, especially the influence of the alkali metal potassium (K) present in biomass, remains incomplete. Building on the Zigzag char(N) models, the present study delves into the migration reactions of char(N), assessing their competitive dynamics through the integration of density functional theory, electronic structure analysis, and conventional transition state theory. Furthermore, it examines the impact of K on char(N) conversion. The competitiveness of the heterogeneous reactions follows the sequence: heterogeneous reduction of NO to N2 > heterogeneous oxidation of char(N) to NO > decomposition of char(N) to NOx precursors. Moreover, the formation of HCN is more favorable than NH3 production. The successive conversion from char(N) to NO and then to N2 is the predominant migration route for char(N), with NO generation as the pivotal step. The less preferred char(N) migration route involves decomposition to NH3/HCN, followed by oxidation to NOx within the main combustion zone, which cannot be mitigated by char. K can accelerate NO generation and sustain the primacy of the heterogeneous NO reduction, consequently enhancing the oxidation-reduction process of char(N). As a result, K plays a constructive role in managing NOx emissions during the thermal conversion of char.

Assessing the efficacy of aluminum metal clusters Al13 and Al15 in mitigating NO2 and SO2 pollutants: a DFT investigation.

The present investigation delves into the adverse environmental impact of atmospheric pollutant gases, specifically nitrogen dioxide (NO2) and sulfur dioxide (SO2), which necessitates the identification and implementation of effective control measures. The central objective of this study is to explore the eradication of these pollutants through the utilization of aluminum Al13 and Al15 metal clusters, distinguished by their unique properties. The comprehensive evaluation of gas/cluster interactions is undertaken employing density functional theory (DFT). Geometric optimization calculations for all structures are executed using the ωB97XD functional and the Def2-svp basis set. To probe various interaction modalities, gas molecule distribution around the metal clusters is sampled using the bee colony algorithm. Frequency calculations employing identical model chemistry validate the precision of the optimization calculations. The quantum theory of atoms in molecules (QTAIM) and natural bond orbital (NBO) methodologies are applied for the analysis of intermolecular interactions. This research establishes the robust formation of van der Waals attractions between the investigated gas molecules, affirming aluminum metal clusters as viable candidates for the removal and control of these gases.

Electrospray ionization mass spectrometric exploration of the high-affinity binding of three natural alkaloids with the mRNA G-quadruplex in the BCL2 5'-untranslated region.

RATIONALE: The BCL2 gene encodes an integral outer mitochondrial membrane protein (25 kDa) which regulates the apoptotic death of cells. There is a 25-nucleotide G-rich sequence in the 5'-untranslated region (5'-UTR) of the BCL2 mRNA, which can adopt a G-quadruplex structure. Small molecules which could tightly bind to this structure have a potential function in the regulation of the expression of the BCL2 mRNA. METHODS: The 25-mer oligonucleotide (5'-G(5)CCGUG(4)UG(3)AGCUG(4)-3') was synthesized by TaKaRa Biotechnology Co., Ltd. (TaKaRa, Dalian) with high-performance liquid chromatography (HPLC) purification. Electrospray ionization (ESI) mass spectrometry (MS) was used to probe the binding properties of natural small molecules (P) with the mRNA G-quadruplex in the BCL2 5'-UTR (BCL2Q). Collision-induced dissociation (CID) mass spectrometry and circular dichroism (CD) spectroscopy were performed to evaluate the stabilization of the mRNA G-quadruplex and its complexes. RESULTS: The results from ESI mass spectra showed that three natural alkaloids (nitidine, palmatine, and jatrorrizine) have high binding affinities to the mRNA G-quadruplex with the binding stoichiometry ranging from 1:1 to 3:1. CID mass spectrometry results revealed that the G-quadruplex-ligand complex lost bases first rather than losing the binding molecules. Increases in the T(m) values of the complexes of the G-quadruplex with the natural alkaloids in the CD melting experiments demonstrated that the three small molecules can stabilize the G-quadruplex structure. CONCLUSIONS: Three natural small molecules were found to have very high binding affinities to the mRNA G-quadruplex and stabilize this structure. The properties of these alkaloids revealed promising potentials to regulate the expression of the BCL2 protein from the posttranscriptional pathway.

Different effects of vaccine on VST in critical and non-critical COVID-19 patients: A retrospective study of 363 cases.

Aim: To explore the risk factors of prolonged viral shedding time (VST) in critical/non-critical COVID-19 patients during hospitalization. Methods: In this retrospective study, we enrolled 363 patients with SARS-CoV-2 infection admitted in a designated hospital during the COVID-19 outbreak in Nanjing Lukou International Airport. Patients were divided into critical (n = 54) and non-critical (n = 309) groups. We analyzed the relationship between the VST and demographics, clinical characteristics, medications, and vaccination histories, respectively. Results: The median duration of VST was 24 d (IQR, 20-29) of all patients. The VST of critical cases was longer than non-critical cases (27 d, IQR, 22.0-30.0 vs. 23 d, IQR 20-28, P < 0.05). Cox proportional hazards model showed that ALT (HR = 1.610, 95%CI 1.186-2.184, P = 0.002) and EO% (HR = 1.276, 95%CI 1.042-1.563, P = 0.018) were independent factors of prolonged VST in total cases; HGB (HR = 0.343, 95%CI 0.162-0.728, P = 0.005) and ALP (HR = 0.358, 95%CI 0.133-0.968, P = 0.043) were independent factors of prolonged VST in critical cases, while EO% (HR = 1.251, 95%CI 1.015-1.541, P = 0.036) was the independent factor of prolonged VST in non-critical cases. Vaccinated critical cases showed higher levels of SARS-CoV-2-IgG (1.725 S/CO, IQR 0.3975-28.7925 vs 0.07 S/CO, IQR 0.05-0.16, P < 0.001) and longer VSTs (32.5 d, IQR 20.0-35.25 vs 23 d, IQR 18.0-30.0, P = 0.011) compared with unvaccinated critical patients. Fully vaccinated non-critical cases, however, presented higher levels of SARS-CoV-2-IgG (8.09 S/CO, IQR 1.6975-55.7825 vs 0.13 S/CO IQR 0.06-0.41, P < 0.001) and shorter VSTs (21 d, IQR 19.0-28.0 vs 24 d, IQR 21.0-28.5, P = 0.013) compared with unvaccinated non-critical patients. Conclusions: Our results suggested that risk factors of prolonged VST were different between critical and non-critical COVID-19 patients. Increased level of SARS-CoV-2-IgG and vaccination did not shorten the VST and hospital stay in critical COVID-19 patients.

Mass spectrometry of G-quadruplex DNA: formation, recognition, property, conversion, and conformation.

G-quadruplexes are special secondary structures formed from G-rich sequences of DNA, and have proven to play important roles in a number of biological systems, including the regulation of gene transcription and translation. The highly distinctive nature of G-quadruplex structures and their functions suggest that G-quadruplexes can act as novel targets for drug development. As a highly sensitive analytical tool, mass spectrometry has been widely used for the analysis of G-quadruplex structures. Electrospray-ionization mass spectrometry, in particular, has found captivating applications to probe interactions between small molecules and G-quadruplex DNA. In this review, we will discuss: (1) mass spectrometry probing of the formation, binding affinity, and stoichiometry between G-quadruplexes and small molecules; (2) stabilization and collision-dissociation behavior of G-quadruplex DNA; (3) the exploration of the equilibrium transfer between a G-quadruplex and duplex DNA; and (4) the ESI-MS analysis of the conversion of intramolecular and intermolecular G-quadruplexes. Finally, we will also introduce the application of new techniques in the analysis of G-quadruplex conformation, such as ion-mobility and infrared multiphoton-dissociation mass spectrometry. We believe that, with the new technical developments, mass spectrometry will play an unparalleled role in the analysis of the G-quadruplex structures.

Investigation of non-covalent interaction of natural flexible cyclic molecules with telomeric RNA G-quadruplexes by electrospray ionization mass spectrometry.

RATIONALE: Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity. METHODS: The 12-mer and 24-mer telomeric RNA sequences, r(UAGGGUUAGGGU) and r(UAGGGUUAGGGUUAGGGUUAGGGU), were synthesized by TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa, Dalian) with high-performance liquid chromatography (HPLC) purification. Electrospray ionization ion-trap mass spectrometry was used to evaluate the binding affinities of three natural flexible cyclic molecules, tetrandrine, fangchinoline and cepharanthine, with the telomeric RNA G-quadruplexes. The fragmentation pathways of the G-quadruplexes and G-quadruplex-ligand complexes were investigated by tandem mass spectrometry. RESULTS: the natural flexible cyclic molecules were found to have high binding affinities to the 12-mer and 24-mer RNA G-quadruplexes with stoichiometry of 1:1 to 3:1. Collision-induced dissociation tandem mass spectrometry shows that the G-quadruplex-ligand complexes lose neutral ammoniums first and the small molecule ligand subsequently. Besides, among the three flexible cyclic molecules, cepharanthine binds most tightly to the RNA G-quadruplexes than tetandrine and fangchinoline. CONCLUSIONS: Three flexible cyclic small molecules were found to be potential telomeric RNA G-quadruplex ligands, especially cepharanthine, which has high affinity and binds most tightly to the RNA G-quadruplexes. These findings may provide further implications in the regulation of telomeric RNA and telomerase activity.